Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands...

15
Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that directs the cell’s functions.

Transcript of Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands...

Page 1: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

Chromatid (97) – The identical rods of chromatin in chromosomes.

Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that directs the cell’s functions.

Page 2: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

DNA NOTESCREATURE DUEPASS BACK TEST

1. DNA is part of our definition of a living organism.

2. DNA is found in all living things.

3. DNA is the “blueprint” of life.

11/12/13…. DNA stands for deoxyribonucleic acid.

Page 3: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

FINISH DNA NOTESDNA VOCABULARYDNA PROJECT ASSIGNED DUE: 12/3 GO OVER TESTPASS BACK GRADED WORK

•Sugar + phosphate + base = nucleotide. •The sides of the DNA ladder are made of sugars and phosphate atoms.•A always pairs with T in DNA. •C also pairs with G in DNA.

11/13/13…. DNA stands for deoxyribonucleic acid.

Page 4: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

DNA Notes

Using page 131 in your book, complete the Discover Activity (write you answers on your DNA Notes).

Answers: “Where are genes located?” “On chromosomes.”– – – / – • / – • – • / • • • • / • – • / – – – / – – /

– – –/ • • • / – – –/ – –/ • / • • • /

Page 5: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

DNA Notes

Genes control protein production in cells.Proteins help determine the size, shape,

color, and many other traits of an organism.

A gene is a section of DNA that contains the information to code for one specific protein.

Page 6: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

The structure of DNA is called a double helix.Backbone/Sides

phosphate and sugars

Bases/Rungs 4 different Nitrogen containing bases

Adenine – AThymine – TGuanine – GCytosine - C

Page 7: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

Adenine only pairs with ThymineGuanine only pairs with CytosineThe following is an example of a DNA

code. Can you write the matching code? (Remember your pairs!)CGGTAGCCATAATTCGCTCTCCAATAGGCTTCATTAAGCGAGAGGTTATCCGAAGT

Page 8: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

Today 11/14

Color the structure of DNA using Mrs. Woods’ Coloring guidelines

Correctly build the structure of DNACorrectly say the word:

De oxy ribo nucleic acid

Page 9: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

Chromosome

DNA Molecule

Nitrogen Bases

Page 10: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

Chromosome

DNA Molecule

Nitrogen Bases

“This model—the double helix—with its biological implications ranks as the greatest contribution to biology since the work of Darwin and Mendel, something that is obvious enough from the fact that the acronym DNA and the image of the double helix are among the icons of late twentieth-century culture” (17-18, 1999). Collin Patterson

Page 11: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

The Structure of DNA

The Backbone & the Bases…..2.28.1953

Page 12: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

DNA is the Blueprint of Life

Genetic material is responsible for trait similarities and differences between all organisms.

Nucleic Acids come in two major forms: RNA and DNA. This chemical found in all living things is the blueprint of life.

Page 13: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

Mutations

A mutation is any change in a gene or chromosome.

A mutation in a body cell (somatic), such as a skin cell, will not be passed on to the offspring.

A mutation in a sex cell can be passed on to an offspring.

Page 14: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

Types of Mutations

One or more base substitutions: Original sequence: ATTCGG Substitution: ATTAGG

One or more bases are deleted: Original sequence: ATTCGG Deletion: ATTGG

Chromosomes fail to separate during meiosis. Too many chromosomes Not enough chromosomes

Page 15: Chromatid (97) – The identical rods of chromatin in chromosomes. Chromatin (62) – Thin strands of DNA in the nucleus that contain genetic material that.

Effects of mutations

A mutation is harmful if it reduces an organisms chance for survival or reproduction. Ex. Down Syndrome is caused by having 3 chromosomes

instead of 2 in the 21st pair.

A mutation is helpful if it increases an organisms chance of survival or reproduction. Ex. Sickle-cell disease is caused by a codominant allele.

If you get one allele, you are resistant to Malaria.

Some mutations are neutral. Ex. Albinism, caused by a recessive allele, results in

lighter skin and hair pigment.