CHEMICAL SIGNALING IN Caenorhabditis elegans AND...

CHEMICAL SIGNALING IN Caenorhabditis elegans AND INTERACTIONS WITH MICROORGANISMS

By

JUNGSOO HAN

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2016

To my family

4

ACKNOWLEDGMENTS

I would like to thank my advisor Rebecca A. Butcher for her support and

guidance during my doctoral course at the University of Florida. She gave me an

opportunity to work on interesting projects and provided advice whenever I had

difficulties on projects. Without her patience for slow progress on projects, I might not

have been able to finish my studies. I will always be thankful to her for that.

I would like to acknowledge my committee: Dr. Nicole Horenstein, Dr. Steven

Bruner, Dr. Y. Charles Cao, and Dr. Keith Choe for their support.

I would like to thank all of our group members from the beginning to now for the

support we gave to each other. In particular, I would like to thank Dr. Jaime Noguez

who inspired me regarding a career path, Dr. Satya Chinta and Dr. Rachel Jones who

synthesized molecules for use in my research, Xinxing Zhang who was always

supportive and gave me good suggestions, and Likui Feng, Yue Zhou, and Yuting

Wang who were kind and made lab work more fun. I will not forget the moments that

we had together not only inside, but also outside of school.

I would like to thank Jeongah Lee and Yousoon Lee who were more than friends

and like sisters to me in the department of chemistry at UF. We shared the same

distress in studying in the USA, commiserated that we missed home, and encouraged

each other to go forward.

Lastly, I would like to thank my family who have been extremely supportive and

always cherished me. Especially, when I suffered from deep depression in past years, I

could survive from the condition and resume work because of them.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS .................................................................................................. 4

LIST OF TABLES ............................................................................................................ 7

LIST OF FIGURES .......................................................................................................... 8

LIST OF ABBREVIATIONS ........................................................................................... 10

ABSTRACT ................................................................................................................... 11

CHAPTER

1 INTRODUCTION .................................................................................................... 14

1.1 Caenorhabditis elegans as a Model Organism ................................................. 14 1.2 Development of Dauer and Two Chemical Signals ........................................... 15 1.3 Nomenclature of Ascarosides ........................................................................... 17 1.4 Role of the Ascarosides in Controlling Various Behaviors ................................ 18 1.5 Biosynthesis of the Ascrarosides ...................................................................... 20

2 BIOSYNTHESIS OF METHYLKETONE MOIETY IN ASCAROSIDES IN Caenorhabditis elegans .......................................................................................... 23

2.1 Background ....................................................................................................... 23 2.2 Result and Discussion ...................................................................................... 24

2.2.1 Recombinant Expression and in vitro Activities of β-Oxidation Enzymes ....................................................................................................... 24

2.2.2 Ascaroside Production in an acot-1 Mutant ............................................. 28 2.2.3 Ascaroside Production in an acot-1 Overexpression Strain ..................... 29 2.2.4 Site of ACOT-1 Expression ..................................................................... 31

2.3 Summary and Future Directions ....................................................................... 33 2.4 Experimental ..................................................................................................... 34

2.4.1 C. elegans Strains ................................................................................... 34 2.4.2 C. elegans Liquid Cultures ...................................................................... 34 2.4.3 Plasmid Construction ............................................................................... 35 2.4.4 Protein Expression and Purification ......................................................... 36 2.4.5 Synthesis of CoA-Thioesters of Ascarosides ........................................... 37 2.4.6 Enzyme Assays ....................................................................................... 37 2.4.7 LC-MS Analysis ....................................................................................... 37 2.4.8 pacot-1::gfp Transcriptional Reporter Strain ............................................ 38 2.4.9 acot-1 Overexpression and Rescue Strains ............................................ 39 2.4.10 Quantitative RT-PCR ............................................................................. 39

6

3 Caenorhabditis elegans USES AN ASCAROSIDE PHEROMONE AS A SENTINEL TO MONITOR ITS MICROBIAL ENVIRONMENT ................................ 40


3.2.1 Synthesis of Deuterium-Labeled Asc-C6-MK and Glc-Asc-C6-MK ......... 42 3.2.2 C. elegans Does Not Attach or Cleave the Glucosyl Group under

Various Culture Conditions ............................................................................ 43 3.2.3 Certain Bacterial Species Can Cleave the Glucosyl Group ..................... 45 3.2.4 Effect of M. nematophilum on Ascaroside Production and Dauer

Formation ...................................................................................................... 47 3.3 Summary and Future Directions ....................................................................... 48 3.4 Experimental ..................................................................................................... 49

3.4.1 Materials and Methods ............................................................................ 49 3.4.2 Synthesis of d2-Asc-C6-MK and d2-Glc-Asc-C6-MK ................................ 49 3.4.3 C. elegans Liquid Culture Conditions ...................................................... 50 3.4.4 Identification of B20 by 16S rRNA Gene Sequencing ............................. 51 3.4.5 Testing Bacterial Strains for Glucosidase Activity ................................... 52 3.4.6 Sample Preparation ................................................................................. 53 3.4.7 LC-MS Analysis ....................................................................................... 53

4 CHARACTERIZATION OF BACTERIAL CUES THAT CONTROL DAUER DEVELOPMENT IN Caenorhabditis elegans .......................................................... 54


4.2.1 Identification of Defined Nutrients That Promote Dauer Recovery in C. elegans ......................................................................................................... 56

4.2.2 Identification of Small Molecules Secreted by Bacteria That Promote Dauer Recovery in C. elegans ...................................................................... 62

4.3 Future Directions............................................................................................... 69 4.3.1 Mechanism of Action of the Food Signal Molecules ................................ 69 4.3.2 Effect of the Food Signal on Metabolism and Fat Accumulation ............. 70 4.3.3 Effect of the Food Signal on Lifespan ...................................................... 70

4.4 Experimental ..................................................................................................... 71 4.3.1 Preparation of CeHR Medium ................................................................. 71 4.3.2 Activity-Guided Fractionation of Bacteria (OP50)-Conditioned Medium .. 71 4.3.3 Bacteria Strains and Preparation of Bacteria-Conditioned Media ............ 72 4.3.4 C. elegans Strain and Maintenance ........................................................ 73 4.3.5 Egg Preparation and Dauer Formation .................................................... 73 4.3.6 Development of Dauer Recovery Assay .................................................. 74

LIST OF REFERENCES ............................................................................................... 75

BIOGRAPHICAL SKETCH ............................................................................................ 83

7

LIST OF TABLES

Table page 3-1 Bacterial strains collected from rotting apples, a natural habitat for wild C.

elegans. .............................................................................................................. 47

8

LIST OF FIGURES

Figure page 1-1 Scanning electron micrographs of the head showing the external

morphological differences between the L2 larval stage (A) and the dauer larval stage (B).. ................................................................................................. 16

1-2 Life cycle of C. elegans and two antagonistic chemical signals in dauer development. ...................................................................................................... 16

1-3 Structures of potent dauer pheromone ascarosides. .......................................... 17

1-4 Modular structure of ascarosides and nomenclature. ......................................... 18

1-5 Structures of male-attracting ascarosides. ......................................................... 19

1-6 Structures of potent aggregation pheromones. .................................................. 20

1-7 Proposed biosynthetic pathway of ascarosides and ascaroside profiles of wild type and β-oxidation mutants. ..................................................................... 22

2-1 SDS-PAGE of three -oxidation enzymes. ......................................................... 25

2-2 Proposed biosynthetic pathway of short-chain (ω-1)-ascarosides (A) and ω-ascarosides (B).. ................................................................................................. 26

2-3 in vitro activities of β-oxidation enzymes against (A) asc-C9-CoA, (B) asc-C7-CoA, and (C) asc-ωC5-CoA, and (D) in vitro activities of β-oxidation enzymes without DAF-22 against asc-C7-CoA. ................................................................. 27

2-4 Ascaroside production of acot-1 mutant compared with WT. ............................. 29

2-5 Proposed role of ACOT-1 in biosynthetic pathway of the ascaroside. ................ 30

2-6 Ascaroside profile of acot-1 rescue strain compared with acot-1. ....................... 31

2-7 Ascaroside profile of acot-1 overexpression strain compared with wild type. ..... 32

2-8 ACOT-1 expression in the intestine.. .................................................................. 33

3-1 C. elegans dauer and mating pheromones. ........................................................ 40

3-2 Synthesis of deuterium-labeled ascarosides (A) and their use in feeding experiments with C. elegans (B, C). ................................................................... 44

3-3 Streaked bacteria B20 on an LB-agar plate (A), effect of B20, C. elegans-associated bacteria, and CBX102 on glucosyl cleavage (B, C). ......................... 46

9

3-4 Ascaroside production of WT worms fed with different bacteria. ........................ 48

4-1 Structure of the amphid opening in a head (A) and exposed amphid neurons (B). ...................................................................................................................... 55

4-2 Pathways in both normal developmental stages and dauer stage. ..................... 56

4-3 Ratio of recovery of the complete CeHR medium, the milk, and combined 13 defined components without milk. ....................................................................... 58

4-4 Ratio of recovery of individual component of CeHR medium. ............................ 58

4-5 Ratio of recovery in the subtractive assay of the CeHR medium. ....................... 59

4-6 Ratio of recovery in the additive assay of the CeHR medium. ............................ 60

4-7 Ratio of recovery in the subtractive assay of the ingredients of vitamin mix in the CeHR medium. ............................................................................................. 61

4-8 Dauer recovery assay with LB medium and OP50-conditioned LB medium. .... 63

4-9 Structure of cyclodipeptide containing proline. ................................................... 64

4-10 NMR spectra of the active fractions and the synthesized molecules. ................. 65

4-11 The ratio of recovery of bacteria-conditioned media from various strains of bacteria. .............................................................................................................. 67

4-12 The ratio of recovery of OP50- and PA14-conditioned medium.......................... 67

10

LIST OF ABBREVIATIONS

ACOT Acyl-CoA thioesterase

ACOX Acyl-CoA oxidase

Asc Ascaroside

DAF-22 3-ketoacyl-CoA thiolase

DHS-28 (3R)-hydroxyacyl-CoA dehydrogenase

Glc Glucosyl

HPLC High Performance Liquid Chromatography

IC Indole-3-carbonyl

LC-MS Liquid Chromatography-Mass Spectrometry

MAOC Enoyl-CoA hydratase

MK Methylketone

NGM Nematode Growth Media

Ni-NTA Nickel-nitriloacetic acid

NMR Nuclear Magnetic Resonance

PABA Para-aminobenzoic acid

qRT-PCR Quantitative Real Time Polymerase Chain Reaction

SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis

WT Wild Type

11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

CHEMICAL SIGNALING IN Caenorhabditis elegans AND INTERACTIONS WITH

MICROORGANISMS

By

Jungsoo Han

May 2016

Chair: Rebecca A. Butcher Major: Chemistry

The nematode Caenorhabditis elegans uses two groups of small signaling

molecules, the dauer pheromone and an uncharacterized food signal, in deciding

whether to enter a specific larval stage called the dauer. The dauer has a distinct

morphology and is stress-resistant and non-aging. In the development of the dauer

stage, the dauer pheromone promotes dauer formation while the food signal inhibits

dauer formation. The dauer pheromone consists of several ascarosides, derivatives of

the dideoxysugar ascarylose with different fatty acid-derived side chains, while the food

signal is structurally uncharacterized. Among the many ascarosides produced by C.

elegans, two of them contain a methylketone (MK) moiety in their side chains, asc-C6-

MK and glc-asc-C6-MK. The biosynthesis of these ascarosides is studied in Chapter 2

and 3, while the constituents of the food signal are studied in Chapter 4.

Peroxisomal β-oxidation cycles shorten the side chains of long-chain ascarosides

to the short-chain ascaroside pheromones. In Chapter 2, I reconstitute this β-oxidation

process in vitro and show that the last three steps in each β-oxidation cycle are

catalyzed by MAOC-1, DHS-28, and DAF-22, even for cycles that process very short-

chain ascarosides. Absence of DAF-22 in the in vitro reaction leads to formation of

12

ascarosides with side chains that terminate in a MK group. I also identify an acyl-CoA

thioesterase, ACOT-1, that is essential for the biosynthesis of ascarosides with side

chains containing an MK group. ACOT-1 may enable C. elegans to produce

ascarosides of specific side-chain lengths that contain an MK group. Ascarosides with

MK groups are important components of both the dauer pheromone and the sex

pheromone. Thus, an understanding of the biosynthesis of this group will shed light on

how C. elegans controls its chemical language and communicates to other worms.

The chemical structures of the dauer pheromone, asc-C6-MK, and the mating

pheromone differ only in that the latter is modified with a glucosyl group. In Chapter 3,

in order to monitor whether inter-conversion occurs between these two pheromones,

deuterium-labeled versions of the two pheromones were used in feeding experiments. I

demonstrate that certain Microbacterium species, including the C. elegans pathogen, M.

nematophilum, cleave the glucosyl group, thereby converting a mating pheromone into

a dauer pheromone. As dauer formation leads to protection from M. nematophilum and

other bacterial infections, C. elegans may use glc-asc-C6-MK to monitor for pathogens

and increase its dauer formation in response. Our results show that the chemical

message produced by C. elegans can be modified by microorganisms in its

environment.

The food signal, which inhibits dauer formation, consists of unidentified small-

molecule cues that are secreted by bacteria. These cues are thought to bind to

receptors on chemosensory neurons and promote reproductive growth via the

insulin/IGF-1 pathway. Because the food signal molecules are highly polar and easily

degraded, they remain structurally uncharacterized. In Chapter 4, an approach is

13

described to identify the food signal molecules using a dauer recovery assay in which

food signal candidates are added to dauers to determine whether the candidates induce

dauer recovery. Defined nutrients and bacteria-conditioned medium were tested in the

bioassay. The bacteria-conditioned medium was fractionated by several

chromatographic techniques, and the fractions were tested in the dauer recovery assay.

The chemical structures of the compounds in the active fractions were analyzed using

nuclear magnetic resonance (NMR) spectroscopy and liquid chromatography mass

spectrometry (LC-MS) to elucidate their structures. Once the food signal molecules are

fully characterized, their biological mechanisms such as the neurons and receptors that

they target and how the molecules regulates downstream signaling by the insulin/IGF-1

pathway can be studied. Because the insulin/IGF-1 pathway affects metabolism and

the aging process as well as dauer development, the effects of the food signal

molecules on fat storage and lifespan will also be studied. The role of insulin/IGF-1

pathway in aging and metabolism is conserved in higher organisms and studying the

environmental signals that control this pathway in C. elegans could give key insight into

how these processes are regulated in humans.

14

CHAPTER 1 INTRODUCTION

1.1 Caenorhabditis elegans as a Model Organism

C. elegans is a small (approximately 1mm in length), free-living soil nematode

that serves as an ideal model organism for the study of animal development, behavior,

and neurobiology. The attributes that make it a desirable model system include the

following: it has a short life cycle (about 3 days), it can easily be cultivated in the

laboratory on a lawn of bacteria (1), it is primarily hermaphroditic, and it produces a

large number of progeny per animal (250-350) (2). The expression of specific genes

can be easily knocked down using the RNA-mediated interference (RNAi) technique (3).

Furthermore, genes can be edited or removed using the genome-editing technique

CRISPR-Cas (4). These factors make C. elegans a powerful tool for genetic studies.

C. elegans is a transparent multicellular-organism having 959 somatic cells including

about 300 cells for nervous system (5) and the developmental lineage of every cell has

been determined. Connections between all of its neurons have been mapped.

Although its nervous system is relatively simple, C. elegans displays complex behaviors

and forms of learning and memory. C. elegans has 30 pairs of chemosensory neurons

and uses them to detect and discriminate a wide range of chemical compounds.

Chemical signals enable C. elegans to interpret its environment and interact not only

with its own species, but also with other nematodes and microorganisms in the

environment. C. elegans is a good system for studying chemical signaling because

once chemical signals are identified, their target receptors and neurons can be

identified. Furthermore, about 40% of C. elegans proteins have homologs in humans

15

(6,7) and thus, studies of C. elegans may provide insight into signaling pathways in

humans.

1.2 Development of Dauer and Two Chemical Signals

C. elegans develops from an egg through four different larval stages (L1-L4) and

then reaches the adult stage which can lay eggs. The adult worm can live 2 to 3 weeks

in a suitable environment; however, in unfavorable conditions such as high population

density, limited food supply, and high temperature, the L2 larval stage worm develops

into an alternative L3 larval stage at second molt, known as the dauer. The dauer is

non-feeding and non-aging stage and it enables the nematodes to survive in harsh

conditions for several months (8,9). The dauer can be easily distinguished from other

larval stages based on its morphology. The dauer is thinner and darker than L3 stage

worms because of shrinkage of the hypodermis and it is covered with a thickened

cuticle to protect its body from harsh environmental conditions (5,8). In this stage, its

mouth becomes closed (Figure 1-1) and pharyngeal pumping is suppressed (1,10),

which requires the dauer to derive its energy by metabolizing fat in the body that it

accumulates during dauer development (11).

The nematode makes the decision to enter dauer based on two types of

chemical cues: (1) The dauer pheromone ascarosides, which the worm secretes into its

environment and uses to sense its population density, (2) The food signal, which is

secreted by bacteria and which the worm uses to sense food availability (12,13).

Whereas the pheromone promotes dauer formation and inhibits dauer recovery, the

food signal inhibits dauer formation and induces dauer recovery (Figure 1-2). Unlike the

dauer pheromone which consists of five ascarosides with different fatty-acid side chains

16

(12,14-19) (Figure 1-3), the food signal is structurally uncharacterized. More details for

these two chemical signals will be described in Chapters 2 and 4, respectively.

Figure 1-1. Scanning electron micrographs of the head showing the external

morphological differences between the L2 larval stage (A) and the dauer larval stage (B). The figure was reprinted with permission from C. elegans II. 2nd edition. Riddle DL, Blumenthal T, Meyer BJ, et al., editors. Cold Spring Harbor (NY), Copyright 1997 Cold Spring Harbor Laboratory Press.

Figure 1-2. Life cycle of C. elegans and two antagonistic chemical signals in dauer

development. The figure was adapted with permission from N. Fielenbach and A. Antebi, Genes & Dev. 2008, 22, 2149-2165. Copyright 2008 Cold Spring Harbor Laboratory Press.

17

Figure 1-3. Structures of potent dauer pheromone ascarosides.

1.3 Nomenclature of Ascarosides

Since the structures of pheromone secreted by C. elegans have been

discovered, several nomenclatures have been applied to the ascarosides by different

research groups. In this thesis, the nomenclature used is based on the modular

structure of the ascarosides: head group-asc-()()C#-terminus group (20). The head

group indicates the group attached to the 3,6-dideoxysugar ascarylose at the 2’ or 4’

positions, such as indole-3-carbonyl (IC) and glucosyl (Glc). Ascarosides have a fatty

acid-derived side chain that is attached to the ascarylose sugar at either the side chain’s

penultimate (-1) or terminal () carbon and that is sometimes unsaturated () at the -

position. The number of carbons in the side chain is indicated with a number. The

terminus group indicates modifications at the end of the side chains, such as

methylketone (MK) and para-aminobenzoic acid (PABA) (Figure 1-4). The dauer

pheromone consists of at least five components, asc-C6-MK (C6; ascr#2), asc-C9 (C9;

ascr#3), asc-C3 (C3; ascr#5), IC-asc-C5 (C5; icas#9), and asc-C7-PABA (ascr#8)

(15,18,19,21).

18

Figure 1-4. Modular structure of ascarosides and nomenclature. The names of

ascarosides used in this study were based on their modular structure. Each name gives you information such as how many carbons are in the side chain, where the side chain is linked to ascarylose, and whether there is any modifications in either the head or terminus positions. The figure was reprinted with permission from Xinxing Zhang et al., PNAS 2015, 112(13), 3955-3960.

1.4 Role of the Ascarosides in Controlling Various Behaviors

The ascarosides control not only dauer formation but also various sex-specific

and social behaviors, such as male attraction, hermaphrodite attraction, hermaphrodite

avoidance, and aggregation (22-25). These behaviors are influenced by specific

ascarosides. Although some of the ascarosides that affect dauer also affect various

behaviors, the ascarosides that affect dauer work at mid-nM to low M concentrations,

while those that affect behaviors work at fM to nM concentrations.

Hermaphrodites produce a chemical signal that attracts males (26). Activity-

guided fractionation showed that two dauer pheromone ascarosides, asc-C6-MK and

asc-C9, attracted males at very low concentrations (pM to low nM) and that these

ascarosides worked synergistically with glc-asc-C6-MK (22). Another dauer

pheromone, asc-C7-PABA (Figure 1-5), was also enhanced the male attraction activity

with asc-C6-MK and asc-C9 synergistically (21).

19

Figure 1-5. Structures of male-attracting ascarosides.

The ascaroside asc-C9 is used by males to attract hermaphrodites. The

ascroside profiles of males are quite different from those of hermaphrodites. For

example, hermaphrodites produce abundant asc-ΔC9, which has dauer formation

activity at high concentrations and induces hermaphrodite avoidance and male

attraction at lower concentrations. On the other hand, males secrete more asc-C9 than

hermaphrodites and use this asc-C9 to attract hermaphrodites at with extremely low

concentrations (27).

The ascarosides containing the indolecarbonyl (IC) group, IC-asc-ΔC9 and IC-

asc-C5, serve as potent aggregation pheromones. These indole ascarosides attract

both hermaphrodites and males at higher concentrations and attract only

hermaphrodites at lower concentrations (24). In particular, IC-asc-ΔC9 increases

hermaphrodite aggregation on food at very low concentrations (10 fM). An additional

aggregation pheromone was found, 4-hydroxybenzoyl (HB)-asc-ΔC9 (hbas#3), which

has an HB group instead of an IC group and has a similar potency to IC-asc-C9

(Figure 1-6).

20

Figure 1-6. Structures of potent aggregation pheromones.

1.5 Biosynthesis of the Ascrarosides

Golden and Riddle performed a genetic screen to identify mutants that could not

produce the dauer pheromone (that is, the conditioned medium of the mutants did not

prevent dauer recovery in wild-type dauers). In this screen, they obtained the daf-22

mutant, but the daf-22 gene was not cloned for another 25 years (28). A subsequent

study with fat-storage mutants enabled the cloning of the daf-22 gene and showed that

daf-22, as well as dhs-28, participate in the biosynthesis of the dauer pheromone

ascarosides. daf-22 encodes a homolog of mammalian peroxisomal 3-ketoacyl-CoA

thiolase, which catalyzes the last step in peroxisomal -oxidation cycles, while dhs-28

encodes a homolog of the dehydrogenase domain in mammalian peroxisomal

multifunctional protein (29). In mammals, long-chain and/or branched-chain fatty acids

and bile acids are processed via peroxisomal -oxidation that shortens the carbon chain

by two carbons with each cycle (30). Similarly, it has been shown that C. elegans

utilizes the peroxisomal -oxidation in the biosynthesis of ascarosides by trimming the

side chains of long-chain ascaroside precursors to the short-chain ascarosides. Further

studies found more genes participating in peroxisomal -oxidation in C. elegans, and

21

the four steps of the peroxisomal -oxidation cycles were proposed, catalyzed by an

acyl-CoA oxidase (ACOX-1), a 2-enoyl-CoA hydratase (MAOC-1), a -hydroxyacyl-CoA

dehydrogenase (DHS-28), and a 3-ketoacyl-CoA thiolase (DAF-22) (25,31,32) (Figure

1-7A). Worms with mutations in the peroxisomal β-oxidation pathway accumulate

ascarosides with long-chain side chains. In particular, acox-1 mutant produced more

saturated long-chain ascarosides, maoc-1 had more unsaturated long-chain

ascarosides, dhs-28 accumulated β-hydroxylated long-chain ascarosides, and daf-22

produced much less of the short-chain ascarosides (Figure 1-7B). These results

suggest that C. elegans produces long-chain ascarosides and shortens their side-

chains using the -oxidation enzymes.

22

Figure 1-7. Proposed biosynthetic pathway of ascarosides and ascaroside profiles of

wild type and β-oxidation mutants. (A) Proposed roles of peroxisomal β-oxidation enzymes ACOX-1, MAOC-1, DHS-28, and DAF-22 in ascaroside biosynthesis. (B) Ascarosides in wild-type and β-oxidation mutants (acox-1, maoc-1, dhs-28, and daf-22) with saturated (blue), α,β-unsaturated (red), and β-hydroxylated (green) side chains. The figure was reprinted with permission from Stephan H. von Reuss et al., JACS 2012, 134 (3), 1817-1857. Copyright 2012 American Chemical Society.

23

CHAPTER 2 BIOSYNTHESIS OF METHYLKETONE MOIETY IN ASCAROSIDES IN Caenorhabditis

elegans

2.1 Background

The nematode C. elegans secretes the ascarosides as signaling molecules to

communicate with other nematodes and to control its development and behavior in

response to environmental conditions. The ascarosides are structurally diverse

derivatives of the 3,6-dideoxy-L-sugar ascarylose, and they have various biological

activities depending on their structures and concentrations. For example, specific

ascarosides induce the dauer larval stage, while others induce certain behaviors,

including attraction of males to hermaphrodites and vice versa, avoidance, and

aggregation (22-25,27,33). C. elegans develops from eggs to adults via four larval

stages (L1 – L4) under favorable conditions. On the other hand, it will develop into an

alternative L3 larval stage, the dauer diapause, under harsh environmental conditions

such as high population density, limited food, and high temperature (15,16,18,19,21).

Dauers do not feed and have unique morphology, including a closed pharynx and a

thickened cuticle. C. elegans senses its population density and triggers dauer formation

by secreting ascarosides into the environment and sensing them using chemosensory

neurons via G protein-coupled receptors (GPCRs) and downregulate the insulin/insulin-

like growth factor 1 (IGF-1) and TGF- pathways, which control development,

metabolism and lifespan of C. elegans (13,34,35).

Peroxisomal -oxidation cycles shorten the side chains of long-chain ascaroside

precursors by two carbons per cycle to make the short-chain ascarosides. Four

peroxisomal enzymes, an acyl-CoA oxidase (ACOX), 2-enoyl-CoA hydratase (MAOC-

24

1), (3R)-hydroxyacyl-CoA dehydrogenase (DHS-28), and 3-ketoacyl-CoA thiolase (DAF-

22), are required for each cycle (25,29,36). C. elegans with deletion mutations in maoc-

1, dhs-28, or daf-22 fail to make short-chain ascarosides and instead accumulate long-

chain ascarosides. Thus, these genes are required for shortening the side chains of

long-chain ascaroside precursors. However, it is not known whether they are also

required for downstream -oxidation cycles that process shorter chain ascarosides.

ACOX enzymes have been shown to have specific side-chain length preferences. For

example, an ACOX-1 homodimer acts on the CoA-thioester of an ascaroside with a 9-

carbon (-1)-side chain, an ACOX-1/ACOX-3 heterodimer acts on one with a 7-carbon

(-1)-side chain, and an ACOX-2 homodimer acts on one with a 5-carbon -side chain

(37).

In this study, we performed in vitro assays with purified β-oxidation enzymes

against those short-chain ascaroside CoA thioesters to reconstitute the entire pathway.

We identify an acyl-CoA thioesterase, ACOT-1, as playing a key role in the biosynthesis

of the MK group in ascarosides. Our work uncovers how C. elegans produces

ascarosides with MK-modified side chains that are important components of the dauer

and sex pheromones.

2.2 Result and Discussion

2.2.1 Recombinant Expression and in vitro Activities of β-Oxidation Enzymes

Recombinant MAOC-1, DHS-28SCP-2, and DAF-22 were expressed in E. coli

and purified as single bands of ~ 35 kDa, ~ 36 kDa, and ~ 46 kDa, respectively (Figure

2-1). In vitro enzyme assays were set up that included appropriate ACOX enzyme(s)

25

(37), along with MAOC-1, DHS-28SCP-2, and DAF-22, to investigate the substrate

specificity of the latter three enzymes toward short-chain ascaroside-CoAs.

Figure 2-1. SDS-PAGE of three -oxidation enzymes. The proteins were expressed in

E. coli and purified using Ni-NTA resin. The eluted proteins were analyzed by SDS-PAGE. The sizes of the expressed proteins matched calculated sizes.

Lane 1: MAOC-1; Lane 2: DHS-28SCP-2; Lane 3: DAF-22; L: ladder

Recombinant ACOX-1 homodimer, ACOX-1/3 heterodimer, and ACOX-2 homodimer

were used in the assay against asc-C9-CoA, asc-C7-CoA, and asc-C5-CoA,

respectively (Figure 2-2). In order to monitor the reaction products, we developed an

LC-MS method utilizing ammonium acetate to enhance the ionization of coenzyme A

(CoA)-containing metabolites that was based on previously published methods (38-41).

The assay data demonstrated that MAOC-1, DHS-28, and DAF-22 can process even

short-chain ascaroside CoA-thioesters, including asc-C9-CoA, asc-C7-CoA, and asc-

C5-CoA (Figure 2-3). The reaction against asc-C9-CoA was more efficient than the

one against asc-C7-CoA or against asc-C5-CoA. However, this result is likely due to

the ACOX-1 homodimer being a more efficient enzyme than the ACOX-2 homodimer or

the ACOX-1/3 heterodimer (37). Interestingly, running the reactions without DAF-22 led

to the accumulation of ascarosides terminating in a MK group (Figure 2-3D). It is

possible that in the absence of DAF-22 leads to the accumulation of a -keto CoA-

thioester intermediate, which then undergoes hydrolysis of the CoA-thioester and

26

decarboxylation, to yield the MK group. Previous metabolomics work has shown that

daf-22 mutants accumulate MK-containing ascarosides with long-chain side chains of

various lengths (42). Wild-type C. elegans specifically produces MK-containing

ascarosides with 6-carbons in the side chain (asc-C6-MK and glc-asc-C6-MK).

Figure 2-2. Proposed biosynthetic pathway of short-chain (ω-1)-ascarosides (A) and ω-

ascarosides (B). ACOX-1 homodimer, ACOX-1/3 heterodimer, and ACOX-2 homodimer were used in in vitro assay along with following three enzymes, MAOC-1, DHS-28, and DAF-22 against appropriate substrates shown here.

27

Figure 2-3. in vitro activities of β-oxidation enzymes against (A) asc-C9-CoA, (B) asc-

C7-CoA, and (C) asc-ωC5-CoA, and (D) in vitro activities of β-oxidation enzymes without DAF-22 against asc-C7-CoA. (A) The reaction was incubated at 30 °C for 30 min. Most of the substrate was converted to intermediates or final products. These results represent the mean of three independent assays ± SD. (B) The reaction was incubated at 30 °C for 2h. Although less final products were found than in (A), but the enzymes processed asc-C7-CoA as was hypothesized. These results represent the mean of two independent assays ± SD. (C) The reaction was incubated at 30 °C for 2h. A similar amount of activity is shown as in (A). These results represent the mean of two independent assays ± SD. (D) The reaction incubated at 30 °C for 2h. These results represent the mean of two independent assays ± SD. Without DAF-22, asc-C6-MK production was observed. Control refers the sample with no enzyme and AMDD and AMD refer the sample containing all four β-oxidation enzymes and β-oxidation enzymes without DAF-22, respectively. The relative production indicates relative LC-MS area of intermediates or products compared to that of the corresponding substrate.

Thus, inhibition of DAF-22 cannot be the only determining factor leading to the

biosynthesis of MK-containing ascarosides.

28

2.2.2 Ascaroside Production in an acot-1 Mutant

Peroxisomal -oxidation of fatty acids is terminated by acyl-CoA thioesterases

(ACOTs), which hydrolyzes fatty acyl-CoAs to free fatty acids and CoA (43-46). In an

analogous way, we hypothesized that ascaroside-CoAs may be processed via β-

oxidation and then an ACOT might hydrolyze the ascaroside CoA-thioesters to free

ascarosides in order to promote the biosynthesis of ascarosides with specific side-chain

lengths. The C. elegans genome encodes four homologs of human ACOT. Mos1

transposon insertion mutant strains were available for three of these four genes, and

ascaroside production by wild-type and the three mutant strains was analyzed using LC-

MS. Unlike the other two mutants, the acot-1 (ttTi876) mutant showed altered

ascaroside production relative to wild type. To confirm that mutation of acot-1 was

responsible for the altered ascaroside production, the mutant was backcrossed six

times to wild type to remove any additional transposon insertions or mutations. The

backcrossed acot-1 mutant produced more asc-C9, produced less asc-C7, and did not

produce any asc-C6MK or glc-asc-C6-MK, relative to wild type (Figure 2-4). From this

data, we hypothesized that ACOT-1 hydrolyzes asc-C7-CoA and/or asc--keto-C7-CoA,

to produce asc-C7 and/or asc--keto-C7, respectively. Once generated, the asc--keto-

C7 could potentially undergo decarboxylation spontaneously to produce asc-C6-MK

(Figure 2-5). Indeed, it has been reported that wild tomato plants, which produce

methylketones as protection against various herbivorous insects, have thioesterases

that are required for the biosynthesis of the methylketones (47). Analogously, ACOT-1

may function as a thioesterase to drive the production of asc-C6-MK.

29

Figure 2-4. Ascaroside production of acot-1 mutant compared with WT. The relative

production of ascarosides of the backcrossed acot-1 mutant was obtained by dividing LC-MS area of the mutant with the one of the wild type. The mutant accumulated about 6 times more asc-C9 and produced much less asc-C7, asc-C6MK, and Glc-asc-C6MK than WT. The mean ± SD of three independent experiments is plotted. p values were calculated using t test calculator from GraphPad software. Asterisks indicate statistically significant

p values. (*p ≤ 0.05, **p ≤ 0.01)

To confirm further that the defects in the acot-1 mutant strain were due to loss of

acot-1, we generated a rescue strain by PCR-amplifying a segment of genomic DNA

encompassing the acot-1 promoter, coding sequence, and 3’-UTR and injecting the

PCR product into the acot-1 mutant. The production of asc-C7, asc-C6MK, and Glc-

asc-C6MK was partially rescued in the rescue strain (Figure 2-6). Thus, acot-1 is

required in production of these ascarosides.

2.2.3 Ascaroside Production in an acot-1 Overexpression Strain

To provide further support for the role of acot-1 in ascaroside biosynthesis, an

acot-1 overexpression strain was generated by injecting the acot-1 PCR product into

30

wild-type worms. qRT-PCR of the acot-1 overexpression strain demonstrated that the

strain transcribed acot-1 at much higher levels than wild type.

Figure 2-5. Proposed role of ACOT-1 in biosynthetic pathway of the ascaroside.

ACOT-1 hydrolyzes asc-C7-CoA and/or asc--keto-C7-CoA to produce asc-

C7 and/or asc--keto-C7, respectively. Then, the produced -keto acid could be decarboxylated and generate asc-C6-MK, in turn.

The acot-1 overexpression strain produced most ascarosides at similar levels as

wild type, except for asc-C7, which was produced at higher levels in the overexpression

strain (Figure 2-7). ACOT-1 may catalyze the hydrolysis of asc-C7-CoA to produce asc-

C7. However, the acot-1 overexpression strain did not produce more asc-C6-MK or glc-

asc-C6-MK. One possible explanation for this result is that the acot-1 overexpression

strain may hydrolyze asc-C7-CoA as soon as it was produced, such that none of the

31

asc-C7-CoA can be processed further to asc--keto-C7-CoA, a potential precursor in

the biosynthesis of asc-C6-MK or glc-asc-C6-MK.

2.2.4 Site of ACOT-1 Expression

To determine the site of ACOT-1 expression in C. elegans, we generated a

transcriptional reporter strain in which the acot-1 promoter was used to drive the

expression of GFP. The transgenic worms demonstrated that acot-1 is expressed

weakly in the intestine (Figure 2-8).

Figure 2-6. Ascaroside profile of acot-1 rescue strain compared with acot-1. The

relative production of the ascarosides in the acot-1 rescue strain was obtained by dividing the LC-MS area of each ascaroside of the rescue strain with that of the acot-1 mutant. The phenotype of the acot-1 mutant was partially rescued in the rescue strain showing production of asc-C6-MK and glc-asc-C6-MK. Slightly more production of asc-C7 and less production of asc-C9 in the rescue strain also support our hypothesis. The mean ± SD of three independent experiments is plotted. p values were calculated using t test calculator from GraphPad software. Asterisks indicate statistically

significant p values. (*p ≤ 0.005, **p ≤ 0.001)

32

Figure 2-7. Ascaroside profile of acot-1 overexpression strain compared with wild type.

The relative production of ascarosides of acot-1 overexpression strain was obtained by dividing the LC-MS area of each ascaroside of the strain with that of the wild type injected with the marker DNA. The mean ± SD of three independent experiments is plotted. p values were calculated using t test calculator from GraphPad software. Asterisks indicate statistically significant

P values. (*p ≤ 0.05, **p ≤ 0.01)

Interestingly, acot-1 was expressed throughout the intestine, but in localized zones. It is

likely that the intestine is an important site for ascaroside biosynthesis as expression of

dhs-28 and daf-22 in the intestine is sufficient to allow ascaroside biosynthesis (36).

We are not sure why the ACOT-1 is expressed as zones, but one possible explanation

would be transcriptional strain, not translational including acot-1 gene in downstream of

GFP. Indeed, we also generated the translational reporter strain, but it was hard to

monitor the expression. If ACOT-1 expresses as a very low level in general, it could be

very hard to see the expression from the translational strain. On the other hand,

because the transcriptional strain includes only acot-1 promoter and excludes the gene

in which a peroxisomal targeting signal 1 (PTS1) placed at the C-terminus (48), it might

33

cumulate in a cytosol of the intestine and show the specific expression pattern.

Normally, peroxisomal enzymes are expressed in cytosol and imported into the

peroxisome via a specific transporter, ATP-binding cassette superfamily D (ABCD), in

recognition of the PTS.(45,46)

Figure 2-8. ACOT-1 expression in the intestine. To localized ACOT-1 expression, GFP

was observed from rabEx1[acot-1p::gfp; coel::dsRed] using fluorescence microscope. Two representative pictures showed that ACOT-1 was expressed in intestine pointed as white arrows. The inset pictures are DIC images.

2.3 Summary and Future Directions

Structures and functions of ascarosides have been discovered extensively, but

their biosynthetic pathway remained obscure. Through in vitro enzymes assays that we

performed with -oxidation enzymes against short-chain ascaroside-CoAs, it was

identified that the short-chain ascaroside-CoAs processed directly via peroxisomal-

oxidation cycle. In addition, ACOT-1 seems to have important role in not only

biosynthesis of ascarosides containing MK moiety and also releasing the potent dauer

pheromones from the -oxidation cycle. However, we still have to confirm the activity of

ACOT-1 in in vitro by expressing the protein in insect cells or by extracting from worms.

We tried to express the protein, ACOT-1, in E. coli with various plasmid constructions

34

using variety of vectors and a codon optimized gene, but unfortunately, the protein was

not expressed and that is why we consider expressing the protein in insect cells or

extracting from worms directly. Study of the gene regulation of acot-1 is also required to

understand the role of ACOT-1 further. Primarily, the gene expression was compared in

starvation and non-starvation conditions using qRT-PCR and no difference was found. I

also monitored GFP expression using rabEx1[acot-1p::gfp; coel::dsRed] in crude

pheromone condition, but it did not induce higher expression of the GFP. A recently

published paper showed that acot-1 expression was upregulated in a daf-16 mutant

during L1 arrest (49), and studying the correlation between two genes in C. elegans

would be interesting.

2.4 Experimental

2.4.1 C. elegans Strains

Strains used in this study include wild type (N2, Bristol) and IE876 [acot-

1(ttTi876)]. The acot-1(ttTi876) strain was backcrossed six times with wild type.

Transgenic strains with extrachromosomal arrays include rabEx1[acot-1p::gfp;

coel::dsRed], rabEx2[acot-1p::acot-1; coel::dsRed], wild type(N2); coel::dsRed, and

acot-1(ttTi876); rabEx2.

2.4.2 C. elegans Liquid Cultures

All strains were cultured as small-scale (5 mL) nonsynchronized cultures to

compare their ascaroside productions from the one of WT by LC-MS. Additionally, the

acot-1 strain was cultured as large-scale (150 mL) nonsynchronized cultures to get

further ascaroside profiles by LC-MS/MS. Large-scale nonsynchronized worm cultures

were fed E. coli (OP50) and grown for 9 d, and extracts were generated from the culture

medium and analyzed by LC-MS/MS, as described.(20) For small-scale cultures,

35

worms were grown on an NGM agar plate (6 cm) at 20˚C until the food on the plate was

almost gone. Then, the plate was washed with 5 mL of S medium and transferred to 50

mL culture tube (day 1). The worms were grown at 22.5˚C for 6 d and were fed with

500 L of 25X OP50 every 2 d (days 1, 3, and 5). For sample collection in these

experiments, the culture was incubated in an ice-bath for 30 min to 1 hr to allow worms

to settle, and the supernatant was centrifuged again (3500 rpm for 10 min). 1 mL of this

supernatant was lyophilized and resuspended in 100 μL of 50% (vol / vol) methanol in

water, and the ascarosides were analyzed by LC-MS. The worms obtained were

washed with cold M9 buffer several times, flash-frozen, and stored at −80 °C until they

were used for qRT-PCR.

2.4.3 Plasmid Construction

The plasmids for expression of ACOX-1 and ACOX-3 were previously described

(37). The maoc-1, dhs-28, and daf-22 genes were cloned by PCR from an N2 cDNA

library. The maoc-1 gene was amplified with primers

cgcgGAATTCgATGGATAAGAAAACTGCTTGCGCAC and cgcgGCGGCCGC

TTACAATTTTGATGCAAGATCAATTGGAACTGTTGG and inserted into the

pACYCDuet-1 vector at the EcoRІ/NotІ sites for expression with a N-terminal His tag (to

generate pACYCDuet-1::maoc-1). The dhs-28 gene was amplified with primers

cgcgGAATTCgATGTCTCTTCGTTTTGACGGAAAAG and

cgcgGCGGCCGCTTACAGTGCACTACTCCTGATGTTT and inserted into the

pACYCDuet-1 vector at the EcoRІ/NotІ sites for expression with an N-terminal His tag

(to generate pACYCDuet-1::dhs-28Δscp-2). This construct lacks the dhs-28 sequence

encoding the SCP-2 (Sterol Carrier Protein-2) domain because this domain interfered

36

with protein expression and is not necessary for enzymatic activity. The daf-22 gene

was amplified using primers gcgcCCATGGggACGCCAACCAAGCCAAAGG and

catgGCGGCCGCAATCTTGGACTGTGCAGCTCCA and inserted into a modified pET-

16b vector at the NcoІ/NotІ sites for expression with a C- terminal His tag.

2.4.4 Protein Expression and Purification

Co-expression and purification of ACOX-1 and ACOX-3 were described

previously.(37) The plasmids pACYCDuet-1::maoc-1, pACYCDuet-1::dhs-28Δscp-2,

and pET-16b::daf-22 were transformed into BL21(DE3). Pre-cultures for expression of

MAOC-1 and DHS-28ΔSCP-2 were shaken overnight at 37˚C in Luria–Bertani (LB)

broth with 34 μg/mL chloramphenicol. The pre-culture for DAF-22 expression was

shaken overnight at 37˚C in LB broth with 150 μg/mL ampicillin. Then, the pre-cultures

(5 mL) were transferred to 1 L of LB broth supplemented with antibiotics accordingly,

and shaken at 37˚C until the OD600 reached a desired value. The expression of MAOC-

1, DHS-28ΔSCP-2, and DAF-22 was induced by the addition of 0.8 mM isopropyl β-D-1-

thiogalactopyranoside (IPTG) at an OD600 of 0.6-0.7, and the culture was shaken

overnight at 25°C.

The cells were harvested by centrifugation at 3500 rpm for 10 min at 4˚C. The

cell pellets were resuspended in 20-25 mL of lysis buffer [25 mM Tris/HCl (pH 7.5), 500

mM NaCl] and lysed using a microfluidizer. The lysates were centrifuged at 18,000 rpm

for 25 min at 4˚C, and the supernatant was incubated with Ni-NTA resin (Thermo

Fisher). The resin was washed, and the His-tagged proteins were eluted with an elution

buffer [25 mM Tris/HCl (pH 7.5), 500 mM NaCl, and 500 mM imidazole] and

concentrated with a 10 kDa-cut off Centricon (Millipore) prior to further purification using

an FPLC. The concentrated proteins were applied to a HiLoad 16/600 Superdex 200

37

column (GE Healthcare) equilibrated in 25 mM Tris/HCl (pH 7.5), 150 mM NaCl, and 5%

(v/v) glycerol and attached to the FPLC. The fractions containing the proteins of interest

were pooled and concentrated again to use in enzyme assays.

2.4.5 Synthesis of CoA-Thioesters of Ascarosides

CoA-thioesters of ascarosides used in this study were synthesized based on a

previously described method.(37)

2.4.6 Enzyme Assays

Reactions were performed at 30°C in 50 mM potassium phosphate buffer (pH

8.0). The incubation time for each reaction was described in the figure legend of Figure

2-3. In a total assay volume of 50 μL, the reactions contained 4 μg of enzymes (ACOX-

1, ACOX-1/3, ACOX-2, MAOC-1, DHS-28, DAF-22, and ACOT-1), 20 μM FAD, 20 μM

NAD+, 200 μM CoA, and 50 μM MgCl2. The samples were heated at 95˚C for 5 min and

centrifuged at 15000 rpm for 5 min. Reaction products were monitored using LC-MS.

Retention times were confirmed with synthetic standards for asc-C9-CoA, asc-C7-CoA,

asc-ωC5-CoA, asc-C7, asc-C6-MK, and CoA.

2.4.7 LC-MS Analysis

LC-MS analysis of ascarosides was performed on a Phenomenex Luna 5 μm C18

2 100 Å (100 x 4.6 mm) column attached to an Agilent 1260 infinity binary pump and

Agilent 6130 single quad mass spectrometer with API-ES source, operating in dual

negative/positive single-ion monitoring mode. A water (with 0.1% formic acid) and

acetonitrile (with 0.1% formic acid) solvent gradient was used, holding at 5% acetonitrile

for 5 min, ramping to 60% acetonitrile over 20 min, ramping to 100% acetonitrile, and

then holding at 100% acetonitrile for 4 min. In general, all ascarosides were detected by

38

LC-MS using the [M-H]− ion, except for asc-C6MK and glc-asc-C6MK, which were

detected using their [M+Na]+ ion.

LC-MS analysis of enzyme assays was performed as described above, except

that scan mode was used. In the assays with asc-C9-CoA and asc-C7-CoA, a water

(with 0.01 M ammonium acetate) and acetonitrile solvent gradient was used, holding at

0% acetonitrile for 1 min, ramping to 25% acetonitrile over 20min, ramping to 100%

acetonitrile, and then holding at 100% acetonitrile for 4 min. In the assay with asc-ωC5-

CoA, 15% acetonitrile gradient was used instead of 25% over 20min with same

solvents. This solvent system was designed to detect the CoA-thioesters of

ascarosides as products of the enzyme assays.

2.4.8 pacot-1::gfp Transcriptional Reporter Strain

The acot-1 promoter (2 kb upstream of the acot-1 gene) was amplified from C.

elegans genomic DNA by PCR using the primers

cgcgGTCGACTGGGTTAGTACAATATAATCTATATAACAGG and

cgcgGCGGCCGCCTAGTTGATCAGAAAGAGGGAG. The amplified promoter was

inserted into pPD114.108 (created by the Fire lab, obtained from Addgene) at the

SalІ/NotІ sites. The constructed plasmid was injected at (100 ng / L) into the gonad of

wild-type worms, along with coel::dsRed marker DNA (at 50 ng / L) (gift of Piali

Sengupta), to generate rabEx1[acot-1p::gfp; coel::dsRed]. GFP expression was

observed in 5 independent lines with a Carl Zeiss AXIO Vert. A1 attached with X-Cite

series 120Q Lumen Dynamics.

39

2.4.9 acot-1 Overexpression and Rescue Strains

To generate the acot-1 overexpression strain, 5.3 kb of genomic DNA, including

the acot-1 gene and 2 kb upstream and 323 bp downstream, was amplified by PCR.

The PCR product was injected (at 50 ng / L), along with coel::dsRed marker DNA (at

50 ng /L) into wild-type worms to generate rabEx2. Three independent lines of

rabEx2 were generated. The acot-1 rescue strain was made by injecting the PCR

product into the acot-1(ttTi876) strain to generate acot-1(ttTi876); rabEx2. Two

independent lines of the rescue strain were generated.

2.4.10 Quantitative RT-PCR

Total RNA was extracted from worms using Trizol reagent (Life Technologies)

and purified using an RNeasy mini kit (Qiagen), including an on-column DNAse

treatment performed according to the manufacturer’s protocol. cDNA was prepared from

0.26 μg total RNA using the Superscript III First-Strand Synthesis SuperMix (Life

Technologies). The qRT-PCR primers were designed across exon-exon boundaries,

and their sequences are available upon request. qRT-PCR was performed using SYBR

Select Master Mix (Life Technologies) on a 7500 Fast Real-Time PCR System (Applied

Biosystems). Relative abundance was determined using the ΔΔCt method and

normalized to the expression levels of the control genes act-1, Y45F10.4, and pmp-3.

40

CHAPTER 3 Caenorhabditis elegans USES AN ASCAROSIDE PHEROMONE AS A SENTINEL TO

MONITOR ITS MICROBIAL ENVIRONMENT

3.1 Background

The nematode C. elegans secretes ascarosides, derivatives of the 3,6-

dideoxysugar ascarylose that are modified with fatty acid-derived side chains of various

lengths. Different blends of these ascarosides affect the development and behavior of

the worm. The dauer pheromone, which consists of at least five ascarosides, including

asc-C6-MK (other names: C6, ascr#2), induces development of the stress-resistant

dauer larval stage (Figure 3-1) (15,18,19,21).

Figure 3-1. C. elegans dauer and mating pheromones.

41

Dauers form in response to low food availability, high temperature, and high population

density, which C. elegans monitors by sensing the concentration of the dauer

pheromone (15,16,18,19,21). Additional ascaroside pheromones attract males to

hermaphrodites, attract hermaphrodites to males, induce aggregation of

hermaphrodites, and induce avoidance and dispersal of specific larval stages (22-

24,27,33). The ascarosides can be modified with a variety of head groups attached to

the ascarylose sugar and terminus groups attached to the fatty acid side chain that can

have dramatic effects on biological activity in C. elegans. For example, the mating

pheromone component, glc-asc-C6-MK (other name: ascr#4), differs from the dauer

pheromone component, asc-C6-MK, by only the presence of a glucosyl head group

attached to the 2’-position of the ascarylose sugar (Figure 3-1).

The ascarosides enable C. elegans to alter is development and behavior in

response to changing environmental conditions. C. elegans is found in nature on rotting

plant material, such as rotting apples, where it feeds on bacteria and fungi and

undergoes reproductive growth (50). Once the nematode population overwhelms the

available food, dauers form, enabling C. elegans to disperse, often on an invertebrate

carrier such as a fruit fly, to a new microbially rich environment. The dauer also helps

C. elegans to protect itself from microbial pathogens that occupy its habitat, such as the

bacterial pathogens Microbacterium nematophilum and Pseudomonas sp., because

dauers have a thickened cuticle, closed body orifices, and do not feed, they resistant to

infection by these pathogens (8,51).

In this study, I show that certain bacteria, including the nematode pathogen M.

nematophilum, modify the chemical message produced by C. elegans by cleaving the

42

glucosyl group from the mating pheromone glc-asc-C6-MK to generate the dauer

pheromone asc-C6-MK. Thus, glc-asc-C6-MK may serve as a masked version of asc-

C6-MK that can be unmasked under certain conditions. Although many examples exist

of bacteria species modifying the chemical signals of competing bacterial species, our

results provide the first example of a microorganism affecting chemical communication

in C. elegans.


3.2.1 Synthesis of Deuterium-Labeled Asc-C6-MK and Glc-Asc-C6-MK1

C. elegans could potentially biosynthesize glc-asc-C6-MK by adding the glucosyl

group to asc-C6-MK directly or by adding the glucosyl group to some unidentified

biosynthetic precursor. In order to test whether C. elegans can attach the glucosyl

group to asc-C6-MK, or can, conversely, remove the glucosyl group from glc-asc-C6-

MK, we synthesized deuterium-labeled versions of these ascarosides for feeding

experiments (Figure 3-2A). The synthesis of deuterium labelled ascarosides was

achieved by following previously reported protocols. In brief, rhamnose-derived lactone

was subjected to catalytic deuteration followed by reduction to afford 2′,5′-dibenzoyl-

ascarylose in 52% yield over two steps. 2′,5′-dibenzoyl-ascarylose was then

glycosylated with 2R,5R-hexanediol to afford the glycosyl product in 54% yield; a bis-

glycosylated ascaroside was also isolated as the by-product. PDC mediated oxidation

of 5a in 98% yield and subsequent debenzoylation gave d2-asc-C6-MK in 50% overall

yield in three steps. Disaccharide glc-d2-asc-C6-MK was prepared in two steps from d2-

asc-C6-MK. Glycosylation with commercially available 2,3,4,6-tetra-O-acetyl-α-D-

1 The synthesis is done by Dr. Rachel A. Jones, postdoc.

43

glucopyranosyl bromide, followed by HPLC purification gave a mixture of the desired

Koenigs-Knorr product (2′-epimer) in addition to the undesired 4′-epimer. Based-

mediated deacetylation followed by HPLC purification afforded the target disaccharide

(glc-d2-asc-C6-MK).

3.2.2 C. elegans Does Not Attach or Cleave the Glucosyl Group under Various Culture Conditions

Preliminary experiments in which the deuterium-labeled ascarosides were added

to C. elegans cultures suggested that C. elegans does not add the glucosyl group to

asc-C6-MK or remove the glucosyl group (Figure 3-2B,C). To determine whether

specific conditions could induce the inter-conversion between the two ascarosides, wild

type worms were cultured in dauer-inducing and non-dauer inducing conditions, or in

fed and starved conditions, and deuterium-labeled ascarosides were added to the

cultures to monitor for possible inter-conversion via LC-MS. Although we occasionally

detected removal of the glucosyl group from d2-glc-asc-C6-MK, our results were

inconsistent. Cultures in which we detected removal of the glucosyl group, however,

tended to have microbial contamination. It is possible that we did not detect conversion

because the exogenously added ascarosides do not reach the cellular compartment

where addition/removal of the glucosyl group occurs. To test this possibility, a crude

worm lysate was generated and incubated with glc-d2-asc-C6-MK. However, no d2-asc-

C6-MK was detected, indicating that no glucosidase activity was present, although the

possibility remains that the glucosidase is inactive under the assay conditions used.

44

Figure 3-2. Synthesis of deuterium-labeled ascarosides (A) and their use in feeding

experiments with C. elegans (B, C). (A) Each reaction condition is following. a. BzCl, py, 0 °C to r.t., 90%; b. NH3 (7M in MeOH) 0 °C to r.t., 74%; c. PDC, CH2Cl2, 0 °C to r.t., 44%; d. anhydrous NEt3/CHCl3 (4:1), 83%; e. D2, Pd/C, EtOAc, 0 °C to r.t. 90%; f. BH3·THF, 2,3-dimethyl-2-butene, 96%; g. 2R,5R-hexanediol, BF3·Et2O, 4Å mol. sieves, CH2Cl2, 53%; h. PDC, 4Å mol. sieves CH2Cl2, 98%; i. KOH (1M in MeOH), 96%; j. (AcO)4Glc-αBr, I2 (cat.), Ag2CO3, CH2Cl2; k. NEt3/MeOH/H2O (1:8:1).

45

3.2.3 Certain Bacterial Species Can Cleave the Glucosyl Group

Consistent with our result that microbial contamination is associated with

cleavage of the glucosyl group from d2-glc-asc-C6-MK, we have noted that if C. elegans

liquid cultures in our laboratory become contaminated, they often produce a high level

of (endogenously produced, non-deuterated) asc-C6-MK and a low level of

(endogenously produced, non-deuterated) glc-asc-C6-MK. To investigate this pattern

further, one of these microbial contaminants (B20) was isolated (Figure 3-3A). Growth

of C. elegans with B20 as a food source in the presence of d2-glc-asc-C6-MK led to

cleavage of the glucosyl group. The bacteria themselves were sufficient for cleavage

since addition of d2-glc-asc-C6-MK to a B20 culture also led to glucosyl cleavage to

produce d2-asc-C6-MK (Figure 3-3B). This result indicates that B20 does not induce C.

elegans to cleave the glucosyl group, but rather that B20 itself produces a glucosidase

that can cleave the glucosyl group. Using 16S ribosomal RNA sequencing, we

identified B20 as Microbacterium paraoxydans with 100% sequence identity.

To determine whether additional bacterial species could cleave the glucosyl

group, we tested a panel of 18 bacterial species that were isolated from rotting apples

on which wild C. elegans strains were also growing (Table 3-1). Three of these

bacterial species, JUb46, JUb47, and JUb48, readily cleaved the glucosyl group.

Interestingly, JUb48, like B20, is a Microbacterium species, suggesting that the

enzymatic activity for cleaving the glucosyl group may be especially prevalent among

certain bacterial genera. Microbacterium nematophilum is a natural pathogen of C.

elegans that adheres to the cuticle surrounding the anus, leading to swelling of region,

constipation, and slow growth. To determine whether M. nematophilum has the

potential to interfere with C. elegans chemical signaling, we tested whether this

46

bacterium could cleave the glucosyl group from d2-glc-asc-C6-MK and determined that it

did, in fact, lead to cleavage (Figure 3-3C).

Figure 3-3. Streaked bacteria B20 on an LB-agar plate (A), effect of B20, C. elegans-

associated bacteria, and CBX102 on glucosyl cleavage (B, C). (A) An isolated bacteria, B20, from a contaminated C. elegans culture streaked on an LB-agar plate (B) B20 and several bacteria strains isolated with wild C.

elegans in France were grown with glc-d2-asc-C6-MK (3M in final concentration), and glucosyl cleavage was monitored. Percent remaining glc-d2-asc-C6-MK was calculated by dividing the LC-MS area of the molecule in each culture with that of the molecule in OP50 culture (where no conversion occurred), and the percentage of converted d2-asc-C6-MK was calculated by dividing the LC-MS area of the molecule in each culture with that of the molecule in JUb48 culture (where complete conversion occurred). (C) M. nematophilum (CBX102) was also tested for glucosidase activity with glc-d2-asc-C6-MK in the same condition. These results suggest that certain bacteria species can cleave the glucosyl group from glc-asc-C6-MK.

47

Table 3-1. Bacterial strains collected from rotting apples, a natural habitat for wild C. elegans.

Strain Genus

JUb38 Raoultella or Klebsiella sp.

JUb39 Providencia sp.

JUb40 Agrobacterium (tumefaciens)

JUb41 Flavobacterium sp. (same as JUb43)

JUb42 Pseudomonas sp.

JUb43 Flavobacterium sp. (same as JUb41)

JUb44 Chryseobacterium sp.

JUb45 Rhizobium sp. (differs from JUb46)

JUb46 Rhizobium sp. (differs from JUb45)

JUb47 Frigoribacterium / Leifsonia sp.

JUb48 Microbacterium sp.

JUb49 Paracoccus yeei

JUb50 Paenibacillus sp.

JUb51 Frigoribacterium sp. (differs from JUb47)

JUb52 Pseudomonas sp. (differs from JUb42)

JUb126 Acetobacter sp.

JUb127 Gluconobacter sp. (sequence differs from JUb128)

JUb128 Gluconobacter sp. (sequence differs from JUb127)

3.2.4 Effect of M. nematophilum on Ascaroside Production and Dauer Formation

Given that M. nematophilum produces the glucosidase activity, we hypothesized

that C. elegans grown in the presence of M. nematophilum produce higher levels of asc-

C6-MK and lower levels of glc-asc-C6-MK, relative to C. elegans grown in the presence

of bacteria that do not produce the glucosidase activity (e.g., OP50). M. nematophilum

could affect the level of C. elegans pheromone production, simply by inhibiting C.

elegans growth. Thus, we grew C. elegans in the presence of 99% OP50 plus 1% M.

nematophilum (which does not inhibit C. elegans growth), as well as in the presence of

100% OP50 as a control. In the presence of M. nematophilum, the C. elegans culture

medium produced dramatically less glc-asc-C6-MK, as well as more asc-C6-MK and

certain other ascarosides (Figure 3-4).

48

C. elegans could potentially use glc-asc-C6-MK as a sentinel to sense the presence of

certain types of bacteria. Cleavage of the glc-asc-C6-MK (a mating pheromone) to asc-

C6-MK (a dauer pheromone) could lead to production of a more potent dauer

pheromone and hence more dauer formation. Indeed, C. elegans dauers are protected

from infection with M. nematophilum. However, testing of the crude pheromones in the

dauer formation assay indicated that the dauer pheromone generated from C. elegans

cultures fed with 1% M. nematophilum was not more potent, even though it contained

more asc-C6-MK. This result could be due to the presence of additional food molecules

in the crude pheromone preparation.

Figure 3-4. Ascaroside production of WT worms fed with different bacteria. The relative

production of ascarosides of WT fed with two different bacteria strains (OP50 and CBX102) was obtained by dividing the LC-MS area of each ascaroside with that of a control culture (OP50-fed worms). CBX102-fed culture showed much lower glc-asc-C6-MK and slightly higher asc-C6-MK.

3.3 Summary and Future Directions

Two identified ascarosides, asc-C6-MK and glc-asc-C6-MK, share the same side

chain and yet their functions are different. The function of asc-C6-MK is changed from

49

dauer formation to mating attraction by the addition of a glucose group to the ascarylose

sugar. The glucosyl group was not attached or removed by C. elegans under the

conditions tested. We found a specific species of bacteria which has a glucosyl

cleavage activity and alters the chemical signals produced by worms. It is possible that

worms use glc-asc-C6-MK as a sentinel to detect certain types of bacteria and to

protect themselves. To determine whether the presence of bacteria with glucosyl

cleavage activity affects worm behavior or development, we need to perform assays like

dauer formation assay using the crude pheromone produced by worms grown the in

presence or absence of the bacteria. Furthermore, we need to determine whether the

bacteria secrete the relevant glucosidase. This knowledge will facilitate efforts to

identify the relevant glucosidase.

3.4 Experimental

3.4.1 Materials and Methods

For synthetic d2-asc-C6-MK and glc-d2-asc-C6-MK, 1H and 13C NMR were

recorded on a Varian INOVA 500 MHz spectrometer (500 MHz for 1H, 125 MHz for 13C).

3.4.2 Synthesis of d2-Asc-C6-MK and d2-Glc-Asc-C6-MK2

The compounds were synthesized using previously published procedures, except

that deuterium gas was used instead of hydrogen gas at the hydrogenation step.

Deuterium-labeled dibenzoyl ascarylose was prepared following previously reported

protocols(17,52), and reaction with (2R,5R)-hexanediol led to d2-asc-C6-MK(18).

Koenigs-Knorr glycosylation of d2-asc-C6-MK with 2,3,4,6-tetra-O-acetyl-α-D-

2 The synthesis is done by Dr. Rachel A. Jones, postdoc.

50

glucopyranosyl bromide resulted in (AcO)4-glc-d2-asc-C6-MK and subsequent based-

mediated deacetylation afforded glc-d2-asc-C6-MK.(22)

3.4.3 C. elegans Liquid Culture Conditions

For non-dauer inducing (NDI) and dauer-inducing (DI) conditions, wild-type (N2)

worms were passaged onto three 10 cm NGM agar plates (20 worms/plate) and kept at

room temperature until the food on the plates was almost gone. Then, the worms were

transferred to 1 L Erlenmeyer flasks containing pre-autoclaved S medium (250 ml) for a

pre-culture (Day 1). The worms were grown at 22.5˚C for 3 d and fed on day 1 and day

3 with 40 mL and 20 mL of 25X E. coli (OP50), respectively. Then, sucrose floatation

was performed to obtain adult worms, followed by egg preparation using an alkaline

sodium hypochlorite solution. The collected eggs were hatched to L1 in M9 buffer

overnight. Then, the L1s were grown under NDI or DI condition in 5 mL of S medium.

NDI conditions contained 10,000 worms/mL with 20 mg/mL OP50, and DI conditions

contained 20,000 worms/mL with 5 mg/mL OP50. Either d2-asc-C6MK or glc-d2-asc-

C6MK (6 μM in final concentration) was spiked into the culture, or vehicle (ethanol) was

added as a control. The cultures were grown at 22.5˚C for 63 h.

For starved conditions, worms were pre-cultured in same way as described

above. Then, hatched L1s were grown in NDI conditions for 63 h and washed with M9

buffer several times. Sucrose floatation was used to remove the remaining bacteria,

and adult worms were collected. Then, the worms were incubated in M9 buffer for 30

min to remove bacteria from the gut. Worms (30,000 worms/mL) were cultured in 5 mL

of S medium for 2 d at 22.5˚C with glc-d2-asc-C6MK (6 M in final concentration)

without feeding.

51

For the worm cultures using different bacterial strains as food, N2 worms were

passaged onto a 10 cm NGM agar plate (20 worms/plate) and allowed to grow on the

plate until the food was almost gone. Then, the worms were washed with pre-

autoclaved S medium (150 mL) in a 500 mL Erlenmeyer flask and transferred back to

the flask to start the liquid culture (Day 1). The worms were shaken at 22.5˚C for 9 d

and fed with a bacteria stock (100 mg/mL) every day from day 1 to day 9. On day 10,

the worm medium was harvested by placing the flask in an ice-bath for an hour, and

then collecting the medium from the top by pipet and centrifuging it at 3500 rpm for 30

min. The collected worm medium was freeze-dried, ground, and extracted with 150 mL

of ethanol for 2 h. Then, the ethanol extract was filtered and collected, and the filtered

residue was extracted with additional 150 mL of ethanol overnight. The medium was

filtered again, and the ethanol extracts were combined, rotovaped to dryness, and

resuspended in 5 mL of methanol. The medium was filtered using a Pasteur pipet

column packed with cotton, and the column was washed with an additional 2 mL of

methanol. The flow-through was collected, dried, and stored at -20˚C before use.

3.4.4 Identification of B20 by 16S rRNA Gene Sequencing3

The B20 overnight cultures were collected, resuspended in lysis buffer (10 mM

Tris-HCl pH8.0, 1 mM EDTA, 1.1% SDS), and boiled for 5 min at 100 °C. The pellets

were incubated with 3 μL RNase A (Qiagen 100 mg/mL) for 15 min at 37 °C, put on ice

for 1 min, added 200 μL protein precipitation solution (5 M NH4OAc) with vortex for 20

sec and centrifuged. 600 μL isopropanol was added into the supernatant and the

resulting DNA pellets were washed with 500 μL 70% ethanol twice. The pellets were air-

3 This part is done by Likui Feng from our laboratory.

52

dried and rehydrated with 100 μL TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA). The

full-length 16S rRNA genes were amplified by the primers 8F (5’-

AGAGTTTGATCCTTGGCTCAG-3’) and 1492R (5’-GCTTACCTTGTTACGACTT-3’),

sequenced and analyzed by blastn.

3.4.5 Testing Bacterial Strains for Glucosidase Activity

The bacterial strains used in this study include OP50, B20, M. nematophilum

(CBX102), and various strains collected from rotting apples on which wild C. elegans

isolates were also found (JUb38-52 and JUb126-128). The apples were collected from

an orchard in Santeuil, which is 50 km northwest of Paris, France. OP50, B20, and

CBX102 were grown in LB medium at 37°C, JUb38-52 were grown in LB medium at

room temperature, and JUb126-128 were grown in mannitol medium (5g yeast extract,

3g peptone, 25g mannitol in 1L) at room temperature. Most bacterial strains were

grown in 5 mL of medium overnight to saturation, but some of the JUb strains required a

couple of days before the cultures became saturated. The bacterial cultures were

centrifuged at 3500 rpm for 10 min. The pellets were resuspended in 2 mL of S medium,

and glc-d2-asc-C6-MK (3 M, final concentration) was added to the resuspended

cultures. The cultures were shaken overnight at 22.5°C and then were centrifuged.

The medium from each culture was freeze-dried, extracted with 100 L of 50% (vol/vol)

methanol in water, and centrifuged at 15000 rpm for 1 min. 5 L of the extract was

injected into LC-MS to analyze conversion.

To make bacteria stocks of OP50, CBX102, and JUb48, the bacteria were grown

in 5 mL of LB medium overnight (2 d for JUb48). 1 mL of the bacteria culture was

inoculated into 1 L of LB medium and cultured overnight (2 d for JUb48). The cultures

53

were then centrifuged at 3500 rpm for 10 min and resuspended with S medium to make

stocks (100 mg/mL). The 1% CBX102 (vol/vol) was made by mixing with OP50 stock.

3.4.6 Sample Preparation

To collect culture medium, each worm culture flask was placed in an ice-bath for

30 min to settle the worms, and the medium was pipetted from the top to new tube. The

medium was centrifuged at 3500 rpm for 10 min. 1 mL of the medium was freeze-dried,

extracted with 100 L of 50% (vol/vol) methanol in water, and centrifuged (15000 rpm

for 1 min). 5 L of the extract was injected into the LC-MS.

To prepare samples from extracted 150 ml worm culture medium, the dried worm

medium was resuspended in 1 ml LC-MS grade methanol, vortexed vigorously, and

sonicated for 5 min. Then, take 50 μL of the resuspended medium out and transferred

to 1.5 mL Eppendorf tube to centrifuge at 15000 rpm for 5 min. 5 μL of the supernatant

was injected into the LC-MS.

3.4.7 LC-MS Analysis

LC-MS analysis of ascarosides was performed on a Phenomenex Luna 5 μm C18

2 100 Å (100 x 4.6 mm) column attached to an Agilent 1260 infinity binary pump and

Agilent 6130 single quad mass spectrometer with API-ES source, operating in dual

negative/positive single-ion monitoring mode. A water (with 0.1% formic acid) and

acetonitrile (with 0.1% formic acid) solvent gradient was used, holding at 5% acetonitrile

for 5 min, ramping to 60% acetonitrile over 20 min, ramping to 100% acetonitrile, and

then holding at 100% acetonitrile for 4 min. All ascarosides were detected by LC-MS

using the [M-H]- ion, except for asc-C6-MK, glc-asc-C6-MK, d2-asc-C6-MK, and d2-glc-

asc-C6-MK, which were detected using the [M+Na]+ ion.

54

CHAPTER 4 CHARACTERIZATION OF BACTERIAL CUES THAT CONTROL DAUER

DEVELOPMENT IN Caenorhabditis elegans

4.1 Background

In 1984, Golden and Riddle proposed that the food signal is a water-soluble

small molecule that induces dauers to recover to the L4 stage (12). It was determined

that various commercial bacteriological media, including yeast extract, beef-blood

serum, corn meal agar, and bean pod agar have food signal activity, but bacteria-

conditioned medium has the highest amount of food signal activity. Since the structure

of the food signal remains unidentified, it was unknown whether all of these food signals

are the same molecule. In an effort to characterize the molecule(s) responsible for the

food signal activity, Golden and Riddle showed that the food signal is unstable when

stored in water at room temperature, easily oxidized, and stable to heating, autoclaving,

and treatment with acid or base. Although the food signal was shown to have similar

chromatographic properties as pyrimidine nucleosides, none of the candidate

nucleosides tested induced dauer recovery.

The dauer pheromone and food signal are thought to be sensed by the amphid

chemosensory organs, which are located in the head of C. elegans (53). Each amphid

has 12 neurons and 8 of the neurons are exposed to the external environment (Figure

4-1) (54,55). Among the exposed neurons, ASI, ADF, ASG, and ASI regulate a

development of dauer and, especially, ASJ is important in dauer recovery (53). Like the

dauer pheromone ascarosides, the food signal is thought to target G-protein coupled

receptors (GPCRs) in the amphid neurons (13) and modulate several signaling

pathways, including the insulin/IGF-1 (56,57) and TGF-β pathways (58,59). The food

signal is detected by the chemosensory receptors in the exposed amphid neurons

55

resulting in the secretion of insulin and TGF-β. The respective pathways are activated

and hormones are produced which promotes reproductive growth (Figure 4-2).

Identification of the chemical structure of the dauer pheromone has enabled the

identification of several GPCR’s that it targets (34). Similarly, if the structure of the food

signal can be identified, it may enable the identification of the food signal’s receptor and

how those receptors couple to downstream signaling pathways. Furthermore, the

insulin/IGF-1 and TGF-β pathways regulate metabolism and the aging process as well

as development of dauer (60). As these pathways are conserved in higher organisms

(61), understanding these signal transduction pathways could provide key insights into

higher organisms.

Figure 4-1. Structure of the amphid opening in a head (A) and exposed amphid

neurons (B). The figures were reprinted from Albert et al., J. Comp. Neurol. 1981, 198 (3), 435-451 and Perkins et al., Dev Biol, 1986, 117 (2), 456-487, respectively.

56

Figure 4-2. Pathways in both normal developmental stages and dauer stage. The figure

was reprinted with permission from N. Fielenbach and A. Antebi, Genes & Dev. 2008 22:2149-2165. Copyright 2008 Cold Spring Harbor Laboratory Press.


4.2.1 Identification of Defined Nutrients That Promote Dauer Recovery in C. elegans

In order to determine whether specific nutrients have food signal activity, the

defined components of a semi-defined, axenic (no bacteria) medium, called CeHR, had

been screened for their ability to induce dauer recovery. CeHR consists of 13 nutrients,

http://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=An external file that holds a picture, illustration, etc.Object name is 2149fig2.jpg [Object name is 2149fig2.jpg]&p=PMC3&id=2735354_2149fig2.jpg

57

including vitamins, growth factors, essential amino acids, and non-essential amino

acids, as well as milk.(62) Complete CeHR is only semi-defined because it contains

milk which is necessary for optimal growth. Although a couple of fully chemically

defined media have been developed, including Caenorhabditis briggsae Maintenance

Medium (CbMM)(63) and Caenorhabditis elegans Maintenance Medium (CeMM)(64),

these media do not support optimal growth. Because a mixture of the defined

components of CeHR had the food signal activity, each component was tested in the

dauer recovery assay individually. These defined components may or may not be the

same as the food signal molecules that are secreted by bacteria.

The CeHR medium consists of 13 chemically defined components and skim milk.

In order to determine whether the CeHR medium has food signal activity, the complete

CeHR medium, the 13 defined components combined without milk, and also the milk

itself were tested in the dauer recovery assay. The complete CeHR medium induces

dauer to recover and also, the milk component and combined 13 components of the

medium without milk have similar activity in the dauer recovery assay (Figure 4-3).

Although the milk component has a great amount of the activity, the other 13 ingredients

are studied primarily rather than the milk, because the milk is an undefined component.

To find active components, the defined 13 components were tested individually in

the assay, but none of them had activity (Figure 4-4), which implies that more than one

component is needed to make dauer larvae recover. Then, each component was

subtracted out of 13 components to identify crucial components for activity, and the

activity significantly decreased when the vitamin mix was subtracted (Figure 4-5). This

58

result suggests that the vitamin mix has a critical role in the regulation of the dauer

recovery.

Figure 4-3. Ratio of recovery of the complete CeHR medium, the milk, and combined

13 defined components without milk. The CeHR medium with or without milk had a high activity as a positive control. Milk itself also had high activity as others. Water and active bacteria-conditioned medium are used as negative control and positive control, respectively.

Figure 4-4. Ratio of recovery of individual component of CeHR medium. Negative

control is water and positive control is the combined 13 components of the CeHR medium. None of the individual component did not make dauers recover. Each number on X-axis represents individual component of the the medium: 1. Choline diacid citrate, 2. Vitamin Mix, 3. i-Inositol, 4. Hemin, 5. Nucleic acid mix, 6. Mineral mix, 7. Lacta

CHEMICAL SIGNALING IN Caenorhabditis elegans AND...

Documents

Transcript of CHEMICAL SIGNALING IN Caenorhabditis elegans AND...