Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption...
-
Upload
samson-bryan -
Category
Documents
-
view
224 -
download
0
Transcript of Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption...
![Page 1: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/1.jpg)
Chemical Approaches to theDisruption of Telomerase Function
Chemical Approaches to theDisruption of Telomerase Function
Joseph StringerBlackwell Group 1.25.07
![Page 2: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/2.jpg)
2
Cancer
- 1,444,000 predicted new cases diagnosed in 2007 (U.S.)
- 559,650 expected deaths from cancer in 2007 (U.S)
- 2nd leading cause of death (U.S.)- $206 billion cancer costs in 2006 (U.S)
- Emotional aspect
www.cancer.org
![Page 3: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/3.jpg)
3
Traditional Cancer TreatmentsRadiotherapy – damaging DNA by ionization
not selective/highly toxic
Surgery – removal of malignant tumordifficult to
remove/invasive
Chemotherapy – use of drugsside effects
Telomerase inhibitors – selective/minimal side effects
![Page 4: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/4.jpg)
4
Biology Basics
Human body
Systems
Organs
Tissue Cells
Nucleus
Chromosomes
DNA
![Page 5: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/5.jpg)
5
DNA Basics
5'
3'
3'
5'
![Page 6: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/6.jpg)
6
End Replication Problem
3'
3'
5'
5'
5'
3'
5'
3'
replication
replication
replication
Cell death
Critically short DNA
3'5'
5'
3'
5'3'
5'
3'
![Page 7: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/7.jpg)
7
Human Telomere
- Long telomeres have many protective proteins- Critically short telomeres have few protective
proteins- Critically short telomeres are vulnerable
www.cancer.org
![Page 8: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/8.jpg)
8
Human Telomere
……………………TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
……………………AATCCCAATCCCAATCCC (5,000-20,000 bases) (100-400 bases)
Double-stranded Single-stranded
Rest of DNA
Telomere region
-Telomere DNA does NOT code for any genetic information
![Page 9: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/9.jpg)
9
Cell Division
Cancer cell – “immortal”
Shay, J.W., et al. Nature Reviews Drug Discovery 2006, online.
The telomerase enzyme maintainstelomere length in cancer cells,preventing cell death
Normal cell – cell death
![Page 10: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/10.jpg)
10
Telomerase Enzyme
Shay, J.W., et al. Nature Reviews Drug Discovery 2006, online.
Active in ~85% of cancer cells
Absent/undetectable in normal, healthy cells
Telomerase active
Telomerase NOT active
Normal cell – cell death Cancer cell – “immortal”
![Page 11: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/11.jpg)
11
Telomerase Timeline
Telomerase discovered(Blackburn/Greider)
Telomerase activity in cancercells, but not healthy cells(Kim)
Telomere ligandInhibits telomerase(Hurley)
Telomerase doesNOT cause cancer(Wright/Shay)
Crystal structureof human telomere(Neidle)
Wright, W., Shay, J., Nature Reviews Drug Discovery 2006, online.
![Page 12: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/12.jpg)
12
Targeting Telomerase Activity
Inhibit telomeraseassembly proteins
Inhibit telomeraseassembly proteins Telomerase enzyme
-RNAi-RT inhibitors (HIV)-Artificial peptides
Telomerase enzyme-RNAi-RT inhibitors (HIV)-Artificial peptides
RNA template-Peptide nucleic acid (PNA)-Antagonist oligonucleotides
RNA template-Peptide nucleic acid (PNA)-Antagonist oligonucleotides
Telomere-Stabilizing ligands
Telomere-Stabilizing ligands
Gellert, G.C., et al. Drug Discovery Today 2005, 2, 159-164.
![Page 13: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/13.jpg)
13
Guanine - Quadruplex
Zahler, A.M., et al. Nature 1991, 350, 718-719.Gabelica, V., et al. J. Am. Chem. Soc. 2006, 128, 2641-2648
Highly stable G-quadruplex (G4)can inhibit telomerase activity
……TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG……AATCCCAAT
![Page 14: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/14.jpg)
14
G4 Inhibitors -Proposed Mechanism
5'
3'
+ G4 Ligand
…………TTAGGGTTAGGGTTA…………AATCCCAATCCC
…………TTAGGGTTAGGGTTAGGGTTAGGG…………AATCCCAATCCC
(TTAGGG)n
Inhibition ofelongation …cell dies
Telomere elongation… cell lives
Telomerase
![Page 15: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/15.jpg)
15
G4 Selectivity
- Structural diversity provides basis for selective recognition between duplex DNA vs. G4 DNA
- π stacking potential on guanine faces
vs.
duplex DNA G4 DNA
Neidle, S., Read, M.A., Biopolymers 2001, 56, 195-208.Baker, E.S., et al. J. Am. Chem. Soc. 2006, 128, 2641-2648.
![Page 16: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/16.jpg)
16
G4 Ligand Design
- DNA intercalators are toxic- Characterized by large, flat aromatic core,
possibly protonated in center- Need to design ligands selective for G4
DNA
Common DNA intercalators
Chan, A., et al. J. Med. Chem. 2005, 48, 7315-7321.
Cryptolepine Proflavine Ethidium bromide
DNA Intercalated DNA
![Page 17: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/17.jpg)
17
Classes of G4 Ligands
Polycycles Macrocycles
![Page 18: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/18.jpg)
18
Acridine Derivative
- Synthesized in 2001 based on parent acridine intercalator- - 45:1 selectivity for G4 DNA vs. duplex DNA- Phase I/II clinical trial (Antisoma)
Read, M., et al. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 4844-4849.
EC50 115 nM
![Page 19: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/19.jpg)
19
BRACO19 Synthesis
Read, M., et al. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 4844-4849.
![Page 20: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/20.jpg)
20
BRACO19
Read, M., et al. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 4844-4849.
G4 DNA
![Page 21: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/21.jpg)
21
Quinoline Derivatives
Guyen, B., et al. Org. Biomol. Chem. 2004, 2, 981-988.
ΔTm G4 ΔTm dsDNA
quinoline der.
13.0°C 0.0°C
BRACO19 27.5°C -
EC50 ~ 6.3µM
![Page 22: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/22.jpg)
22
Quinoline Synthesis
Guyen, B., et al. Org. Biomol. Chem. 2004, 2, 981-988.
![Page 23: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/23.jpg)
23
G4 Crystal Structure
Parkinson, G.N., Lee, M.P.H., Neidle, S., Nature 2002, 417, 876-880.
Axial view
Side view
=
π stackingpartial (+) charge
Interaction with (-) chargedphosphate backbone
![Page 24: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/24.jpg)
24
“Clicked” Triazoles
- π stacking with guanine faces
Moorhouse, A.D., et al. J. Am. Chem. Soc. 2006, 128, 15972-15973.
ΔTm G4
ΔTm dsDNA
triazole 18.7°C 0.0°C
BRACO19 27.5°C -
![Page 25: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/25.jpg)
25
“Clicked” Triazoles
- “Click chemistry”, highly flexible- Selective for G4 DNA vs. duplex DNA- Generation of π stacking motif
Moorhouse, A.D., et al. J. Am. Chem. Soc. 2006, 128, 15972-15973.
![Page 26: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/26.jpg)
26
Classes of G4 Ligands
Polycycles Macrocycles
![Page 27: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/27.jpg)
27
Telomestatin
- First isolated in 2001 from Streptomyces anulatus
- - Total synthesis
finished in 2006, 21 steps, <1% overall yield
- First natural product shown to bind selectively to G4 DNA
Shin-ya, K., et al. J. Am. Chem. Soc. 2001, 123, 1262-1263.Doi, T., et al. Org. Lett. 2006, 8, 4165-4167.
EC50 5 nM
![Page 28: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/28.jpg)
28
Cyclic Oxazoles
- Minimal duplex DNA stabilization
- 8 steps, ~14% overall yield
Minhas, G.S., et al. Bioorg. Med. Chem. Lett. 2006, 16, 3891-3895.Jantos, K., et al. J. Am. Chem. Soc. 2006, 128, 13662-13663.
R stereochem.
ΔTm G4 ΔTm dsDNA
(CH2)4NH2 R,R,R 6.4°C 0.0°C
telomestatin
- 27.4°C 0.0°C
![Page 29: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/29.jpg)
29
Heterocycle-Peptides
Schouten, J.A., et al. J. Am. Chem. Soc. 2003, 125, 5594-5595.Green, J.J., et al. J. Am. Chem. Soc. 2006, 128, 9809-9812.
- Peptides introduce versatility
- Additional interaction with G4 grooves/phosphate groups
![Page 30: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/30.jpg)
30
Heterocycle-Peptides
>50:1 selectivity G4 DNA vs. duplex DNA
Schouten, J.A., et al. J. Am. Chem. Soc. 2003, 125, 5594-5595.Green, J.J., et al. J. Am. Chem. Soc. 2006, 128, 9809-9812.
![Page 31: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/31.jpg)
31
Metal Complexes
- Ni(II) forces planarity, resulting in π stacking
- Piperidine interaction with phosphate backbone
Reed, J.E., et al. J. Am. Chem. Soc. 2006, 128, 5992-5993.
![Page 32: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/32.jpg)
32
Metal Complexes
- Generation of aromatic motif
- >50:1 G4 DNA vs. duplex DNA
-
Reed, J.E., et al. J. Am. Chem. Soc. 2006, 128, 5992-5993.
ΔTm G4 ΔTm dsDNA
Ni(II) complex
32.8°C 0.0°C
telomestatin
27.4°C 0.0°C EC50 120 nM
![Page 33: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/33.jpg)
33
Metal Complexes
![Page 34: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/34.jpg)
34
G4 Ligand Issues
1. G4 structures can be polymorphic in vivo
Gabelica, V., et al. J. Am. Chem. Soc. 2007, 129, 895-904.
![Page 35: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/35.jpg)
35
G4 Ligand Issues
2. Do G-quadruplex structures exist elsewhere in DNA ?
- Difficult to predict based on DNA sequence- A few have been found in promoter regions
of oncogenes – dual mechanism?
YES
Siddiqui-Jain, A., et al. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 11593-11598.
![Page 36: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/36.jpg)
36
Future Directions of G4 Ligands
Need deeper understanding of G4-ligandinteractions
Possible use as a gene suppressor ?
Metal complexes ?
![Page 37: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/37.jpg)
37
Telomerase Inhibitors: Therapeutic Future
- Need more in vivo testing- Used in combination with traditional
therapy- What about other ~15% of cancer cells ?- Cure for cancer ?
“For every complex problem there is asolution that is simple, neat, and wrong”
- H.L. Mencken
![Page 38: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/38.jpg)
38
AcknowledgementsProf. Helen E. Blackwell
Team Blackwell*Ben Gorske Blake Carlson *Beth Mascato*Grant Geske Aleeza Roth *Rick
McDonald*Jenny O’Neill Dr. Matt Bowman Prof. John
Berry*Qi Lin Wa Neng Thao*Sarah Fowler Margaret Wong*Daniel Fritz *Lingyin Li*Brent Bastian*Margie Mattmann*Christie McInnis*Reto Frei* Practice talk attendees
...I get by with a little helpfrom my friends
![Page 39: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/39.jpg)
39
Supplemental Slides
![Page 40: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/40.jpg)
40
Telomere Capping
- Dynamic equilibrium between G4 and non G4 state
- Telomere must be in linear form for telomerase activity
![Page 41: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/41.jpg)
41
FRET Analysis (ref 26)
FRET analysisFluorescence Resonance
Energy Transfer
- Correlates temperature change with a stabilized/unstabilized DNA structure
![Page 42: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/42.jpg)
42
TRAP Assay (ref 26)
Telomere Repeat Amplification Protocol
- Used for quantitative and qualitative telomerase inhibition
![Page 43: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/43.jpg)
43
• www.txccc.org• www.childrenscancernetwork.org
![Page 44: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/44.jpg)
44
DNA Replication
- Requires initial RNA primer
- Replication only proceeds in 5→3 direction
- After removal of terminal RNA primer, gap is left
- DNA cannot add to the 5' end (wrong direction)
http://www.senescence.info/telomeres.html
Primer removal
DNA base pairaddition
![Page 45: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/45.jpg)
45
Telomere Capping
- Cell can replicate with a capped state, until telomere gets short, then it will uncap and telomerase will add length
- When a telomere is very short, it cannot be capped efficiently, and the single stranded G-rich DNA can form G-quadruplexes, thus making a target for G4 ligands
- Cancer cells with short telomeres must “expose” their loose end (become linear) to add on and keep living
![Page 46: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/46.jpg)
46
G4 Ligand Issues
1. Selectivity G-quadruplex vs. duplex DNA
Minimize toxicity
vs.
![Page 47: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/47.jpg)
47
G4 Ligand Char.
- π stacking ability of central core
- Positively charged substituents to interact with negatively charged phosphate backbone
Partial positive charge in center
Neidle, S., Lee, M.P.H., Parkinson, G. N. Nature. 2002, 417, 876-880.
![Page 48: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/48.jpg)
48
Telomere Structure-Guanine (G)-Tetrad
- Higher order structure of single stranded, Guanine rich DNA
- Guanines are co-planar
- Occurs in telomeres when left “uncapped” by protective proteins
![Page 49: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/49.jpg)
49
G4 Inhibitors -Proposed Mechanism
- Stabilization of G-quadruplex leads to telomerase inhibition
Mergny, J-L., et al. Nature Medicine. 1998, 4, 1366-1367.
![Page 50: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/50.jpg)
50
Human Telomere
- Protects against gene deletion
- Usually capped by protective proteins
- When telomeres become critically short, they become uncapped and are vulnerable
![Page 51: Chemical Approaches to the Disruption of Telomerase Function Chemical Approaches to the Disruption of Telomerase Function Joseph Stringer Blackwell Group1.25.07.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649da75503460f94a92e5c/html5/thumbnails/51.jpg)
51
Telomestatin Binding
Hurley, L.H., et al. J. Am. Chem. Soc. 2002, 124, 4844-4849.
- External binding
>70 fold selectivity G4 vs. duplex DNA