Characterization oftheThyroid Hormone Response Element...

Vol. 4, 269-279, April 1993 Cell Growth & Differentiation 269

Characterization of the Thyroid Hormone Response Elementin the Skeletal a-Actin Gene: Negative Regulation ofT3 Receptor Binding by the Retinoid X Receptor’

George E. 0. Muscat,2 Russell Griggs, Michael Downes,and Jacqueline Emery

University of Queensland, Centre for Molecular Biology andBiotechnology, Ritchie Research Laboratories, St. Lucia,4072, Queensland, Australia

Abstract

We have identified a T3 response element (TRE) in thehuman skeletal a-adin gene between nucleotidepositions -273 and -249 (5’ GGGCAACTGGGTCG-GGTCAGGAGGG 3’) that is accommodated by thecore receptor binding motif, A/G GG T/A C A/G. Thissequence conferred appropriate hormonal regulation ina thyroid hormone receptor (TRa) dependent mannerto an enhancerless SV4O promoter. Eledrophoreticmobility shift assay experiments showed thatEscherichia coil expressed and affinity purified TRabound to the skeletal a-adin TRE in a sequence specificmanner. The a-adin TRE bound TRa dimerscooperatively. Mutagenesis of the a-adin TRE indicatedthat the core binding motifs and the gap sequenceswere the most important for efficient binding to TRot.The retinoid X receptor a (RXRa) interaded with the a-actin TRE in a sequence specific fashion and formedheterodimeric complexes with TRot on the a-adin TRE.However, increased levels of RXRa decreased thebinding of TRot to the a-adin TRE, in contrasf topromoting TRot binding to the a-myosin heavy chainTRE. Furthermore, the a-adin, palindromic, syntheticdired repeat, a-myosin heavy chain, and growthhormone TREs interaded with an identical nuclearfador in vitro in muscle cells. In conclusion, our datasuggest that the human skeletal a-actin TRE is a targetfor dired cross-talk between two different hormonalsignals (T3 and 9-cis-retinoic acid) at the receptor level.To our knowledge, this is the first demonstration ofhomodimeric and heterodimeric binding of TRa andRXRa to a TRE in a gene expressed primarily in skeletalmuscle.

lntrodudion

Thyroid hormones and netinoids regulate diverse aspectsof cellular development and homeostasis by serving asbiological signals to control cell growth and differentia-tion. The effects of these ligands are primarily mediatedby intracellular receptors that are members of the steroidand thyroid superfamily of receptors that act as ligand

Received 1 1/1/92; revised 1/6/93; accepted i/i 1/93.1 This work was supported by the Australian Research Council and a

University of Queensland New Staff Research Grant. G. E. 0. M. is anR. D. Wright Fellow ofthe National Health and Medical Research Council.2 To whom requests for reprints should be addressed.

modulated transcription factors. This superfamily is de-fined by a highly conserved 66/68-amino acid domainpredicted to form zinc finger structures that are necessaryfor sequence specific interactions with cis-acting regula-tony elements of target genes (1, 2). In addition, a lesswell conserved COOH-terminal region of approximately220 amino acids functions as a ligand binding domainand facilitates receptor dimenization. The DNA bindingdomains exhibit ‘�-50% amino acid identity, whereas theligand binding domains are 34% identical with respect tothe superfamily of receptors (1, 2). The similarities be-tween the DNA and hormone binding domains of TRs3and RARs suggest that they may utilize common mech-anisms for the regulation of target gene transcription.

In mammals, there are two distinct genes encodingthyroid hormone receptors, c-erbA-a and c-erbA-/�,which have been localized to chromosomes 3 and 17.The c-erbA-cx gene is alternatively spliced into a1 and ot2(hormone and non-hormone binding) isoforms, respec-tively. The a-isoform of the receptor is most abundant inheart and skeletal muscle, central nervous system, andkidney. intriguingly, the c-erbA-cx locus has also beendemonstrated to contain an overlapping transcriptionunit utilizing coding information on the opposite strand(rev-erb). The a2 and rev-enb isoforms seem to regulatethe function of c-erbA-a1 (3).

The RAR, TR, VDR, and RXR activate transcriptionfrom response elements containing degenerate copies ofthe consensus AGCTCA motif (4-9). A functional rela-tionship among the RXR, VDR, TR, and RAR has recentlybeen described in which these receptors bind and acti-vate through tandem direct repeats, AGGTCA N0AGGTCA, with spacing of 1, 3, 4, and 5 nucieotides,respectively [x = 2, also mediates a positive response toRA and a negative response to T3] (4-7, 10-13). Theorientation and spacing of the core motifs appear todictate selective transcriptional effects by each of thereceptors. A palindromic arrangement of core motifs,AGGTCATGACCT (PA[-0), confers transcriptional re-sponses to TR, RAR, and RXR.

Many T3 responsive genes are also subject to retinoidcontrol. This coregulation underscores the critical rolethat both hormones play in development and differentia-tion and reveals a functional relatedness. The RAR, TR,

3 The abbreviations used are: TR, thyroid hormone receptor; RA, retinoicacid; RAR, retinoic acid receptor; RxR, retinoid x receptor; VDR, vitaminD receptor; MHC, myosin heavy chain; HSA, human skeletal a-actin;TRE, T3 response element; GH, growth hormone; SRE, serum responseelement; DR. direct repeat; PAL, palindromic repeat; CAT, chloramphen-icol acetyltransferase; CMV, cytomegalovirus; EMSA, electrophoretic mo-bility shift assay; r-, rodent; c-, chicken; h-, human; DOTAP, N-[i-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl ammonium-methylsulfate; HEPES,N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid; DMEM, Dulbec.co’s modified Eagle’s medium; FCS, fetal calf serum; PMSF, phenylmeth-ylsulfonyl fluoride.

270 TRE of the Human Skeletal a-Actin Gene

and VDR require accessory/auxiliary factors present innuclear extracts for high affinity binding to their cognatesequences (10-13). The retinoid X receptor family is oneof these accessory proteins and is activated by the newlyidentified ligand 9-cis-retinoic acid. Unlike the RARs,which reveal only limited expression in the adult, theRXR family is abundantly expressed in the adult. RXRaand -/3 are expressed in many tissues but most abundantlyin liver, lung, kidney, and skeletal and cardiac muscle(14). RXR’y is preferentially expressed in skeletal andcardiac muscle (14). The RXRs heterodimenize with theTRs, VDRs, and RARs and function to selectively targetand modulate the binding of these receptors to theircognate elements (10-13). This hetenodimenization neg-ulates the transcriptional activity and ligand sensitivity ofthese receptors. This enhanced binding and functionalactivity seems to require two distinct hormones, suggest-ing that there is direct cross-talk between 9-cis-retinoicacid (15, 16) and many different hormonal signals, thusimplying that RXR has a central role in modulating mul-tiple hormone signaling pathways.

Hypen- and hypothyroidism result in increases anddecreases, respectively, in cardiac output and contrac-tion velocity (1 7, 18). In skeletal muscle, hyper- andhypothyroidism result in the precocious and retardeddevelopment, respectively, of fast contractile proteingene expression (19). T3 induced increases in skeletal a-actin mRNA (20-22) were mediated by direct transcnip-tional mechanisms; furthermore, the cis-acting Se-quences between nucleotide positions -432 and -153in the skeletal a-actin gene were required for the T3 andTR dependent trans-activation in vivo (22).

Our present study was directed toward the precisemapping and in vitro/in vivo functional characterizationof the TRE in the HSA gene, which was located betweennucleotide positions -432 and -153. We demonstratedthat the sequences between nucleotide positions -273and -249 conferred hormonal regulation in a TR de-pendent manner to an enhancerless SV4O promoter.Furthermore, we overexpressed and affinity purified TRafrom Escherichia co/i and showed that it bound to the a-actin TRE as monomers and dimens. Similar results wereobtained with our control, the recently characterizedrodent a-MHC TRE (23, 24). E. co/i expressed and pun-fied RXRa bound to the a-actin TRE and formed heter-odimers with TRot on the actin promoter. interestingly,increased levels of RXRa decreased the binding of TRotto the a-actin TRE, in contrast to promoting TRot bindingto the a-MHC TRE.

Results

The Sequences between Nucleotide Positions -273 and-249 in the Human Skeletal a-Adin Gene Confer T3Regulation to an Enhancerless SV4O Promoter. We pre-viously showed that the cis-acting sequences betweennucleotide positions -432 and -1 53 were required forthe T3/TR dependent trans-activation in myogenic C2C1 2and fibroblast-like COS-l cells (22). Putative TREs wereidentified using the core receptor binding motif, A, GGT/ C A/G, between nucleotide positions -273/-249 and-173/-149, in the HSA gene. These were arranged asdirect repeats, with four nucleotide gaps (Fig. 1). Thesequences of these regions are indicated below.

(1) HSA -273/-249 5’ CGCCAACTCGCTCGGCTCAG-GACC 3’ and

(2) HSA -173/-149 5’ TCCTCAACCCACCCGACCCC-CCGC 3’

We speculated (22) that the TRE was located at nu-cleotide position -1 73/-l49, based on competition witholigonucleotides between nucleotide positions -168/-146 and -70/-46 in the rGH gene (6, 7). However,many recent rCH TRE studies, in conjunction with theelegant studies that elucidated receptor binding to tan-dem repeats with variable spacing, verified that the bestTRE was located between nucleotide positions nCH-l90/-l66 (25-27). This sequence was arranged as adirect repeat with a 4-base pain gap and a palindrome(Fig. lA).

In the light of these studies, we cloned both putativeTREs into an enhancenless SV4O promoter and conductedexperiments to identify which sequences conferred ap-propriate hormonal regulation. We cloned single andmultiple copies of each oligonucleotide upstream of anenhanceniess SV4O promoter (Fig. 1B). We observed thatinsertions of one, two, on five copies of the -173/-l49sequences, when transfected into COS-l in the presenceof cotransfected TRot, resulted in T3 inductions of 1.68-,1.55-, and 2.21-fold, respectively. The basal vector alsoshowed modest inductions of 2. 1 5- and 1 .64-fold, ne-spectively, after T3 treatment in the presence and ab-sence of cotransfected rodent TRot (Fig. 18). In contrast,a more significant effect was observed after the cloningof the HSA -273/-249 sequences. Insertion of two andthree copies of the -273/-249 sequences resulted in T3inductions of 4.39- and 4.13-fold, respectively, aftertransfection into COS-l cells in the presence of cotnans-fected TRot (Fig. 1, B and C). This level of mnducibilitycorrelated with the 4.4-fold, T3 dependent trans-activa-tion of the transfected human skeletal a-actin promoterin the presence of either c-erbA-a or c-enbA-f3 (22). Theseresults demonstrated that a functional and positive TREwas located in the cis-acting region between nucleotidepositions -432 and -153, which is required for thyroidhormone dependent regulation of the human skeletal a-actin gene.

The Human Skeletal a-Adin TRE (-273/-249) Bindsto E. coil Expressed and Affinity Purified Thyroid Hor-mone Receptor and Is Specifically Competed by the rGH,rMHC, PAL-0, and DR-4 TREs. We further characterizedthe TRE at nucleotide position -273/-249 by demon-strating that it bound affinity purified thyroid hormonereceptor a with high affinity and sequence specificity.We cloned the cTRa into pCEX-l . cTRa was expressedas a fusion with glutathione-S-transferase in E. co/i andaffinity purified with glutathione-aganose (Sigma), as de-scnibed previously. We selected cTRa because it hasbeen successfully expressed in E. co/i by Forman andSamuels (28) and utilized to identify and characterizecooperative binding of the thyroid hormone receptor tothe rodent growth hormone, a-myosin heavy chain, andmalic enzyme TREs (23, 27).

We incubated increasing concentrations (0.5-13.5pmol) of purified receptor to a fixed quantity of labeleda-actin TRE and our control, the recently characterizedrMHC TRE (Fig. 2A). At low concentrations of TRot, onlythe monomer complex was detected. Increased receptor

PAL-O

DR-4

B)

pCATo’�asaI promotcr)

pCAT 173-1

pCAT 173-2

pCAT 173-5�

pCAT 273-2

pCAT 273-3

C)

13 Induction

#{247}TR -TR

2.15(45) 1.64(.28)

I .68(.22)

I .55(.07)

2.21(.61)

4.39(1.2)

4. 13(.88)

T3(lOOnMI

I�ane PlumldsPCAT 273-3 +pCMV4 VTRa

112O

I11+

�S S�#{149}

�#{149} I61 ‘1+

Cell Growth & Differentiation 271

fig. 1. A, the putative thyroid hormone response

elements in the human skeletal a-actin promoterand the TRE sequences from a number of othercharacterized genes. The sequences of one strandof each double-stranded oligonucleotide probe are

depicted. Solid arrows, direction and location of theTREs; dashed arrow, location of a TRE embedded inthe direct repeat. These sequences match the coresequence binding motif for the thyroid hormonereceptor: A/c CC T, � A/� PAL-0 is a palindromic/inverted repeat arrangement of motifs that confersa transcriptional response to RXR, TR, and RAR. Thenucleotide positions are indicated with respect tothe transcriptional start site at +1. B, functionalanalyses of the TREs in the human skeletal co-actingene. The mean T3 induction ratios (±SD) are shown

for plasmids containing the putative TRE sequencesin HSA -273/-249 and -173/-149 cloned into thepCAT-promoter construct. Results are shown fortransient transfections in COS-l cells. Each arrowrepresents the orientation of a single copy of thesequence in the pCAT plasmid. C, the skeletal a-actin TRE confers hormonal regulation to an enhan-cerless SV4O promoter. CAT assays demonstratingthe ability of the HSA -273/-249 sequences toconfer an erbAa mediated T3 response (100 nM) tothe pCAT plasmid in COS-1 cells. Lanes 1-6, atriplicate experiment involving the cotransfection of

the plasmids pCAT 273-3 and pCMV4 rTRa in theabsence and presence of T3.

A)

HSA -273/-249

HSA -173/-149

GH -190/-166

MHC -127/-159

>

gat cGGGCAACTGGGTCGGGTCAGGAGG

�gat cTGGTCAACGCAGGGGACCGGGCGG

�.

gat cAAGGTAAGATCAGGGACGTGACCGC

�‘ �. 1�

gat cCTCTGGAGGTGACAGGAGGACAGCAGCCCTGA

gat cTCAGGTCATGACCTGA

�.

gat cAGGTCACAGGAGGTCA

binding resulted in the formation of dimens. TRot clonedin the antisense orientation in pCEX-l and expressed andaffinity purified from E. co/i did not interact with HSA-273/-249 (data not shown). Scanning of these EMSAgels on a Molecular Dynamics phosphonimager and plot-ting the percentage of TRE bound as a monomer anddimer as a function of TRot (in pmoi) produced a sigmo-idal curve for dimen binding suggestive of preferentialreceptor dimenization at high concentrations (23, 27) (Fig.2B). Receptor cooperativity was tested by inverse/double

reciprocal plots of the dimenic binding. The points wereplotted, and a best fit polynomial curve was drawn thatfitted a hyperbolic relationship (Fig. 2C). The upwardlycurved parabola is characteristic of positive coopenativity(Fig. 2C) (23, 27).

We tested the defined and previously characterizedTREs from the rGH and a-MHC genes and the syntheticPAL-0 and DR-4 sequences in EMSA competition assaysto assess the sequence specific binding of TRot to HSA-273/-249. The oligonucleotides used in this study are

TOTAl.

DI&R

5 10 15 20Free TR (pmol)

C. Dimczreci�..�

I

0.0 0.5 1.0 1.5 2.01/Free TR (1/pmol)


D

M

MHC TRE

A

ACFIN TRE

I

wN.�I I

listed in Fig. 1 with the TRE orientations defined byarrows. These oligonucleotides were used in the bindingreactions at 10-, 20-, and 60-fold molar excesses withrespect to the HSA -273/-249 probe (Fig. 3). These dataindicated that the HSA -273/-249:TRa interaction couldbe competed by a wide variety of previously character-ized wild-type and synthetic TREs. This interaction wasfurther examined by testing the effect of competition bythe HSA -173/-149 sequence and an oligonucleotideencoding the SRE (Fig. 3). Neither of these sequencescompeted for the formation of the TRot complex, mdi-cating that the HSA -273/-249:TRa interaction was se-quence specific and only competed by defined TRE sites.

Mutagenesis of the a-Actin TRE in the Human Skeletala-Adin Gene Identifies the AGGTCA Motifs as EssentialTRot Binding Sites. Based on the methylation interferenceanalyses (data not shown), we synthesized a number ofmutated TREs, Ml-M6, depicted in Fig. 4A to furthercharacterize the nucleotides that interacted with clRcr.The mutant TREs were then analyzed and distinguishedwith respect to their affinity for cTRa. We labeled thenative a-actin TRE and the mutants, Ml -M6, and exam-med the ability of these sequences to directly interactwith cTRa. Fig. 4B (Lanes 2-7) indicated that Ml > M2> M6 > M3 > MS > M4 showed respectively loweraffinity for cTRa. To complement these direct bindingEMSA experiments, we incubated a wild-type skeletal a-actin TRE (-273/-249) probe with cTRa and competedwith 10-, 20-, and 60-fold molar excesses of the Ml ,M2,

B

fig. 2. Binding of increasing amounts of TRcc

to the actin and myosin heavy chain TREs. A,

E. coli expressed and affinity purified chickenTRo (0.5- 13.5 pmol) with labeled a-actin (HSA-273/-249) and cx-MHC TREs (-127/-1591.The products were analyzed on nondenatu-ring EMSA gels. M and 17, the positions of themonomer and dimer complexes. B, graphshowing the fraction of labeled a-actin TREbound as monomer, dimer, and total boundversus free TRa (pmol(. C, double reciprocalplots of 1/fraction a-actin TRE bound as dimerversus 1/free TRa.

M3, M4, M5, and M6 mutant TREs. Fig. 4C shows theEMSA competition analyses of the mutant M1-M6 TREoligonucleotides. Mutant a-actin TREs Ml, M2, and M6competed very efficiently for binding to cTRcs. In con-trast, M3, MS. and M4 TREs did not compete efficientlyfor binding to cTRcc and displayed, respectively, differ-ential and lower affinity for the receptor that correlatedwith the ability of these sequences to directly interactwith cTRa. The data indicated that the sequences in eachcore motif and the spacer region were crucial to binding.

The Human Skeletal a-Actin IRE (-273/-249) Bindsto E. coil Expressed and Affinity Purified Retinoid XReceptor and Is Specifically Competed by the rGH,rMHC, and Palindromic TREs. We further characterizedthe TRE at nucleotide position -273/-249 by demon-strating that it bound affinity purified human retinoid Xreceptor a in a sequence specific manner. We incubated‘�-l0 pmol of purified receptor to a fixed quantity (‘�-5 ng)of labeled ot-actin TRE and tested the defined and pre-viously characterized TREs from the rCH and cc-MHCgenes and the synthetic PAL-0 sequences in EMSA com-petition assays to assess the sequence specific binding ofRXRa to HSA -273/--249 (Fig. 5). PAL-0 has been shownto be stimulated by retinoic acid in a RXR-dependentfashion and to interact with purified RXRa. The oiigonu-cleotides used in this study are listed in Fig. 1A, and theTRE orientations are defined by arrows. These oligonu-

cleotides were used in the binding reactions at 10-, 20-,and 60-fold molar excesses with respect to the HSA


4 M. Downes, unpublished observations.

Probe: HSA -2731-249Receptor Thyroid Hormone ReceptorCompetitor GH TRE MHC ThE PAL-O DR-4MolarExcess C 10 20 60 10 20 60 C 10 20 60 10 20 60

- ‘.s_�.

-2731-249 -173/-149 SRE

C 10 20 60 10 20 60 10 20 60

�

� � � 4

Fig. 3. The skeletal a-actin TRE interacts with TRa in a sequence specific fashion. The effect of competition (10-60-fold molar excesses), by the GH,MHC, PAL-U, and DR-4 characterized TREs and various other nonspecific DNA sequences on the complex formed between the probe HSA -273/-249and TRa. The molar excess of each DNA competitor is indicated. C, the control binding reaction in the absence of any unlabeled competitor; SRI, serumresponse element.

-273/-249 probe (Fig. 5). These data indicated that theHSA -273/-249:RXRa interaction could be competedby a wide variety of previously characterized wild-typeand synthetic TREs. This interaction was further exam-ned by testing the effect of competition by the HSA

-173/-l49 sequence and an oiigonucieotide encoding

the SRE (Fig. 5). Neither of these sequences efficientlycompeted for the formation of the RXRa complex, mdi-cating that the HSA -273/-249:RXRa interaction wassequence specific and was only competed by definedTRE sites. We also observed that labeled PAL-0 and theMHC TRE had a much greaten affinity for RXRa than thea-actin TRE and displayed the ability to form oligomeniccomplexes with RXRa (data not shown). This series ofexperiments suggested that RXRct may modulate theinteraction of TRot to this sequence and that -273/-249is a target for direct cross-talk between two differenthormonal signals (T3 and 9-cis-RA) at the receptor level.Our preliminary experiments indicate that the trans-fected skeletal ot-actin promoter and the pCAT 273 con-structs were not responsive to RXRa alone4 in the pres-ence of l0� M ali-trans-RA [which has been reported toactivate RXRa (12)]; however, verification of these dataawaits synthesis of 9-cis-RA.

Retinoid X and Thyroid Hormone Receptors Form Het-erodimers That Differentially Interact with the a-Actinand a-MHC TREs. We then investigated the ability ofTRa:RXRa heterodimens to interact with the cs-actin TREin a sequence specific manner. Yu et a!. (9) have recently

demonstrated that RXR$ selectively enhances the bind-ing of TR to the a-MHC TRE; hence, we used this TRE asa hetenodimenization control in our studies. The thyroidhormone and retinoid X receptors were capable of bind-ing to the a-MHC and a-actin TREs. When TRot and RXRawere simultaneously incubated with the a-MHC TRE,binding was dramatically enhanced, with the formationof heterodimers and oligomers (Fig. 6). The hetenodimersand oligomens formed were specifically competed byself-competition. TRot and RXRa also formed heterodi-mers on the ct-actin TRE that were specifically competedby self-competition. However, increasing amounts ofRXRa inhibited the binding of TRot dimers to the cr-actinTRE (Fig. 6), in contrast to promoting TRot binding to thea-MHC TRE. Whether the in vitro situation is stoichio-metrically relevant to the physiological situation is un-clear, but we are currently examining the differentialexpression of TR and RXR mRNAs during myogenesis.

Nuclear Extracts from Differentiated Myogenic CellsForm a Complex with HSA -2731-249 That Is Specifi-cally Competed by the rGH, rMHC, Palindromic, andDired Repeat (DR-4) Synthetic TREs. EMSAs were usedto determine the nature of the nuclear factor from differ-entiated mouse myogenic C2C12 cells that interactedwith the ot-actin TRE. In the EMSA experiments, the HSA-273/-249, nCH TRE, and DR-4 probes were incubatedwith C2C12 nuclear extract. The complexes formed withthese three probes were similar and indicated that similarproteins were binding to these sequences in C2C1 2 cells(Fig. 7A). The PAL-U, DR-4, rCH, and cv-MHC TREs spe-cificaily competed for binding to the complex thatformed on the HSA -273/-249 sequences in C2C12cells (Fig. 7, B and C). In contrast, 10-, 20-, and 60-fold

M3 GGGCAACTGGGA�GGTCAGGAGGG

CCCGTTGACCCTTTCCAGT CCT C C C

M4 GGGCAACTGGGTCGCAGGAGGAGGG

CC CGTTGAC C CAGCGTCCTCCT C CC

M5 GGGCAACTGGGTCGGGTCTTTAGGG

CCC G TTGAC CCAGC CCAG�AT C C C

M6 GGGCAACTGGGTCGGGTCAGGTTTG

CCCGTTGACCCAGCCCAGTCCAAAC

HSA .273/.249

C)Probe:ReceptorCompetitor

Molar Excess

Thyroid Hormone Receptor

.273/.249 Ml M2 M3

C 10 20 60 10 20 60 cio 2060102060. . #{149}. . .

hi

M4 MS M6

C 10 20601020 60 C102060

b4’


A)WILD TYPE GGGCAACTGGGTCGGGTCAGGAGGG

( -27 3 1 -24 9) CCCGTTGACCCAGCCCAGTCCTCCC

B)Receptor: cTRa

Lanes 1. 2 3 4 5 6 7

�-

MUTANTS Ml TTTCAACTGGGTCGGGTCAGGAGGG

AAAGTTGACCCAGCCCAGTCCTCCC

M2 GGGCAACTTTTTCGGGTCAGGAGGG

CCCGTTGAA�AGCCCAGTCCTCCC

fig. 4. Mutational analyses ofthe human skeletal a-actin TRE.A, pictorial representation of thevarious site specific mutations inthe human skeletal a-actin TRE.The wild-type TRE sequence isdepicted; bold-face letters, themutations in the Ml, M2, M3,

M4, M5, and M6 TREs. B, inter-action of cTRa with the mutantbinding sites. Lane 1, -273/-249; Lane 2, mutant 1; Lane 3,mutant 2; Lane 4, mutant 3; Lane5, mutant 4; Lane 6, mutant 5;Lane 7, mutant 6. C, the core

receptor binding motifs in theskeletal a-actin TRE are impor-tant for TRa binding. The effectsof competition by a battery ofmutations in the a-actin TRE,designated Ml, M2, M3, M4,M5, and M6, on the complexformed between the probe HSA-273/-249 and TRa. The molar

excess of each DNA competitoris indicated. C, the control bind-ing reaction in the absence ofany unlabeled competitor.

molar excesses of DR-2, HSA -l73/-l49, and the SREdid not compete for the binding of this complex (Fig.70).

Discussion

T3 has been shown to cause rapid increases in ot-actinmRNA in cardiocyte cultures and in the hearts of normal,hypophysectomized, and hypothyroid rats (20, 21). Weshowed recently that the human skeletal ot-actin pro-moten is regulated by T3 and that the cis-acting sequencesbetween nucleotide positions -432 and -1 53 were re-quired for T3 TR mediated trans-activation of the humanskeletal a-actin gene (22). These experiments indicated

that T3 induced increases in a-actin mRNA in animalswere mediated by direct transcriptional mechanisms.

Transfection experiments and electrophoretic mobilityshift assays were used to map the TRE in the ot-actingene. This TRE is located between nucleotide positions-273 and -249 (5’ CCCCAACTCCCTCCCCTCAC-CACCC 3’) and is accommodated by the core receptorbinding motif, A/ GG I C A/c This TRE sequenceconferred a 4.39-fold induction to an enhancenless SV4Opromoter, after T3 treatment in a TR dependent manner.Curiously, two and three copies of the HSA -273/-249TRE conferred similar responses to T3; this phenomenonwas also observed with two and three copies of thenative rodent growth hormone TRE (-190/-164) after T3


Probe: HSA -273/-249

Receptor Retinoid X Receptor

Competitor GH TRE MHC TRE PAL-O -2731-249 -1731-149 SRE

MolarExcess do 20 6010 20 60 C102060 C 10 2060 10 20 60 102060a.. � - . . ... �

�‘ - .-#{248} -� �

Fig. 5. The skeletal a-actin TRE interacts with RxRa in a sequence specific fashion. The effect of competition (10-60-fold molar excesses) by the GH,

MHC, and PAL-U characterized TREs and various other nonspecific DNA sequences on the complex formed between the probe HSA -273/-249 and E.coli expressed and affinity purified hRXF�a. The molar excess of each DNA competitor is indicated. C. the control binding reaction in the absence of anyunlabeled competitor. SRE, serum response element.

treatment (26). This level of induction is similar to the3.5-5.8-fold inductions observed when vitamin D3, thy-roid hormone, and retinoic acid response elements werecloned 5’ of the thymidine kinase promoter linked toCAT (29). This level of mnducibility also correlated withthe ‘�‘4.5-fold, T3 dependent trans-activation of the trans-fected human skeletal ct-actin promoter in the presenceof either c-erbA-a or c-erbA-f3 (22). Furthermore, thetransfected cardiac specific sarcoplasmic reticulum Ca2�ATPase promoter showed a similar level of inducibility(4.5-5.4-fold) in primary cardiocytes after T3 treatment(30).

EMSA experiments showed that E. co/i expressed andaffinity purified TRcs formed monomers and dimers onthe skeletal cr-actin TRE in a similar fashion to the wellcharacterized cr-MHC TRE. Mutagenesis of the ct-actinTRE indicated that only the flanks of the half-site motifsand the gap sequence were required for efficient bindingto TRot. Furthermore, the ability of the HSA -273/-249sequences to function in vivo and confer hormonal reg-ulation to a heterologous promoter correlates with thecooperative dimenic interaction of purified TRot withthese sequences in vitro. In vitro complex formation ofTRcs dimers on TRE sequences has been shown to cor-relate with the in vivo hormonal regulatory function ofthe GH, MHC, and malic enzyme TRE elements (23, 25-27).

The cs-actin TRE interacted with a nuclear factor(s)from myogenic nuclear extracts that was specificallycompeted by the characterized (PA[-0) TRE, the syn-thetic direct repeat TRE (DR-4), and MHC and GH TREsbut not by any other DNA element. Furthermore, these

sequences interacted with an identical nuclear factor(s)in vitro in muscle cells. These binding and competitionexperiments correlated well with the interaction of thea-actin TRE with purified TRot in vitro. This TRE site mapsto a promoter region that interacts with SpI (22) at posi-tions -297/-273, serum response factor (31) at positions-225/-2 1 6, and NF-l/CTF (CCAAT binding transcriptionfactor) at -210/-179 (22), suggesting that TRot may in-teract with these ubiquitous factors.

The retinoid X receptor has recently been shown toform regulatory heterodimers with the vitamin D, thyroidhormone, and retinoic acid receptors which modulatethe affinity of these receptors to their cognate DNAelements and their transcriptional function (8, 9, 12, 13).When TRcr and RXRa were simultaneously incubatedwith the a-MHC TRE, binding of TRot was dramaticallyenhanced, with the formation of heterodimers and oh-gomers. In contrast, although TRot and RXRr formedheterodimers on the ot-actin TRE, increasing amounts ofRXRa inhibited the binding of TRot dimers to the cs-actinTRE. The data suggest that, under these conditions, RXRaand TRa were forming heterodimers in solution (12) andreducing the affinity of TRot for the HSA -273/-249

sequences. This series of experiments suggested thatRXRa may modulate the interaction of TRot to this se-quence and that -273/-249 in the human skeletal a-actin gene is a target for direct cross-talk between twodifferent hormonal signals (T3 and 9-cis-RA) at the recep-ton level (15, 16). In support of our suggestions, it hasbeen shown recently that TRot and RXRa binding in vitrocorrelated with the function of the receptors in vivo (24).To our knowledge, this is the first demonstration of

I,.’


a-MHC TRE a-Actin ThE

pMoI TRotpMol RXRaCompetitor

Oligomer *�

HeterodimerHomodlmer

43 - - - 4.5 4.5 4.5 4.5 4.5 4.5 4.5 4.5

- 0.5 13 4.5 - 0.5 15 4.5 030.5030.5

+ ++ +++

4.5- - - 434.5434.5434.5434.5

- 0.5 1.5 4.5 - 0.5 13 43 03 03 03 0.5+ ++ +++

i�Hetero�*Homo

Fig. 6. The thyroid hormone and retinoid x receptors form heterodimeric complexes on the a-actin and the a-MHC TREs. E. col, expressed and affinitypurified cTRa and hRXRa were incubated with the a-actin and a-MHC TREs.

homodimenic and heterodimenic binding of TRot andRXRcr to a TRE in a gene expressed primarily in skeletalmuscle. In addition, the mRNA levels of this gene areincreased and pathophysioiogicaiiy regulated in cardiactissue.

RA has been shown to induce a-MHC in cardiacmyocytes, although supraphysiological levels have beenrequired (nM) (30). Our EMSA results on the enhancedbinding of TRot to the a-MHC IRE in the presence ofRXRa suggest that the supraphysiological levels of reti-noic acid in these studies may have been cross-activatingthe 9-cis-retinoic acid-RXR pathway.

The retinoid regulation of skeletal myogenesis is anunexplored area; however, the implication that this hor-monal pathway is involved in the transcriptional negula-tion of myogenic differentiation has a biomedical prec-edent. Vitamin A deficiency and toxicity result in embry-ological effects such as cardiovascular malformation andphenotypic modifications of limb muscles, respectively.Etnetinate and isotnetinoin, derivatives and analogues ofvitamin A, have proved effective in controlling a widevariety of dermatoses. However, muscle pain, stiffness,and muscle and myoneunal damage similar to Becker-type muscular dystrophy are common side effects; thebasis for these muscular symptoms has not been eluci-dated, and we are currently studying the molecular basisof these side effects (32-34).

in conclusion, we have characterized the human skel-etal a-actin gene TRE by demonstrating its ability to bindthe appropriate purified TRa and RXRa receptors in asequence specific fashion with high affinity and to conferappropriate T3 regulation to a heterologous promoter.This TRE mapped to a region that we had previouslyshown to be essential for the T3 response in vivo.

Materials and Methods

Cell Culture and Transfection. Mouse myogenic C2 cells(35, 36) were grown in DMEM supplemented with 20%FCS in 10% CO2 as described previously (31). This cellline was induced to biochemically and morphologicahlydifferentiate into muitinucieate myotubes by mitogenwithdrawal (DMEM supplemented with 2% FCS in 10%

CO2). Differentiation was essentially complete within 72-96 h with respect to isoform switching in the actin mui-

tigene family (22). However, these cells will sponta-neously differentiate at a very high confluence (100%) inthe presence of mitogens. COS-1 cells were grown inDMEM supplemented with 10% FCS in l0% CO2.

Each 60-mm dish of cells was transiently transfectedwith 10 �tg of reporter plasmid DNA expressing CAT,mixed with an additional amount of the TR expressionvectors or pUCl8 DNA. The total amount of DNA in

each transfection experiment (1 1 �zg) was kept constantby the addition of pUCl 8 DNA. Prior to transfection, thecells were cultured for 24 h in T3 and T4 deficient mediumcontaining 5% charcoal stripped FCS in DMEM. The DNAmixtures were cotransfected into C2 myobiasts and COS-1 fibroblasts by the hiposome mediated procedure. We

used the cationic lipid DOTAP. Unilamehlar vesicles wereformed by mixing the appropriate DNAs with 30-40 zi

of DOTAP and lx HEPES buffered saline to a totalvolume of 200 zi. After a 10-mm incubation at room

temperature, this mixture was added to 6 ml of freshculture (T3 and T4 deficient) medium and added to thecells, which were 50-70% confluent. After a period of20-24 h, fresh medium with or without T3 (10 nM) wasadded to the cells. The cells were harvested for the assayof CAT enzyme activity 60-72 h after the transfection

Extract : Ntyogenie C2C12

�Probe: �

B)Probe:Extraict

Competitor . 273/.249 PAL.O DR.4

MolarExces.s C 10 20 40 60 10 20 40 60 10 20 40 60 C

�.

.�. ..

A)

C)Probe:

Extract

Competitor . 273/.249 �;H TRE

MolarExces.s:C 10 20 40 60 10 20 40 60

�

�“. - #{163}� � M. �

HSA -273/.249

Myogenic C2Cl2

D)

Probe:

Extract

rMHC TRE Competitor:

10 20 40 60 C MolarExcess:C 10 20 60 10 20 60 10 20 60 10 20 60 C

. - �. - � � .� - -

‘:=N �IIuu.� �‘ I ‘ I


Fig. 7. The HSA -273/-249 Se-

quences interact with factor(s) innuclear extracts derived from

C2C12 cells. A, interaction of-273/-249, rGH TRE, and DR-4with myogenic C2C12 nuclear

extract. B, the effect of compe-tition (10-60-fold molar ex-cesses(, by the PAL-0 and DR-4characterized TREs on the com-

plex formed between the probeHSA -273/-249 and myogenic

factors. The molar excess of each

DNA competitor is indicated. C,the control binding reaction in

the absence of any unlabeled

competitor. C, the effect of cam-petition (10-60-fold molar ex-cesses(, by the GH and MHC

characterized TREs on the cam-plex formed between the probeHSA -273/-249 and myogenic

factors. The molar excess of eachDNA competitor is indicated. C,

the control binding reaction inthe absence of any unlabeled

competitor. 0, the effect of cam-petition (10-60-fold molar ex-cesses), by the DR-2, -273/-249, -1 73/-149, and SRE DNAsequences on the complex

formed between the probe HSA

-273/-249 and myogenic fac-tors. The molar excess of eachDNA competitor is indicated. C,

the control binding reaction inthe absence of any unlabeledcompetitor. SRE, serum responseelement.

HSA .273/.249

Myogenic C2C12

HSA -2731.249

Myogenic C2C12

DR.2 .2731.249 .173/.149 SRE

period. Each transfection experiment was performed

three times using at least two different plasmid prepara-

tions in order to overcome the variability inherent intra nsfections.

CAT Assays. The cells were harvested, and the CATactivity was measured as previously described (31). Au-

quots of the cell extracts were incubated at 37#{176}Cwith

0.1-0.4 �Ci of {4C]chloramphenicol (Amersham) in thepresence of 5 mM acetyl CoA and 0.25 M Tnis-HCI, pH

7.8. After a 2-4-h incubation period, the reaction wasstopped by the addition of 1 ml ethyl acetate, which was

used to extract the chloramphenicol and its acetylated

forms. The extracted materials were analyzed on silica

gel thin layer chromatography plates as described previ-

ously (3 1 ). Quantitation of CAT assays was performed by

scintillation counting of the chromatograms.

Plasmids. The plasmid pCAT-promoter (an enhancer-less SV4O promoter linked to CAT in a pUC19 backbone)was purchased from Promega. The plasmids expressingthe rodent c-erbA-cr genes in the eukaryotic expression

vector CMV 4, containing the cytomegalovirus promoter

and SV4O origin of replication, were described by Ziiz et

a!. (37). The piasmid pHSA432CAT was described byMuscat et a!. (38). We constructed pGEX-1-cTRa byexcising the chicken TRot complementary DNA from the

pSG5 expression vector by EcoRl digestion. This comple-

mentary DNA insert was then cloned in frame into EcoRlcleaved pGEX-1.

Oligonucleotides. The sequences of the oiigonucleo-tide probes used in the EMSA experiments are describedin the legend to Fig. 1. The sense and antisense strandsof the HSA -273/-249 and HSA -173/-149 sequences


with gate ends were annealed, phosphonylated with T4polynucleotide kinase, and self-ligated with T4 DNA ii-gase. These products were then cloned into the Bg!ll sitein the pCAT-pnomoter vector from Promega and initiallyscreened by EcoRi digestion. Clones containing putativeinserts were sequenced by double stranded sequencingto determine the orientation and number of copiescloned. The orientation and copy number of the oligo-nucleotides cloned into the pCAT vector are pictoriallyrepresented in Fig. 1.

Expression and Purification of Receptors. HumanRXRa and chicken TRa were expressed as fusions withglutathione-S-transferase using the pGEX-2T and pGEX-1 bacterial expression vectors. BL21(DE3)pLysS cells orDH5a cells containing these expression vectors wereinduced for 1-2 h with 0.4 mi�i isopropyl thiogalactosideafter the cells had grown to an OD� of � Pelietedcells were lysed; the clarified lysates containing the fusionproteins were loaded onto glutathione-agarose columnsin Dignam buffer C (containing 0.5 mt�vi PMSF and 2 �zg/ml of leupeptin and aprotinin). After extensive columnwashing, the fusion protein was eluted with Dignambuffer C containing 5 m� reduced giutathione.

Nuclear Extrads and Gel Mobility Shift Assays. Nu-clear extracts were prepared by the method of Schneiberet al. [1989] (39). The cells were lyzed using 10% NonidetP-40 following incubation in 10 mtvi HEPES (pH 7.9), 10mM KC1, 0.1 mM EDTA, 0.1 m#�i EGTA, 1 mt�i dithiothrei-tol, 0.5 mM PMSF, and 2 zg/mI of leupeptin and aprotinin(Boehringer Mannheim). Nuclear proteins were extractedwith 0.4 M NaCI, 20 mis�i HEPES (pH 7.9), 1 mt�’i EDTA, 1mM EGTA, 1 mM dithiothreitol, 1 mt�i PMSF, and 2 zg/mlaprotinin and leupeptin.

Each binding mixture (25 zi) contained 1-2 ng of a T4polynucleotide kinase labeled DNA fragment, 5-10 �g ofprotein, 6 ;ag of bovine serum albumin, and 3-5 �zg ofpolydeoxyinosinic-deoxycytidylic acid as a nonspecificcompetitor in Dignam buffer C (40). The assays wereincubated at room temperature for 20 mm and electro-phoresed through a 6% (20:1 polyacnylamide:-bisacrylamide) gel in 80 mrs’i Tnis borate and 2 mtvi EDTA.Gels were briefly soaked in 10% acetic acid, dried, andautoradiographed.

Acknowledgments

We sincerely thank Dr. Howard Towle for generously providing the ratc-erbA-a in the CMV 4 expression vector, Dr. Bjorn Vennstr#{246}m for thechicken c-erbA-a in the pSG5 expression vector, and Dr. Ron Evans forthe plasmid pGEx-2T-hRxRa, which expresses the retinoid x receptor inE. coli.

References

1 . Glass, C. K., and Holloway, J. M. Regulation of gene expression bythe thyroid hormone receptor. Biochim. Biophys. Acta, 1032: 157-176,1990.

2. Forman, B. M., and Samuels, H. H. Interactions among a subfamily of

nuclear hormone receptors: the regulatory zipper model. Mol. Endocri-

nol.,4: 1293-1301, 1990.

3. Glass, C. K., and Rosenfeld, M. G. Regulation of gene expression by

thyroid hormones and retinoic acid. In: P. Cohen and J. G. Foulkes (eds.),the Hormonal Regulation of Gene Transcription. New York: Elsevier

Science, 1991.

4. Naar, A. M., Boutin, J-M., Lipkin, S. M., Vu, V. C., Holloway, J. M.,

Glass, C. K., and Rosenfeld, M. G. The orientation and spacing of coreDNA binding motifs dictate selective transcriptional responses to threenuclear receptors. Cell, 65: 1267-1279, 1991.

5. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M.

Direct repeats as selective elements for the thyroid hormone, retinoic

acid and vitamin D3 receptors. Cell, 65: 1255-1266, 1991.

6. Norman, M. F., Lavin, T. N., Baxter, J. D., and West, B. L. The rat

growth hormone gene contains multiple thyroid response elements. j.

Biol. Chem., 264: 12063-12073, 1989.

7, Lavin, T. N., Baxter, J. D., and Horita, S. The thyroid hormone receptorbinds to multiple domains of the rat growth 5’ flanking sequence. j. Biol.

Chem., 263: 9418-9426, 1988.

8. Leid, M., Kastner, P., Lyons, R., Nakshartri, H., Saunders, M., zachar-

ewski, T., Chen, j-Y., Staub, A., Gamier, J-M., Mader, S., and Chambon,

P. Purification, cloning, and RXR identity of the HeLa cell factor with

which RAR or TR heterodimerizes to bind target sequences efficiently.

Cell, 68: 377-395, 1992.

9. Vu, V. C., Delsert, C., Anderson, B., Holloway, j. M., Devary, 0. V.,

Naar, A. M., Kim, S. V., Boutin, j. M., Glass, C. K., and Rosenfeld, M. G.

RxR�: a coregulator that enhances binding of retinoic acid, thyroid

hormone, and vitamin D receptors to their cognate elements. Cell, 67:

1251-1266, 1991.

10. Mangelsdorf, D. J., Ong, E. S., Dyck, J. A., and Evans, R. M. Nuclear

receptor that identifies a novel retinoic acid response pathway. Nature

(Lond.), 345: 224-229, 1990.

1 1 . Mangelsdorf, D. J., Umesono, K., Kliewer, S. A., Borgmeyer, U., Ong,

E. S., and Evans, R. M. A direct repeat in cellular retinol-binding proteintype II gene confers differential regulation by RXR and RAR. Cell, 66:

555-561, 1991.

12. Zhang, X., Hoffmann, B., Tran, P. B-V., Graupner, G., and Pfahl, M.

Retinoid X receptor is an auxiliary protein for thyroid hormone and

retinoic acid receptors. Nature (Lond.), 355: 441-446, 1992.

13. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M.

Retinoid X receptor reacts with nuclear receptors in retinoic acid, thyroid

hormone and vitamin D3 signalling. Nature (Lond.), 355: 446-449, 1992.

14. Mangelsdorf, D. J., Borgmeyer, U., Heyman, R. A., Yang zhou, J.,

Ong, E. S., Oro, A. E., Kakizuka, A., and Evans, R. M. Characterization ofthe three RXR genes that mediate the action of 9-cis retinoic acid. Genes& Dev., 6: 329-344, 1992.

15. Levin, A. A., Sturzenbecker, L. J., Kazmer, S., Bosakowski, T., Husel-

ton, C., Rosenburger, M., Lovey, A., and Grippo, J. F. 9-Cis retinoic acid

stereoisomer binds and activates the nuclear receptor RxRa. Nature

(Lond.), 355: 359-361, 1992.

16. Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., Stein, R. B., Eichele,

G., Evans, R. M., and Thaller, C. 9-Cis retinoic acid is a high affinity ligand

for the retinoid x receptor. Cell, 68: 397-406, 1992.1 7. Swynghedauw, B. Developmental and functional adaptation of con-

tractile proteins in cardiac and skeletal muscle. Physiol. Rev., 66: 710-

771, 1986.

18. Lompre, A. M., Mercadier, I. J., and Schwartz, K. Changes in gene

expression during cardiac growth. Int. Rev. Cytol., 124: 137-186, 1991.

19. Russel, S. D., Cambon, N., Nadal-Ginard, B., and Whalen, R. G.

Thyroid hormone induces a nerve independent precocious expression of

fast myosin heavy chain mRNA in rat hindlimb skeletal muscle. J. Biol.

Chem., 263: 6370-6374, 1988.

20. Schwartz, K., Dela Bastie, D., Bouvaret, P., Olieviero, P., Alonso, S.,

and Buckingham, M. a-Skeletal actin mRNAs accumulate in hypertro-

phied adult rat hearts. Circ. Res., 59: 551-556, 1986.

21. Winegrad, S., Wisnewsky, C., and Schwartz, K. Effect of thyroid

hormone on the accumulation of mRNA for skeletal and cardiac actin in

hearts from normal and hypophysectomised rats. Proc. NatI. Acad. Sci.

USA, 87: 2456-2460, 1990.

22. Collie, E. S. R., and Muscat, G. E. 0. The human skeletal a-actin

promoter is regulated by thyroid hormone: identification of a thyroid

hormone response element. Cell Growth & Differ., 3: 31-45, 1992.

23. Brent, G. A., Williams, G. R., Harney, J. W., Forman, B. M., Samuels,

H. H., Moore, D. D., and Larsen, P. R. Capacity for co-operative binding

of the thyroid hormone receptor dimers defines wild type T3 response

elements. Mol. Endocrinol., 6: 502-514, 1992.


24. Hermann, T., Hoffmann, B., zhang, x-K., Tran, P., and Pfahl, M.

Heterodimeric receptor complexes determine 3,5,3’-triiodothyronine

and retinoid signallingspecificities. Mol. Endocrinol., 6: 1153-1162, 1992.

25. Brent, G. A., Larsen, P. R., Harney, J. W., Koenig, R. J., and Moore,D. D. Functional characterization of the rat growth hormone promoter

elements required for induction by thyroid hormone with and without a

co-transfected b type thyroid hormone receptor. J. Biol. Chem., 264:

178-182, 1989.

26. Brent, G. A., Williams, G. R., Harney, J. W., Forman, B. M., Samuels,H. H., Moore, D. D., and Larsen, P. R. Effects of varying the position of

the thyroid hormone response elements within the rat growth hormonepromoter: implications for positive and negative regulation by triiodothy-

ronine. Mol. Endocrinol., 5: 542-548, 1991.

27. Williams, G. R., Harney, J. W., Forman, B. M., Samuels, H. H., andBrent, G. A. Oligomeric binding of T3 receptor is required for maximal

T3 response. J. Biol. Chem., 266: 19636-19644, 1991.

28. Forman, B. M., and Samuels, H. H. pEXPRESS: a family of expressionvectors containing a single transcription unit active in prokaryotes and in

eukaryotes. Gene (Amst.), 105: 9-15, 1991.

29. Cooney, A. J., Tsai, S., O’Malley, B. W., and Tsai, M-J. Chicken

ovalbumin upstream promoter transcription factor (COUP-TF) dimersbind to different GGTCA response elements, allowing COUP-TF to re-

press hormonal induction of the vitamin D3, thyroid hormone andretinoic acid receptors. Mol. Cell. Biol., 12: 4153-4163, 1992.

30. Rohrer, D. K., Hartong, R., and Dillman, W. H. Influence of thyroid

hormone and retinoic acid on slow sarcoplasmic calcium ATPase and

myosin heavy chain a-gene expression in cardiac myocytes. J. Biol.

Chem., 266: 8638-8646, 1991.

31 . Muscat, G. E. 0., Gustafson, T. A., and Kedes, L. A common factor

regulates skeletal and cardiac a-actin transcription in muscle. Mol. Cell.

Biol., 8: 4120-4133, 1988.

32. Hodak, E., Gadoth, N., David, M., and Sandbank, M. Muscle damage

induced by isotretinoin. Br. Med. J., 293: 425-427, 1988.

33. Albin, R., Silverman, A. K., Ellis, C. N., Voorhees, J. J., and Albers, J.A new syndrome of axial muscle rigidity associated with etretinate ther-

apy. Movement Disorders, 3: 70-76, 1988.

34. Hodak, E., Gadoth, N., David, M., and Sandbank, M. Etretinate

induced skeletal muscle damage. Br. J. Dermatol., 1 16: 623-627, 1987.

35. Yaffe, D., and Saxel, 0. Serial passaging and differentiation of my-

ogenic cells isolated from dystrophic mouse muscle. Nature (Lond.), 270:

725-727, 1977.

36. Yaffe, D., and Saxel, 0. A myogenic cell line with altered serumrequirements for differentiation. Differentiation, 7: 159-166, 1977.

37. zilz, N. D., Murray, M. B., and Towle, H. Identification of multiplethyroid hormone response elements located far upstream from the rat

514 promoter. J. Biol. Chem., 265: 8136-8143, 1990.

38. Muscat, G. E. 0., and Kedes, L. Multiple 5’ flanking regions of thehuman a-skeletal actin gene synergistically modulate muscle specific gene

expression. Mol. Cell. Biol., 7: 4089-4099, 1987.

39. Schreiber, E., Mathias, P., Muller, M., and Schaffner, W. Rapid

detection of octamer binding proteins with mini nuclear extracts, pre-

pared from a small number of cells. Nucleic Acids Res., 17: 6419, 1989.

40. Dignam, J. D., Lebovitz, R. M., and Roeder, R. Accurate transcriptioninitiation by RNA polymerase II in a soluble extract from isolated mam-

malian nuclei. Nucleic Acids Res., 1 1: 1475-1489, 1983.

41. Denner, L. A., Weigel, N. 1., Maxwell, B. 1., Schrader, W. T., andO’MaIley, B. W. Regulation of progesterone receptor-mediated transcrip-

tion by phosphorylation. Science (Washington DC), 250: 1740-1743,1990.

42. Power, R. F., Lydon, J. P., Conneely, 0. M., and O’Malley, B. W.Dopamine activation of an orphan of the steroid receptor superfamily.Science (Washington DC), 252: 1 546-1 548, 1991.

43. Goldberg, V., Gliner, C., Gesqui#{232}re,J-C., Ricouart, A., Sap, J., Ven-nstr#{244}m,B., and Ghysdael, J. Activation of protein kinase C or cAMP-

dependent protein kinase increases phosphorylation of the c-erbA-en-coded thyroid hormone receptor and of the v-erbA-encoded protein.

EMBO)., 7:2425-2433, 1988.

44. Wiegel, N. L., Carter, T. H., Schrader, W. T., and O’MaIIey, B. W.

Chicken progesterone receptor is phosphorylated by a DNA-dependentprotein kinase during in vitro transcription assays. Mol. Endocrinol., 6: 8-14, 1992.

45. Beck, C. A., Wiegel, N. L., and Edwards, D. P. Effects of hormoneand cellular modulators of protein phosphorylation on transcriptionalactivity, DNA binding, and phosphorylation of human progesterone re-

ceptors. Mol. Endocrinol., 6: 607-620, 1992.

46. Kliewer, 5. A., Umesono, K., Heyman, R. A., Mangelsdorf, D. J.,Dyck, J., and Evans, R. Retinoid x receptor-COUP-TF interactions mod-ulate retinoic acid signalling. Proc. NatI. Acad. Sci. USA, 89: 1448-1452,1992.

47. Durand, B., Saunders, M., Leroy, P., Leid, M., and Chambon, P. All-trans- and 9-cis-retinoic acid induction of CRABP II transcription is me-diated by RAR-RXR heterodimers bound to DR-i and DR-2 repeatedmotifs. Cell, 71: 73-85, 1992.

Characterization oftheThyroid Hormone Response Element...

Documents

Transcript of Characterization oftheThyroid Hormone Response Element...