a 1759 (2006) 443–450www.elsevier.com/locate/bbaexp

Biochimica et Biophysica Act

Characterization of the rabbit HKα2 gene promoter

Deborah L. Zies a , 1 , Michelle L. Gumz a, b, Charles S. Wingo b, Brian D. Cain a ,⁎

a Department of Biochemistry, University of Florida College of Medicine, 1600 SW Archer Road, Gainesville, FL 32610, USAb Department of Veterans Affairs Medical Center, Gainesville, FL 32610, USA

Received 3 May 2006; received in revised form 4 August 2006; accepted 30 August 2006Available online 12 September 2006

Abstract

The HKα2 gene directs synthesis of the HKα2 subunit of the H+, K+-ATPase. In the kidney and colon, the gene is highly expressed and isthought to play a role in potassium (K+) conservation. The rabbit has been an important experimental system for physiological studies of iontransport in the kidney, so the rabbit HKα2 gene has been cloned and characterized. The genomic clones and the previously reported HKα2a andHKα2c subunit cDNAs provided a means to address several issues regarding the structure and expression of the HKα2 gene. First, the genomicorganization established that the rabbit HKα2 gene was unambiguously homologous to the mouse HKα2 gene and the human ATP1AL1 gene.Second, the mapping of the transcription start site for the alternate transcript, HKα2c, confirmed that it was an authentic rabbit transcript. Finally,isolation of DNA from the 5′ end of the HKα2 gene enabled us to initiate studies on its regulation in the rabbit cortical collecting duct. Thepromoter and two putative negative regulatory regions were identified and the effect of cell confluency on gene expression was studied.© 2006 Elsevier B.V. All rights reserved.

Keywords: HKα2; H+; K+-ATPase; Kidney; Collecting duct; Potassium; Confluency

1. Introduction

Despite daily fluctuations in dietary K+ intake, mammalsmaintain blood K+ levels in the range of 3.5–5.5 mE/L. H+,K+-ATPases are among the pumps expressed along the collectingduct of the kidney that play a role in K+ conservation inhypokalemic individuals [1]. Indeed, a H+,K+-ATPase-defi-cient patient presented with severe hypokalemia [2]. H+,K+-ATPases have either a gastric (HKα1) subunit or a colonic(HKα2) subunit. Both types of α subunits are expressed in thecollecting duct. Evidence from several sources suggested thatHKα2, and not HKα1, was upregulated in the kidney whenblood K+ concentration decreases [3–6]. Furthermore, in wildtypemice fed a K+ deficient diet, HKα2mRNAwas upregulatedin the collecting duct [7]. WhenHKα2 knockout mice were fed aK+ deficient diet, the mice developed severe hypokalemia withmuch of the K+ loss occurring in the colon. The HKα2 H+,K+-

⁎ Corresponding author. Tel.: +1 352 392 6473.E-mail address: bcain@biochem.med.ufl.edu (B.D. Cain).

1 Present Address: University of Mary Washington, Fredericksburg, VA22401, USA.

0167-4781/$ - see front matter © 2006 Elsevier B.V. All rights reserved.doi:10.1016/j.bbaexp.2006.08.007

ATPase has also been linked to bicarbonate absorption [8],ammonium secretion [9] and chronic adaptation to changes insodium [10] and aldosterone [11]. In aggregate, the evidencefavors an important role for the HKα2 containing pump in K+

conservation.Genomic clones for the human (ATP1AL1) [12] and mouse

[13] HKα2 genes, and the cDNAs encoding the human [14], rat[15], mouse [16], guinea pig [17], and rabbit [18,19] HKα2subunits have been previously reported. Analysis of the cDNAsequences left some doubt about whether these proteins shouldbe considered homologous, and indeed, what subunits wereexpressed in tissues of variousmammalian species. Although thededuced amino acid identity of the HKα2 subunits was lower(87%) than the identity of the HKα1 proteins (97%), distanceanalysis of the HKα1, HKα2, and NaKα subunits from severalspecies showed that the HKα2 proteins were more closelyrelated to each other than to HKα1, or any of the NaKα subunits[20]. The cDNAs cloned from rabbit and rat suggested that theHKα2 gene produced alternative transcripts that differed fromthe widely accepted HKα2a sequence only at the 5′ end. ThesemRNAs therefore encoded alternative HKα2 subunit proteinswith distinct amino termini (HKα2b and HKα2c) [13,18].

444 D.L. Zies et al. / Biochimica et Biophysica Acta 1759 (2006) 443–450

Alternative transcripts of this sort have not been reported in othermammals. A controversy over the rabbit alternative transcript(HKα2c) arose when two laboratories cloned the HKα2 cDNAswith differing results. Both laboratories used 5′ rapid amplifi-cation of cDNA ends (5′RACE) to clone the 5′ end of the HKα2transcript. Fejes-Toth et al. [19] obtained only a cDNA for theknown colonic HKα2a cDNA, but Campbell et al. [18]identified two cDNAs with distinct 5′ ends yielding theHKα2a and HKα2c subunits. The latter appeared to be aproduct of differential splicing near the 5′ end of the HKα2 genetranscript. The HKα2c protein was therefore identical to theHKα2a protein in all but the extreme amino terminus. TheHKα2c translation begins at an AUG codon encoded withinintron 1 of the HKα2a sequence producing a protein that lacksthe first 2 amino acids of HKα2a, but contains an additional 63unique amino acids (Fig. 1C). Inspection of intron 1 of thehuman genomic sequence did not reveal an HKα2c-like openreading frame. In view of the absence of the alternative HKα2csubunit mRNA in other mammalian species and one groupidentifying only the HKα2a transcript in the rabbit, it remainedcontroversial as to whether HKα2c was in fact an authenticrabbit transcript.

Although there was abundant in vivo data suggesting a rolefor the HKα2 form of the H+,K+-ATPase in K+ conservation,little is known about the molecular mechanisms involved inregulating transcription from the HKα2 gene. Zhang et al. [16]cloned a 7.2 kbp fragment of DNA upstream of the mouseHKα2transcription start site and performed a promoter deletionanalysis. In two mouse medullary collecting duct cells lines(mIMCD3 and mOMCD3) high levels of reporter geneexpression were observed. The activity was not significantlyaltered after deleting all but 177 bp upstream of the transcriptionstart site, and no regulatory elements were identified outside ofthis minimal core promoter. Recently, these investigatorsidentified a functional cyclic AMP response element (CRE)within the 177 bp promoter.

Fig. 1. Organization of the rabbit HKα2 gene. (Panel A) Phage lambda clones and Plocations of exons are drawn to scale. (Panel B) Intron–exon structure of the rabbit Hbelow). (Panel C) Splicing of exon 1 to exon 2 yields the HKα2a mRNA, and tranpositions of the HKα2a and HKα2c probes for the RNase protection assay.

In this report, we address several lingering issues withrespect to the structure and expression of the rabbit HKα2 gene.Rabbit HKα2 genomic clones have been obtained to show thatthe gene structure is comparable to the human and mouse genesthat apparently produce only single transcripts. The transcrip-tion start sites for the HKα2 gene were mapped at single baseresolution to demonstrate that it does indeed produce twotranscripts encoding the HKα2a and HKα2c subunits. Addi-tionally, studies on the regulation of the HKα2 gene wereinitiated. A series of promoter deletion and mutation experi-ments were performed to consider regulation of the genebeyond the minimal promoter. RT-PCR and QPCR experimentstested the effect of tissue culture cell confluency on HKα2 geneexpression.

2. Experimental procedures

2.1. Cloning the rabbit HKα2 gene

A rabbit genomic bacteriophage λ library (Clontech) was plated onEscherichia coli and plaques were lifted onto hybridization membranes.Three HKα2a (accession #AF023128) cDNA probes (bp 16–93, 1264–1569,and 3265–4073) were radio-labeled by random priming and used to screenthe membranes. Positive plaques were purified and λ DNA was isolatedusing the Qiagen large-scale λ DNA isolation kit. Sections of the gene notrepresented in the λ clones were obtained by PCR using rabbit genomicDNA as template. Nucleotide sequences were determined in the core facilityat the University of Florida.

2.2. RNase protection assay

Transcription start sites for HKα2a and HKα2c were mapped by RNaseprotection using the RPAIII kit from Ambion. The probes for HKα2a andHKα2c mRNAs consisted of a 726 bp EcoRI/SacII fragment and a 121 bpXmnI/ApaI fragment from pDZ10, respectively. The RNase protection assay wascarried out using total RNA from the rabbit colon. The protected fragments wererun on a 6% polyacrylamide gel along side a reference DNA (BacteriophageM13). The gel was dried for 2 h and exposed to autoradiograph film at −80 °Covernight.

CR products used to determine the gene structure are indicated by the bars, andKα2 gene. The arrows show the transcription start sites as mapped in Fig. 2 (seescription initiation within intron 1 results in the HKα2c mRNA. Stars indicate

445D.L. Zies et al. / Biochimica et Biophysica Acta 1759 (2006) 443–450

2.3. Promoter deletion and mutation constructs

A 5.5 kbp XhoI/SacII fragment of λHKα2.1 DNA was cloned into thepGL3-basic vector (Promega) to make the longest reporter gene construct(pDZ10) extending to position −5394 upstream of the HKα2a transcription startsite. Existing restriction sites and MluI sites made by site directed mutagenesis(Quikchange kit, Stratagene) were used to create deletions of pDZ10.Quikchange mutagenesis was also used to create mutations at the TATA-likeelement upstream of the HKα2a transcription start site. Primer DZ86 (5′GCGGGGCGCGCAGCGATCGAGGCGGACACCACC) and its comple-ment, DZ87, were used to destroy the element. Primer DZ57 (5′GCGGGG-CGCGCATATAAAAGGCGGACACCACC3′) and its complement, DZ58,were used to create a consensus TATA box.

2.4. Transfection and luciferase assays

RCCT28A cells were grown in 24 well tissue culture dishes (Corning) inDMEM-F12 plus 10% FBS to 70% confluency. 250 pMol of the promoterconstruct was mixed with non-specific DNA (to 1 μg) and with 0.2 μg of pRLcontrol plasmidDNA. Transfections were carried out using 40 μl of the Superfectreagent (Qiagen). Cell lysis and the reporter gene assays were conductedaccording to the Dual Luciferase Reporter Gene Protocol (Promega). Luciferasedata was normalized to the Renilla transfection control and the relative light unitsfor the promoter construct with the highest reporter gene activity were set to one.

2.5. RNA isolation and Reverse Transcriptase-PolymeraseChain Reaction (RT-PCR)

RNA was isolated from 60 mm dishes containing RCCT28A cells usingthe Trizol method (Invitrogen). Reverse transcriptase PCR (RT-PCR) wascarried out with PCR Mastermix (Qiagen). The reactions were primed witholigonucleotides BC230 (5′CCGACACGAGTGAAGACAAT3) and BC231 (5′GCTTGTCATTGGGATCTTCC). This primer set amplified a 305 base pairband from the common region of the HKα2 mRNAs (HKα2a 1264–1569).The PCR products were analyzed on a 1% agarose gel with ethidium bromidestaining.

2.6. RNA isolation and Quantitative Real-time Polymerase ChainReaction (QPCR)

RNAwas isolated from 30 mm dishes that were either pre- or 30 days post-confluent using the RNAqueous RNA isolation protocol (Ambion, Inc.). TotalRNA (1 μg) was converted to cDNA using cDNA archive kit (AppliedBiosystems). QPCR was performed using Taq-man universal PCR master mix(AppliedBiosystems). The reactions were carried out in anABI 7900HTsequencedetection system with cycle parameters as follows: 50 °C for 2 min, 95 °C for10 min, 45 cycles of 95 °C for 15 sec and 60 °C for 1 min. The Assay by Designreagents (Applied Biosystems) were created to amplify a portion of the commonregion of the HKα2a and HKα2c transcripts. The forward primer wasCCCCTGGAAACAAAGAACATCACTT, the reverse primer was CGGTCAC-CCGTGTTGATGA, and the probe was FAM TTGCCGTGCCTTCCAG. Assayon Demand reagents for 18S were used as an internal standard. Samples werescored as either positive if a Ct value was obtained within 45 cycles or negative ifthe sample remained undetermined after 45 cycles.

3. Results

3.1. Rabbit HKα2 gene structure

In order to obtain λ clones that contained the HKα2 gene, arabbit genomic library was screened using probes cor-responding to the 5′ end, the middle, and the 3′ end of theHKα2a cDNA. Four λ clones hybridized to the 5′ probe, threewere detected with the mid-probe and two were identifiedusing the 3′ probe. Southern analyses were performed using

all nine clones and all three probes. Three clones that spannedmost of HKα2 gene were identified (Fig. 1). Clone λHKα2.1contained a DNA fragment that hybridized only to the 5′probe and extended at least 12 kbp in the 5′ direction. CloneλHKα2.5 was identified with the mid-probe, but also hybridizedto the 5′ probe indicating an overlap with λHKα2.1. None of theclones found using the 3' probe shared sequence withλHKα2.5.The downstream clone selected for sequence analysis wasλHKα2.8. Together λHKα2.1, λHKα2.5 and λHKα2.8contained genomic DNA covering >90% of the rabbit HKα2gene. Genomic PCR was used to amplify fragments containingintron–exon boundaries within the gap between λHKα2.5 andλHKα2.8 (Fig. 1). The sequence of the HKα2 gene wassubmitted to GenBank under the following accession numbers:AY552537 (exons 1–11), AY552538 (exon 12), AY552539(exons 13 and 14), AY552540 (exons 15–17), AY552541(exons 18–21), and AY552542 (exons 22 and 23).

Nucleotide sequence data from the three λ clones and thefour PCR products were used to determine the genomicorganization for the rabbit HKα2 gene (Table 1). The rabbitHKα2 gene contained 23 exons organized much like thehuman ATP1AL1[12], the mouse HKα2 [16] and the rat HKα2genes (NCBI database). The exon sizes were identical in allexcept for three 5′ exons (1, 2 and 14) and the last exon (23).This strongly supported the conclusion that the genes werehomologous, and focused our attention on the differences at theextreme 5′ end of the gene.

3.2. Transcription start sites for HKα2a and HKα2c

Our report of the HKα2c cDNA and the subunit [18] had beenattributed to an artifact of an in vitro system [19]. In order todetermine if the HKα2c transcript existed in the animal, theHKα2a and HKα2c mRNAs were mapped at single-baseresolution using the RNase protection assay. HKα2a andHKα2c specific probes were designed and annealed to rabbitcolon total RNA. Colon RNA was chosen because it was themost abundant in vivo source of HKα2 mRNAs [18]. Theexperiments yielded protected fragments for both HKα2a andHKα2c (Fig. 2). The protected fragments for HKα2a were 94and 95 bp (Fig. 2A). This placed the transcription start site forHKα2amRNA10–11 bp upstream of the cDNA end reported byFejes-Toth et al. [19]. More importantly, the HKα2c protectedfragments were 117 and 118 bp (Fig. 2B), corresponding to 6–7bp upstream of the cDNA end obtained by Campbell et al. [18].The result represented an independent approach to showing theexistence of the HKα2c subunit mRNA in vivo.

3.3. HKα2 gene promoter

Sequence 1500 bp upstream and 900 bp downstream of theHKα2a transcription start site was analyzed using CPGplot(www.ebi.ac.uk/cpg/) and TFSearch [21]. A CpG islandcharacteristic of eukaryotic promoters extended from −80 to+483 and covered the transcription start sites for both HKα2aand HKα2c. The TFSearch program identified many putativetranscription factor binding sites, and these were sorted for

Table 1Exon and intron sizes for the rabbit, rat, mouse and human (ATPAL1) HKα2 genes

Exon Rabbit a Ratb Mousec Humand Intron Rabbita Ratb Mousec Humand

1 208 287 262 195 1 569 677 658 (700)2 141 153 150 159 2 2702 2133 2286 (2300)3 60 60 60 60 3 3061 2511 2321 (2900)4 201 201 201 204 4 1049 746 762 7385 114 114 114 114 5 1032 742 726 9376 135 135 135 135 6 115 124 129 1237 118 118 118 118 7 173 233 227 2588 269 269 269 269 8 854 939 970 11879 199 199 199 200 9 142 144 134 15710 110 110 110 110 10 2282 1324 1269 (1700)11 135 135 135 135 11 (4200) 4231 2010 (4200)12 193 193 193 193 12 (1600) 1484 1471 (1600)13 176 176 176 176 13 105 834 639 (900)14 138 137 137 137 (4200) 1599 1597 (4200)15 151 151 151 151 15 365 ⁎ 1419 55716 169 ⁎ 169 169 16 88 ⁎⁎ 90 8717 155 ⁎ 155 155 17 (700) 1425 1311 (1900)18 124 124 124 124 18 171 184 195 19319 146 145 146 146 19 445 594 590 (600)20 134 134 134 134 20 167 174 168 19521 102 102 102 102 21 (11,550) 434 388 43122 92 92 92 92 22 87 137 161 8323 658 658 658 905 23 – – – –

Sources: athis work, bNCBI database, c[16], d[18] Notes: () indicates introns with sizes determined by estimating the size of restriction fragments. ⁎ indicates sizesthat could not be determined due to incomplete database sequence.

446 D.L. Zies et al. / Biochimica et Biophysica Acta 1759 (2006) 443–450

transcription factors known to be expressed in kidney tissue(Fig. 3). An element with weak homology to a TATA box waslocated just upstream of the HKα2a transcription start site andan apparent CAAT box was located upstream of the HKα2ctranscription start site.

In order to identify elements important for expression andregulation of the HKα2 gene, a luciferase reporter gene strategywas adopted. A 5.5 kbp genomic fragment containing 5400 bpof sequence upstream of the HKα2a transcription start site and

Fig. 2. The HKα2 gene transcription start sites for HKα2a (panel A) and HKα2c (represents the protected fragment from the RNase protection assay performed withshown below each figure. Arrows indicate the position of the transcription start sites.transcription start site.

93 bp downstream of the transcription start site was cloned fromλHKα2.1 into pGL3-basic to direct expression of luciferase.This fragment did not contain the transcription start site forHKα2c or the translation start sites for HKα2a and HKα2c. Aseries of deletion constructs were made by progressivelyremoving segments of DNA from the 5' end of the fragment(Fig. 4). HKα2 deletion constructs were transiently transfectedinto rabbit cortical collecting tubule RCCT28A cells along witha Renilla luciferase transfection control DNA. Surprisingly,

panel B). GATC represents those nucleotides for the M13 control sequence. Rrabbit colon RNA. A portion of the genomic sequence 5′ of the HKα2 gene isBolded nucleotides represent putative core promoter elements upstream of each

447D.L. Zies et al. / Biochimica et Biophysica Acta 1759 (2006) 443–450

activity increased as the HKα2 DNA was reduced to position−345. Control experiments involving replacement of thedeleted DNA with bacterial DNA demonstrated that this wasnot a product of the size of the construct (Fig. 4, dotted line).Two statistically significant increases in reporter gene activitywere observed. These increases correspond to deletions of DNAbetween positions −2471 to −1919, and −881 to −639. Atranscription factor database search using the deleted sequencesrevealed several possible binding sites for potential transcrip-tional repressors known to be expressed in kidney. Betweenpositions −2471 and −1919 there were four potential GATA-1binding sites (−2385, −2111, −2052, −1980), one NFκBbinding site (−2471), one AP-1 binding site (−2428) and twoC/EBP binding sites (−2031, −1983). Similarly, betweenpositions −881 and −639, there were two GATA-1 bindingsites, one CREB binding site and one AP-1 binding site (Fig. 3).

Fig. 3. Nucleotide sequence of the 5′-flanking region of the HKα2 gene. This sequenctranscription start site. Bold letters indicate the 5′most transcription start sites for HKand a CCAAT box element that may serve as core promoter element for HKα2a and H1 and exon 2 amino acids of HKα2a. Italics indicate nucleotides that code for aminosequences represent binding sites that were identified by TFSearch for transcription

The functionality of these binding sites was not tested.Additionally, there were short sequences conserved betweenthe two regions; mutation of those bases did not result in anincreased luciferase activity (data not shown).

The two shortest deletion constructs (−345 and −26) haddramatic decreases in luciferase activity (Fig. 4). A transcriptionfactor database search of the region between −639 and −345revealed potential binding sites for NFkB, C/EBP and GATA-1(Fig. 3). Furthermore, an alignment of the DNA sequence from−345 to −26 with the same region of the human ATP1AL1, themouse HKα2, and the rat HKα2 genes revealed a great deal ofconservation that included a completely conserved CATTTAAelement located at the appropriate distance from the transcrip-tion start site to serve as a TATA box (−31). In order to test thefunctionality of the element, two mutations were made to the−639 reporter gene construct (Fig. 5). The first mutation

e of 2400 bp represents 1500 bp upstream and 900 bp downstream of the HKα2aα2a (+1) and HKα2c (+382). Boxed sequences represent a TATA-like elementKα2c respectively. Capital letters indicate the nucleotide bases that code for exonacids in exon 1 of HKα2c that are not included in exon 2 of HKα2a. Underlinedfactors that have been shown to be expressed in kidney tissue.

Fig. 4. Deletion analysis of the HKα2 promoter. Relative light units for reportergene constructs that contain the HKα2a transcription start site. Error barsindicate standard error for N≥6. Stars represent constructs that had astatistically significant difference in luciferase activity when compared to theprevious construct using a one way ANOVA analysis. Dotted line represents theinsertion of bacterial DNA.

Fig. 5. Mutation of the apparent TATA box. Relative light units for reporter geneconstructs with mutations in the CATTTAA element. X represents the mutationthat converts the CATTTAA element to a random sequence (ATCGAGG).Triangle represents a mutation that converts the CATTTAA element into aconsensus TATA element (ATATAAAA). Error bars indicate standard error forN≥6.

Fig. 6. RT-PCR products indicating the presence or absence of HKα2transcripts. Lane designations are as follows: Lane 1: 1 kbp ladder, lane 2:blank, lane 3: 70% confluent RCCT28A cells without reverse transcriptase(−RT), lane 4: 70% confluent RCCT28A cells +RT, lane 5: 100% confluentRCCT28A cells −RT, lane 6: 100% confluent RCCT28A cells +RT, lane 7:plasmid control showing the expected size of the PCR product using primersBC230 and BC231.

448 D.L. Zies et al. / Biochimica et Biophysica Acta 1759 (2006) 443–450

converted the CATTTAA to a randomized sequence(CGATCGA) and the second mutation converted it to aconsensus TATA box sequence (TATAAAA). Approximatelyhalf of the promoter activity was lost upon mutation of theCATTTAA element. Other putative core promoter elementsfound in the HKα2 promoter likely contribute to the remainingreporter gene activity. These include SP1 binding sites, aninitiator sequence and a downstream promoter element.Promoter activity was restored by conversion to a consensusTATA box sequence indicating that the element probably servesthis role in the HKα2 promoter.

3.4. RCCT28A cell confluency and HKα2 gene expression

Surprisingly, the HKα2 gene promoter was repressed underthe conditions of the reporter gene assay. Our laboratory hadpreviously reported that the HKα2 gene was in fact expressed inRCCT28A cells [18]. The one major difference between theearlier experiments and the reporter gene experiment was theconfluency of the cells. The luciferase reporter experimentswere necessarily conducted under conditions where the cellswere not confluent because of the need to obtain efficienttransient transfection. Therefore, it seemed plausible that therepression of the HKα2 gene observed was due to the level ofcell confluency with the gene only maximally expressed inpolarized cells. RT-PCR was performed on total RNA isolatedfrom RCCT28A cells grown to 70% and to 100% confluency tomonitor expression of the endogenous chromosomal HKα2gene, rather than relying on a reporter. A RT-PCR product wasonly observed when RNA from the 100% confluent cells wasused as template (Fig. 6). Additionally, mRNA was isolatedfrom 30 culture dishes containing RCCT28A cells grown toeither pre- or 30 days post- confluency. QPCR analysis showedthat 10 of 12 pre-confluent dishes had an undetermined Ct

values after 45 cycles, whereas 15 of 18 post-confluentproduced determined Ct values after 45 cycles. Cultureconfluency clearly favored HKα2 gene expression, however,

there must be additional factors that affect HKα2 geneexpression.

4. Discussion

Here we report the cloning and characterization of therabbit HKα2 gene. The genomic organization of the rabbitHKα2 gene provided additional evidence that the rabbitgene is indeed homologous to the mouse HKα2 gene, the ratHKα2 gene, and the human ATP1AL1 gene. In rabbit colon,the HKα2 gene had transcription start sites for both HKα2aand HKα2c. This unambiguously demonstrated that theHKα2c transcript was an authentic rabbit transcript presentin RNA derived from rabbit tissue. Moreover, the resultestablished that use of alternative transcription initiation siteswas the mechanism for generation of two mRNAs. Reportergene analysis of the HKα2 gene promoter identified the corepromoter and two regions upstream with respect to thepromoter that account for negative regulation of thepromoter.

The computer analysis of the sequence immediatelyupstream of the HKα2a and HKα2c transcription start sitesrevealed a large number of putative transcription factorbinding sites. Several transcription factor binding sites may beof particular interest. One apparent site was the CATTTAAelement that appeared to serve as the TATA box and was

449D.L. Zies et al. / Biochimica et Biophysica Acta 1759 (2006) 443–450

completely conserved between human, mouse, rat, and rabbit.However, none of the other putative transcription factorresponse elements appeared to be conserved across mamma-lian species at exactly the same positions. Nevertheless, manyof the factor binding sites were found at different locations onall three genes. For example, in rats cyclic AMP increaseswhen blood K+ levels decrease [22]. Putative CRE werefound at −217, −869, and −1245 in the rabbit gene providinga plausible mechanism for stimulation of transcription fromthe HKα2 gene in response to hypokalemia. In fact, it wasrecently reported that the CRE at −177 in the mouse HKα2promoter played a functional role in regulating geneexpression [23]. Similarly, NF-κB inhibits transcription ofHKα2 in a mouse medullary collecting duct cell line [24]; aputative NF-κB site is located at −486 in the rabbit HKα2promoter.

One important observation was that in RCCT28A cells, theHKα2 gene was not expressed until the cells reach confluency.The promoter deletion analysis suggested that the HKα2 genewas largely repressed under the conditions of the assay.Removal of two negative regulatory regions of DNA stimulatedthe reporter gene, but no consensus sequences for knownrepressor binding sites were found in those regions. DifferentialHKα2 gene regulation was also observed in mouse kidney andcolon using an HKα2 promoter–reporter transgene [25].Therefore, specific cell types may express unknown factorsthat act on the HKα2 gene promoter. Indeed, comparison of thisstudy with the results from Zhang et al. [16] indicated that theregulation in the cortical collecting duct cells may differ frommedullary collecting duct cells. Zhang et al. observedsignificant reporter gene activity in their assays using a mousemedullary collecting duct cell line [16] whereas we observedrepression with a similar promoter construct in RCCT28A cells.Furthermore, our observation that cell confluency plays a role inregulation of HKα2 gene expression is in line with work fromother laboratories showing increased gene expression withincreasing confluency [26,27].

Acknowledgements

This work was supported by Public Health Service grantDK54721 and a predoctoral fellowship to D.L.Z. from theAmerican Heart Association.

References

[1] C.S. Wingo, B.D. Cain, The renal H-K-ATPase: physiological significanceand role in potassium homeostasis, Annu. Rev. Physiol. 55 (1993)323–347.

[2] A.M. Simpson, G.J. Schwartz, Distal renal tubular acidosis with severehypokalaemia, probably caused by colonic H(+)-K(+)-ATPase deficiency,Arch. Dis. Child 84 (2001) 504–507.

[3] T.D. DuBose Jr., J. Codina, A. Burges, T.A. Pressley, Regulation of H(+)-K(+)-ATPase expression in kidney, Am. J. Physiol. 269 (1995)F500–F507.

[4] Y.M. Barri, C.S. Wingo, The effects of potassium depletion andsupplementation on blood pressure: a clinical review, Am. J. Med. Sci.314 (1997) 37–40.

[5] K.Y. Ahn, K.Y. Park, K.K. Kim, B.C. Kone, Chronic hypokalemiaenhances expression of the H(+)-K(+)-ATPase alpha 2-subunit gene inrenal medulla, Am. J. Physiol. 271 (1996) F314–F321.

[6] D.L. Zies, C.S. Wingo, B.D. Cain, Molecular regulation of the HKalpha2subunit of the H+,K(+)-ATPases, J. Nephrol. 15 (Suppl. 5) (2002)S54–S60.

[7] P. Meneton, P.J. Schultheis, J. Greeb, M.L. Nieman, L.H. Liu, L.L. Clarke,J.J. Duffy, T. Doetschman, J.N. Lorenz, G.E. Shull, Increased sensitivity toK+ deprivation in colonic H,K-ATPase-deficient mice, J. Clin. Invest. 101(1998) 536–542.

[8] S. Nakamura, Z. Wang, J.H. Galla, M. Soleimani, K+ depletion increasesHCO3- reabsorption in OMCD by activation of colonic H(+)-K(+)-ATPase, Am. J. Physiol. 274 (1998) F687–F692.

[9] P.J. Schultheis, L.L. Clarke, P. Meneton, M.L. Miller, M. Soleimani, L.R.Gawenis, T.M. Riddle, J.J. Duffy, T. Doetschman, T. Wang, G. Giebisch, P.S. Aronson, J.N. Lorenz, G.E. Shull, Renal and intestinal absorptivedefects in mice lacking the NHE3 Na+/H+ exchanger, Nat. Genet. 19(1998) 282–285.

[10] P. Sangan, S. Thevananther, S. Sangan, V.M. Rajendran, H.J. Binder,Colonic H-K-ATPase alpha- and beta-subunits express ouabain-insensitiveH-K-ATPase, Am. J. Physiol., Cell Physiol. 278 (2000) C182–C189.

[11] F. Jaisser, B. Escoubet, N. Coutry, E. Eugene, J.P. Bonvalet, N. Farman,Differential regulation of putative K(+)-ATPase by low-K+ diet andcorticosteroids in rat distal colon and kidney, Am. J. Physiol. 270 (1996)C679–C687.

[12] V.E. Sverdlov, M.B. Kostina, N.N. Modyanov, Genomic organization ofthe human ATP1AL1 gene encoding a ouabain-sensitive H,K-ATPase,Genomics 32 (1996) 317–327.

[13] B.C. Kone, S.C. Higham, A novel N-terminal splice variant of the rat H+-K+-ATPase alpha2 subunit. Cloning, functional expression, and renaladaptive response to chronic hypokalemia, J. Biol. Chem. 273 (1998)2543–2552.

[14] A.V. Grishin, V.E. Sverdlov, M.B. Kostina, N.N. Modyanov, Cloning andcharacterization of the entire cDNA encoded by ATP1AL1—A member ofthe human Na,K/H,K-ATPase gene family, FEBS Lett. 349 (1994)144–150.

[15] M.S. Crowson, G.E. Shull, Isolation and characterization of a cDNAencoding the putative distal colon H+,K(+)-ATPase. Similarity of deducedamino acid sequence to gastric H+,K(+)-ATPase and Na+,K(+)-ATPaseand mRNA expression in distal colon, kidney, and uterus, J. Biol. Chem.267 (1992) 13740–13748.

[16] W. Zhang, T. Kuncewicz, S.C. Higham, B.C. Kone, Structure,promoter analysis, and chromosomal localization of the murine H(+)/K(+)-ATPase alpha 2 subunit gene, J. Am. Soc. Nephrol. 12 (2001)2554–2564.

[17] S. Asano, S. Hoshina, Y. Nakaie, T. Watanabe, M. Sato, Y. Suzuki, N.Takeguchi, Functional expression of putative H+-K+-ATPase from guineapig distal colon, Am. J. Physiol. 275 (1998) C669–C674.

[18] W.G. Campbell, I.D. Weiner, C.S. Wingo, B.D. Cain, H-K-ATPase in theRCCT-28A rabbit cortical collecting duct cell line, Am. J. Physiol. 276(1999) F237–F245.

[19] G. Fejes-Toth, A. Naray-Fejes-Toth, H. Velazquez, Intrarenal distributionof the colonic H,K-ATPase mRNA in rabbit, Kidney Int. 56 (1999)1029–1036.

[20] T.L. Caviston, W.G. Campbell, C.S. Wingo, B.D. Cain, Molecularidentification of the renal H+,K+-ATPases, Semin Nephrol. 19 (1999)431–437.

[21] T. Heinemeyer, E. Wingender, I. Reuter, H. Hermjakob, A.E. Kel, O.V.Kel, E.V. Ignatieva, E.A. Ananko, O.A. Podkolodnaya, F.A. Kolpakov, N.L. Podkolodny, N.A. Kolchanov, Databases on transcriptional regulation:TRANSFAC,TRRD and COMPEL, Nucleic Acids Res. 26 (1998)362–367.

[22] J.K. Kim, S.N. Summer, T. Berl, The cyclic AMP system in the innermedullary collecting duct of the potassium-depleted rat, Kidney Int. 26(1984) 384–391.

[23] X. Xu,W. Zhang, B.C. Kone, CREB trans-activates the murine H(+)-K(+)-ATPase alpha(2)-subunit gene, Am. J. Physiol., Cell Physiol. 287 (2004)C903–C911.

450 D.L. Zies et al. / Biochimica et Biophysica Acta 1759 (2006) 443–450

[24] L. Sun, N. Halaihel, W. Zhang, T. Rogers, M. Levi, Role of sterolregulatory element-binding protein 1 in regulation of renal lipidmetabolism and glomerulosclerosis in diabetes mellitus, J. Biol. Chem.277 (2002) 18919–18927.

[25] W. Zhang, X. Xia, L. Zou, X. Xu, G.D. LeSage, B.C. Kone, In vivoexpression profile of a H+-K+-ATPase alpha2-subunit promoter–reportertransgene, Am. J. Physiol. Renal Physiol. 286 (2004) F1171–F1177.

[26] S. Durual, C. Blanchard, M. Estienne, M.F. Jacquier, J.C. Cuber, V. Perrot,C. Laboisse, Expression of human TFF3 in relation to growth of HT-29 cellsubpopulations: involvement of PI3-K but not STAT6, Differentiation 73(2005) 36–44.

[27] Y. Xu, L.J. Tan, V. Grachtchouk, J.J. Voorhees, G.J. Fisher, Receptor-typeprotein-tyrosine phosphatase-kappa regulates epidermal growth factorreceptor function, J. Biol. Chem. 280 (2005) 42694–42700.