Journal of Controlled Release 132 (2008) 55–64

Contents lists available at ScienceDirect

Journal of Controlled Release

j ourna l homepage: www.e lsev ie r.com/ locate / jconre l

GENEDELIVERY

Characterization of carbosilane dendrimers as effective carriers of siRNA toHIV-infected lymphocytes

Nick Weber a,d, Paula Ortega b,d, Maria Isabel Clemente a,d, Dzmitry Shcharbin c, Maria Bryszewska c,F. Javier de la Mata b,d, Rafael Gómez b,d, M. Angeles Muñoz-Fernández a,d,⁎a Laboratorio Inmunobiología Molecular, Hospital General Universitario Gregorio Marañón, Madrid, Spainb Departamento Química Inorgánica, Universidad de Alcalá de Henares, Madrid, Spainc Department of General Biophysics, University of Lodz, Lodz, Polandd CIBER de Bioingeniería, Biomateriales y Nanomedicina, Instituto Salud Carlos III, Spain

Abbreviations: HIV, human immunodeficiency videficiency syndrome; RNAi, RNA interference; siRNAcarbosilane dendrimer; MeI, methyl iodide; NMR, nucleperipheral blood mononuclear cells; HEPES, 4-(2-hydrsulfonic acid; NaCl, Sodium Chloride; DLS, dynamicanalysis light scattering; SEM, standard error of the meaMTT, (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tedimethyl sulfoxide; BrdU, bromodeoxyuridine; GAPDHdehydrogenase; HAART, Highly Active Anti-Retroviral ThFITC, fluorescein isothiocyanate; PBS, phosphate bufferreaction; RT, room temperature; PHA, phytohemagglutPAGE, polyacrylamide gel electrophoresis; h, hour; miRNA; MOI, multiplicity of infection; PEG, polyethylene g⁎ Corresponding author. Laboratorio Inmunobiología

Universitario Gregorio Marañón, C/ Dr. Esquerdo 46, 280E-mail address: mmunoz.hgugm@salud.madrid.org (

0168-3659/$ – see front matter © 2008 Elsevier B.V. Aldoi:10.1016/j.jconrel.2008.07.035

a b s t r a c t

a r t i c l e i n f o

Article history:

One of the primary limitation Received 3 April 2008Accepted 29 July 2008Available online 5 August 2008

Keywords:DendrimersiRNAHIVNanoparticleTransfection

s of RNA interference as a technique for gene regulation is effective delivery of siRNAinto the target cells. Dendrimers are nanoparticles that are increasingly being used as oligonucleotide and drugdelivery vehicles.We have developed amino-terminated carbosilane dendrimers (CBS) as ameans to protect andtransport siRNA. Initially, stability studies showed that CBS bind siRNA via electrostatic interactions. Dendrimer-bound siRNA was found to be resistant to degradation by RNase. Cytotoxicity assays of CBS/siRNA dendriplexeswith peripheral blood mononuclear cells (PBMC) and the lymphocytic cell line SupT1 revealed a maximum safedendrimer concentration of 25 µg/ml. Next, utilizingflowcytometry and confocal microscopy, lymphocyteswereseen to be successfully transfected by fluorochrome-labeled siRNA either naked or complexed with CBS.Dendriplexes with +/− charge ratio of 2 were determined to have the highest transfection efficiency whilemaintaining a low level of toxicity in these systems including hard-to-transfect HIV-infected PBMC. Finally, CBS/siRNA dendriplexes were shown to silence GAPDH expression and reduce HIV replication in SupT1 and PBMC.These results point to the possibility of utilizing dendrimers such as CBS to deliver and transfect siRNA intolymphocytes thus allowing the use of RNA interference as a potential alternative therapy for HIV infection.

© 2008 Elsevier B.V. All rights reserved.

1. Introduction

HIV/AIDS continues to be a major public health problemworldwidewithmillions of people currently infected andnew infectionson the rise.As of now, no effective vaccines are available for the prevention of HIVinfection, however, there are a number of medical treatments availableto help keep HIV in check and prevent the progression to AIDS. HighlyActive Anti-Retroviral Therapy (HAART) is the standard of care for HIV

rus; AIDS, acquired immune, small interfering RNA; CBS,ar magnetic resonance; PBMC,oxyethyl)-1-piperazineethane-light scattering; PALS, phasen; LDH, lactate dehydrogenase;trazolium-bromide); DMSO,, glyceraldehyde 3-phosphateerapy; PFA, paraformaldehyde;ed saline; PCR, polymer chaininin; FBS, fetal bovine serum;n, minute; mRNA, messengerlycol.Molecular, Hospital General07, Madrid, Spain.M.A. Muñoz-Fernández).

l rights reserved.

infection [1]. HAARThasmadeAIDSmoremanageable, despite its severeside effects and the fact that patients remain infectious. In addition, thehigh mutation rate of HIV makes multiple drug resistance a continuingand challenging problem [2]. Thus, alternative therapies need to beexplored. Recently, RNA interference (RNAi) has been shown toefficiently inhibit gene expression in a sequence-specific manner [3,4].The prospect of RNAi mediated treatment of HIV as an alternative forfuture therapy of HIV/AIDS poses a tantalizing idea [5].

Themechanism of RNAi involves short double-stranded segments ofRNA termed short interfering RNA (siRNA). The introduction of theseoligonucleotides into the cytoplasm of the cell results in degradation ofmRNA complementary to the sequence contained in the siRNA [6]. RNAiis a technique that has been used to successfully target HIV replication[7–13]. However, a major limiting step for the success of this therapy isthe effective delivery and transfection of siRNA into the target cells [14].This issue is of main concern especially for in vivo settings and withprimary suspension cell lineswhich are exceedingly difficult to transfect[15] and constitute the battle ground for HIV research.

One of the hurdles that RNAi faces in vivo is degradation of siRNA byRNases while in the bloodstream. On the other hand, the mainimpediment for in vitro use of RNAi with cells in suspension is successfultransfection. Current techniques used for siRNA delivery in vitro such ascationic lipids or viral vectors pose problems such as low transfection

GENEDELIVERY

56 N. Weber et al. / Journal of Controlled Release 132 (2008) 55–64

efficiency, cytotoxicity and immunogenicity [16–21] in particular whenthey are utilized for lymphocytic cell lines or in vivo. There is a need for analternative approach to siRNA delivery with the potential of overcomingthese obstacles.

We have synthesized carbosilane dendrimers (CBS) to address thedifficulties in siRNA and oligonucleotide delivery [22]. Dendrimers arenanoscopic monodisperse polybranched synthetic polymers. Ammo-nium-terminated carbosilane dendrimers bind siRNA or oligonucleo-tides forming a “dendriplex” via electrostatic interactions between thenegatively charged oligonucleotide backbone and the positively chargedfunctional groups located on the dendrimer extremities. Carbosilanedendrimers possess interior carbon–silicon bonds that are slowly hydro-lyzedwhen the dendrimer is dissolved inwater. This results in a gradualliberation of the exterior branches and their cargoes. The bulk of thistime-dependent release has been estimated to be between 4 and 24 h[23]. Theobjective of using this structure is for thedendrimer tobindandprotect the siRNA while in transit to the target cells, facilitate its trans-fection into the cytoplasm, and release the siRNA once inside the cells.

Previous research by our group has focused on a number ofcarbosilane dendrimer structures. This paper reports on experimentalresults obtained with one type of second generation ammonium-terminated CBS synthesized to possess either 8 or 16 positive chargesdepending on the degree of quaternization with MeI (Fig. 1). First,dendriplexes formed between these CBS and siRNAwere characterizedin terms of their stability, strength of union, resistance to degradation byRNase, particle size, and zeta potential. Next, cytotoxicity experimentswere carried out on PBMC and a T lymphocytic cell line. Transfectionefficiency was then measured, before finally analyzing dendriplexfunctionality via GAPDH silencing and HIV inhibition experiments.

2. Materials and methods

2.1. Dendrimers

Carbosilane dendrimers were all synthesized as has been previouslyreported [23]. The method of preparation of the dendrimers follows adivergent procedure (synthesis from the core outwards). Two distinctdendrimerswereused. Theyare2G-CBS-(OCH2CH2NMeCH2CH2N+Me3+I−)8and 2G-CBS-(OCH2CH2N+Me2CH2CH2N+Me3I−)8, andwill be referred to as

Fig. 1. Structure of second-generation carbosilane dendrimers.

2G-NN8 and 2G-NN16, respectively, based on the number of positivecharges each one possesses (Fig. 1). The difference between the twodendrimers is the amount of quaternization of the exterior amine groupson each branch. At pH 7.4 (physiological pH), the two dendrimer variantspossess 8 and 16 positive charges as has been shown by 1H NMR and 13CNMR spectroscopy measurements [23].

2.2. siRNA

All siRNA sequences were chosen from previously published results[24–26] and had inhibited HIV replication in experiments using tran-siently transfected cells. They were purchased from Dharmacon. Inc.(Lafayette, CO). The sequences of the various siRNA were siP24, sense:GAUUGUACUGAGAGACAGGCU, antisense: CCUGUCUCUCAGUACAAU-CUU; siGAG1, sense: GAGAACCAAGGGGAAGUGACAdTdT, antisense:UGUCACUUCCCCUUGGUUCUCdTdT; siNEF sense: GUGCCUGGCUA-GAAGCACAdTdT, antisense: UGUGCUUCUAGCCAGGCACdTdT. ThesiRNA siP24 labeled with the fluorochrome cyanine 3 (Cy3) on the 5′end of the sense strandwas utilized to detect the entrance of siRNA intocells. A positive control siRNA designed to silence the expression of thehousekeeping gene GAPDH (siGAPDH) was used to indicate successfultransfection and biological activity of siRNA. In siRNA functionalityexperiments a siRNAof random sequencewas used as a negative controlto test for sequence-specific effects (siRandom). This siRNA wassiCONTROL Non-Targeting siRNA #2 designed and screened by Dhar-macon to have no silencing effect on any human, mouse or rat genes.

2.3. Cell lines

The established cell line SupT1 (human leukemia T lymphocytes)wasmaintained in complete RPMI 1640 growthmedium (BiochromAG)supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 1%ampicillin,1% cloxacillin, 0.32% gentamicin,10mMHEPES,1mMsodiumpyruvate and 4.5 g/l glucose at 37 °C in a 5% CO2 atmosphere.

2.4. Primary cell cultures

Peripheral blood mononuclear cells (PBMC) were obtained fromhealthy HIV-negative blood donors by standard Ficoll–Hypaquedensity centrifugation, activated with the mitogen phytohemaggluti-nin (PHA) (2 µg/ml), and maintained in RPMI 1640 complete growthmedium supplemented with 10% FBS and antibiotics along withinterleukin-2 (20 U/ml).

2.5. Dendriplex formation

Dendriplexes were formed by mixing equal volumes of dendrimerand siRNA dissolved in OPTIMEM® I free of serum or antibiotics atconcentrations depending on the +/− charge ratio andmolar concentra-tion desired.

Heparin exclusion experiments were utilized to test the strength ofthe union between dendrimer and siRNA. These were carried out bymixing dendriplexes (+/− ratio 4) of 2G-NN8 or 2G-NN16 with varyingconcentrations of Heparin (0.1, 0.15, 0.2, 0.3, and 0.6 U/μg siRNA). Themixture was run on a 20% polyacrylamide gel for 2 h at 15mA that wasthen immersed in a 0.0017% ethidium bromide solution for 5 minfollowed by a 5 min wash in water. The gels were photographed andthe bandswere quantified using the program ImageJ (1.38×, NIH, USA).

For protective effect experiments, dendriplexes (+/− ratio of 2) orsiRNA alone were incubated with 0.25% RNase (Promega, MadisonWI,USA) at 37 °C for 30 min and were then loaded on a 3% agarose gelcontaining 0.017% ethidium bromide and run at 90 V for 30 min.

2.5.1. Size and zeta potentialAll samples intended for light scattering analyses were prepared at

25 °C using 0.15 mol/l HEPES buffer (containing 6 mmol/l HEPES and

57N. Weber et al. / Journal of Controlled Release 132 (2008) 55–64

GENEDELIVERY

144 mmol/l NaCl), pH 7.4, which was filtered with a 0.22-mm filter toremove any trace particulates. Complexes of 2G-NN16 and siGAG1were prepared at a 500 nM siRNA concentration and at +/− chargeratios between 0 and 16. Particle size of complexes was measured bydynamic light scattering (DLS) using a Malvern Zeta-Sizer Nano S90(Malvern, UK). The light scattered at 90° from the incident light was fitto an autocorrelation function using the method of cumulants. Theparticle size of a sample was determined from the average of 12 cyclesin a Malvern disposable plastic cuvette at 25 °C.

Zeta potential experimentswere carried out by phase analysis lightscattering (PALS) using a Malvern Instruments Zetasizer 2000(Malvern, UK) at 25 °C. The electrophoretic mobility of the scattering(DLS) samples was determined from the average of 6 cycles of anapplied electric field in a standard rectangular quartz cell. The zetapotential of complexes was determined from the electrophoreticmobility by means of the Smoluchowski approximation. All data areexpressed as a mean value±SEM of 4 independent experiments.Statistical significance was assessed using Student–Fisher test.

2.6. Cytotoxicity

2.6.1. LDH assayTo test cytotoxicity, cells were submitted to treatment of dendrimers

or dendriplexes and toxic effects were assessed by measuring cellmembrane rupture and release of lactase dehydrogenase (LDH) into thesupernatant via the CytoTox96®Non-Radioactive Cytotoxicity Assay kit(Promega). In all experiments, the transfection medium, whether it bedendrimer, dendriplex or Lipofectin®, was never removed prior to theend of the experiment. SupT1 cells were seeded in 96 well plates incomplete medium (1.5×105 cells in 190 µl/well) and were submitted totreatment (10 µl) of 2G-NN16 alone or complexedwith siRNA at varying+/− charge ratios. 3 to 24h later,100 µl of the cellswere extracted, spunat1500 rpm for 5 min, the supernatant was separated and the cells wereput aside to be run through the flow cytometer. The supernatant wasanalyzed for LDH according to kit protocol. Measurements werenormalized between the mock treatment control and the TritonX-100(0.1% w/v) control. All points were performed in triplicate. A toxicitylimit was set at 10% LDH release [27].

2.6.2. MTT assaySupT1 or PBMC were seeded in 96 well plates in OPTIMEM® I

medium containing 10% FBS (1.5×105 cells in 190 µl/well) andsubmitted to 10 µl treatment of siRNA alone or complexed with 2G-NN16 at varying +/− charge ratios. 20 h later, 20 µl MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium-bromide) substratesolution (5 mg/ml) was added to the cells to measure mitochondrialactivity. After 4 h, the supernatant was removed and the formedcrystals were dissolved in 200 µl DMSO and absorbancewasmeasuredat 550 nm with a reference of 690 nm. All points were performed intriplicate.

2.6.3. Cell proliferationSupT1 were seeded in 96 well plates 24 h prior in complete

medium containing 2% FBS (1×105 cells in 100 µl/well). The followingday, the serumwas brought up to 10% and the cells were submitted totreatment with siRNA alone or dendriplex. After 20 h and 48 h, cellproliferation was measured by detecting the incorporation ofbromodeoxyuridine (BrdU) in newly synthesized DNA according tokit protocol (Chemicon International, Temecula, CA, USA).

2.6.4. Absolute cell numbersSupT1 cells were seeded and submitted to treatment the same as

for LDH experiments with mock treatment and TritonX-100 used ascontrols. The commercial cationic lipid reagent Lipofectin® (Invitro-gen, Calsbad, CA, USA) was used as a comparative control according tokit transfection protocol for cells in suspension. 72 h later, healthy and

viable cells were counted from 10 µl samples from each well using aNeubauer slide under a light microscope.

2.7. Flow cytometry

Following treatment with dendriplexes or siRNA or dendrimersalone, cells were analyzed by flow cytometry to determine twoattributes,1) the percentage of the cell population that could be deemedviable, and 2) the percentage of the viable cell population that exhibitedfluorescence representing successful uptake of the Cy3-labeled siRNA(siRNA and dendriplex treated cells only). Cells washed with eithertrypsin or glycinic acid to remove any siRNA from the membraneexterior produced identical results as non-washed cells so this step wastypically omitted in order to maintain high cell retention.

2.8. Confocal microscopy

Cells that had been treated with Cy3-labeled siRNA alone, in den-driplex or with a mock treatment were collected after 20 h incubation,spun and resuspended in OPTIMEM® I medium. Cell membranes werelabeled by incubating the cells with a 1:20 dilution of anti-CD45-FITCantibody (BeckmanCoulter, Fullerton, CA,USA).Without beingfixed, thein vivo cells were attached to a slide with poly-L-lysine then viewed andphotographed with a Leica TCS SP2® confocal microscope using dif-ferentexcitationwavelengths (488 and543nm).Unlabeledphotographswere analyzed by three independent viewers to determine percentageof cells positive for uptake of siRNA. Videosweremadeof the live cells bycapturing still images every 30 s during a 5 min span.

2.9. Electroporation

2.9.1. GAPDH silencing experimentsSupT1 cells were washed and resuspended in serum-free OPTI-

MEM® I medium. From 4×106 to 8×106 cells/point were mixed withsiRNAvarying in concentration from10nMto0.5µM inOPTIMEM®I at acell concentration of 10×106 cells/ml in a cuvette and incubated on icefor 15 min prior to subjecting the cuvette to an electropulse (250V,1050F) (EasyjecT Plus®Multipurpose Electroporation System). The cellswere left to recover at room temperature (RT) for 15 min before beingadded dropwise to 2 to 4 ml warm complete medium. Cells were har-vested from two to six days after electroporation and the RNA wasextracted according to SV Total RNA Isolation System kit protocol(Promega). Total RNA quantities were normalized between points bymeasuring RNA concentrations with a Nanodrop® ND-1000 Spectro-photometer. Reverse transcription PCR using the ImProm-II™ ReverseTranscription System (Promega) and real-time PCR using Brilliant®SYBR®Green QPCRMasterMix (Stratagene, Cedar Creek, TX, USA) wereperformed to quantify GAPDH gene expression at themRNA level usingthe housekeeping gene β-actin to normalize mRNA quantities. Theprimers used to amplify GAPDH gene were TGG-GGA-AGG-TGA-AGG-TCG-G (forward) and GGG-ATC-TCG-CTC-CTG-GAA-G (reverse) (Euro-gentec S.A., Belgium) and the primers for β-actin amplification wereGGC-TTC-CCC-AGT-GTG-ACA-T (forward) andGGG-GTG-TTG-AAG-GTC-TCA-AA (reverse) and an annealing temperature of 58 °C was used inreal-time PCR.

2.9.2. HIV inhibition experimentsPBMC that had been stimulated for 2 days with PHA were infected

with HIV NL4-3 at 0.5multiplicity of infection (MOI) in a total volume of1mlduring2hwith frequentmixing. 3 days later, the infected cellswerecollected and spun (1200 rpm, 10 min) and washed once with cellculture medium at RT. 1×106 cells/point were resuspended in 500 µlOPTIMEM® I (RT), mixed with the corresponding siRNA treatment,transferred to a cuvette, subjected to an electropulse (250V,1050F), andimmediately transferred to 15 ml of warm culture medium. Samples ofcells and supernatant were collected every 24 h starting 24 h post-

Fig. 2. CBS-siRNAdendriplex stability. Heparin competition assays reveal strength of unionbetween siRNA and dendrimer. Poly-acrylamide gel electrophoresis reveals the migrationof siRNA due to its release from dendrimers 2G-NN8 (A) or 2G-NN16 (B) as Heparinconcentration increases with bar graphs representing the relative intensity of the siRNAbands. C. Dendrimer exerts a protective effect on siRNA in the presence of RNase.

GENEDELIVERY

58 N. Weber et al. / Journal of Controlled Release 132 (2008) 55–64

treatment and tested for transfection of siRNA and HIV viral concentra-tion, respectively. Transfection of siRNA was detected via flow cyto-metry, and HIV concentration was measured using the HIV protein p24ELISA kit (INNOTEST® HIV Antigen mAb, Innogenetics, N.V., Belgium)according to the kit protocol.

2.10. Treatment with dendriplex

2.10.1. GAPDH silencingSupT1 cells were seeded in 24 well plates in complete medium

(1×106 cells in 900 µl/well) and were submitted to 100 µl treatment ofsiRNA (500 nM) either alone, complexed with 2G-NN16 at a +/− ratioof 2, or with Lipofectin® according to manufacturer protocol. Cellswere harvested 48 h later and RNA was extracted and GAPDH mRNAwas quantified by qPCR as mentioned above.

2.10.2. HIV inhibitionPBMC that had been stimulated with PHA for up to 3 days or SupT1

cellswere infectedwithHIVNL4-3 at 0.05 or 0.01MOI, respectively. Thecells were washed twice with warm medium before being plated andtreated with siRNA or dendriplexes at varying concentrations and +/−ratios. The dendriplex treatment was added to the infected cells withinan hour of the end of the incubation with HIV. The dendriplexwas formed in serum- and antibiotic-free OPTIMEM® I and incubated15minatRT for the complex to formprior to adding it to theplated cells.Samples were collected every 24 h starting 24 h after treatment, spun,and the supernatant was collected and assayed for viral concentrationusing the HIV protein p24 ELISA kit according to kit protocol. Thedilution factors depended on theMOI of infection and the time point inwhich the sample was collected but ranged from 10−1 to 10−4.

3. Results

3.1. Dendriplex formation and stability

siRNA/CBS dendriplexes were formed in OPTIMEM® I and testedfor stability using gel electrophoresis. 3% agarose gels were used todetect retention of the siRNA due to its union with the dendrimer atvarying +/− ratios. Various trials revealed that siRNA retention is seenstarting with a +/− ratio of 1 with full retention achieved with +/− ratiofrom 2–4 for both 2G-NN8 and 2G-NN16 (data not shown).

In order to test the strength of the union between siRNA and CBSdendrimer, heparin competition assayswere performed. Polyacrylamidegel electrophoresis (PAGE) was utilized to adequately visualize andquantify the siRNA released from the dendriplex as heparin con-centration increased. It was found that 2G-NN8 binds siRNA morestrongly as a slight release of siRNA is not seen until heparin concen-tration of 0.2 U Hep/μg siRNA (Fig. 2A) while the release of siRNA from2G-NN16 begins at 0.15 U/μg (Fig. 2B). There is also a substantially largeramount of siRNA released at 0.2 U/μg with 2G-NN16 thanwith 2G-NN8.

3.2. Protection from RNase

Agarose gel electrophoresis was used to characterize a possibleprotective effect that CBS dendrimer has on siRNA. As shown in Fig. 2C,naked siRNA was seen to be completely degraded in the presence ofRNase, while siRNA retained in the gel wells due to its union with CBSshowed no signs of RNase degradation whatsoever. Furthermore, thesmall amount of siRNA that was not bound to the dendrimer and wasfree to migrate in the gel disappears when in the presence of RNase.

3.3. Size and zeta potential

Addition of 2G-NN16 led to changes of zeta potential of the siRNA,siGAG1. From a +/− charge ratio of 1 up to 3 a sharp and significantincrease of zeta potential from −20 to +5 was observed. When den-

drimer concentrationwas increased from a +/− charge ratio of 4 up to 16a continuous but more gradual increase of zeta potential was observed.Based on these data, NN16/siGAG1 dendriplex when formed in HEPESbuffer appears to possess a +/− charge ratio of 3 (SupplementarymaterialFig. S1A). The particle size of the dendriplexes estimated by intensity atdifferent NN16/siGAG1 charge ratios is presented in the Supplementarymaterial Fig. S1B. At a charge ratio of between 3 and 8 the size ofdendriplexes ranged from300 to 370 nm. Further addition of dendrimerled to an increase in dendriplex size.

3.4. Cytotoxicty of CBS dendrimers

Dendriplexes and dendrimers alone were tested on cells for a toxiceffect using an array of assays to measure cell viability, membranerupture, metabolic activity, and cell proliferation. To test membranerupture, LDH assay was utilized on SupT1 cells with 10% LDH releaserepresenting a limit above which treatments were considered toxic. At3 h post-treatment, 2G-NN16 alone was determined to exert a toxiceffect when used at concentrations above 15 μg/ml. Meanwhile, whencomplexed with siRNA (250 nM), a toxic effect was not reached untilslightly more than 25 μg/ml 2G-NN16 (Fig. 3A) corresponding to a +/−charge ratio of 8. Mitochondrial metabolism for both SupT1 and PBMCtreated with dendriplex was measured by MTT assay. In both cell types,mitochondrial activity remained higher than the toxicity limit of 80%when subjected to dendriplex treatments of up to 24 μg/ml (Fig. 3B).

Cell viability was measured using flow cytometry where cells weredeemed viable if they fell within the established area of healthy cells insize/complexity dot plots. Again results show that dendrimer alone isslightlymore toxic thanwhen complexedwith siRNA (Fig. 3C). At higherdendrimer concentrations (above 25 μg/ml),more cell loss is detected at

59N. Weber et al. / Journal of Controlled Release 132 (2008) 55–64

GENEDELIVERY

24 h than at 3 h. The results mirror LDH toxicity results in that at25 μg/ml, around 10% of the cell population cannot be deemed viable.Furthermore, cell proliferation assays and counts of absolute cellnumbers reflect a non-toxic and non-proliferative effect of 2G-NN16on T lymphocytes (Fig. 3D and E).

3.5. Transfection efficiency of CBS/siRNA dendriplexes

Flow cytometry was used to detect the entrance of fluorochrome-labeled siRNA either alone or complexed with 2G-NN16 dendrimerinto viable SupT1 cells. At 3 h, the highest transfection efficiency isinterestingly detected for siRNA alone and at +/− charge ratios of 2 and1 (86, 84 and 81%, respectively) (Fig. 4A). For higher +/− charge ratios,not only a lower transfection efficiency was measured, but also adiminished quantity of viable cells were seen inevitably due to toxiceffects. By 24 h, the percentages of successfully transfected cells for alltreatments with siRNA were 100%, and the intensity of fluorescenceemitted by the cells was substantially higher indicating a largequantity of siRNA in the interior of each cell (Fig. 4B and C).

3.6. Confocal microscopy

To assure that flow cytometry results indicated a successful trans-fection into the cytoplasm of the cell as well as to further investigatethe rare occurrence of successful uptake of naked siRNA, cells that hadbeen treated with fluorochrome-labelled siRNA either alone or indendriplex at +/− ratio of 1 or 2 were viewed with a scanning confocalmicroscope (Fig. 5). The figure images are labeled with the per-centages of cells with successful uptake of siRNA. For all treatments,the siRNAwas clearly seen in the interior of a majority of the cells witha higher percentage of uptake for a +/− ratio of 1. The cells were clearlyalive and viable as is seen in videos showing healthy, mobile cells withsiRNA clearly located in the interior of the cells (Supplementary ma-terial Vid. S2).

3.7. Toxicity and transfection efficiency in HIV-infected PBMC

Next, toxicity and transfection efficiency were tested for siRNA anddendriplex treatments on HIV-infected PBMC. At 3 h, unlike with theSupT1 cells, naked siRNA was unable to enter the PBMC, but whencomplexed with 2G-NN16 successful transfectionwas obtained with amaximum at +/− ratio of 2 (41%) (Fig. 6A). Despite this difference,toxicity profiles for these cells mimicked the results for SupT1.

By 24 h, much higher transfection efficiency was seen for nakedsiRNA as well as +/− ratios of 1 and 2. Lipofectin® also exhibited highertransfection efficiency at 24 h compared to 3 h, however not to theextent of 2G-NN16 (Fig. 6B). The percentage of viable cells was loweras awhole for these cells, as a result in part of the HIV infection, but nosubstantial difference was detected between control cells and thosetreated with dendriplex. Meanwhile, Lipofectin® exhibited a largerdecrease in cell viability compared to the control cells.

3.8. Silencing effect by siRNA via electroporation

Prior to attempting HIV inhibition experiments using siRNAcomplexed with dendrimers, the efficacy of the siRNA at inhibitingHIV needed to be determined. To carry this out, HIV-infected PBMCwere subjected to treatment with siRNA via electroporation. As a

Fig. 3. Cytotoxicity of dendrimers and dendriplexes. A. LDH enzyme assay of SupT1 after3 h incubation with varying concentrations of 2G-NN16 dendrimer either alone (○) orcomplexed with 250 nM siRNA (●). B. MTT assay of SupT1 (gray bars) and PBMC (whitebars) 20 h after being treated with siRNA alone or dendriplex. C. Flow cytometry resultsreveal cell viability for SupT1 cells at both 3 h (○, dendriplex; Δ, 2G-NN16 alone) and24 h (●, dendriplex; ▲, 2G-NN16 alone). D. Cell proliferation rates for dendriplex onSupT1 at 20 h and 48 h. E. Absolute SupT1 cell numbers 96 h after treatment withdendrimer, dendriplex or Lipofectin®.

Fig. 5. Complete internalization of siRNA into T cells. Confocal microscopy images ofSupT1 cells after 20 h incubation with mock treatment (A) or with Cy3-labeled siRNA(red) alone (B) or complexed with 2G-NN16 at a +/− ratio of 1 (C) or 2 (D). Cellmembranes are labeled with αCD45-FITC antibodies (green). Percentages of positivecells for siRNA uptake are indicated.

GENEDELIVERY

60 N. Weber et al. / Journal of Controlled Release 132 (2008) 55–64

control for siRNA entrance and function, we performed parallel expe-riments with uninfected SupT1 cells that were electroporated withsiRNA targeted to the housekeeping gene GAPDH. Flow cytometrydata showed that electroporation resulted in successful transfection offluorochrome-labelled siRNA (data not shown). Furthermore, thesiRNA was seen to be functional as cells electroporated with GAPDHsiRNA (siGAPDH) exhibited up to 80% silencing. The GAPDH knock-down was seen to be sequence-specific and dependent on siRNAconcentration. This was determined as points treated with less than250 nM siGAPDH never achieved greater than 50% knockdown while250 and 500 nM siGAPDH achieved 70% and 89% knockdown, respect-ively while a negative control siRNA of random sequence (siRandom)had either no effect or a very slight effect on GAPDH expression(Fig. 7A). Additionally, the silencing affect was seen to last up to 6 days(Fig. 7B).

Next, it was determined if this same effect could be achieved inHIV-infected PBMC via electroporation. Results showed from 50% to80% inhibition for 500 nM of a siRNA targeted to the HIV p24 gene(siP24) and up to 85% inhibition when targeted to the HIV gag gene(siGAG1) compared to mock treated cells (Fig. 7C). Furthermore, therewas a difference of at least 40% between cells treated with siGAG1 andthose treated with siRandom for all time points. This indicates asequence-specific inhibition of HIV for siRNA at this concentration. At3 times the siRNA concentration, there was no improvement in viralinhibition (data not shown). Because of these results, siRNA concen-trations were limited to between 250 nM and 500 nM for all furtherHIV inhibition experiments.

3.9. siRNA activity when delivered by 2G-NN16

With the efficacy of siRNA at GAPDH knockdown and inhibition ofHIV demonstrated via electroporation, GAPDH silencing and HIV

Fig. 4.Histograms show successful transfection by dendriplex. Transfection efficiency isshown by flow cytometry of SupT1 cells 3 h after treatment with siRNA or dendriplexes(A) (+/− charge ratio indicated in parentheses) and overlay plots for all samples at both 3(B) and 24 h (C). 500 nM siRNA for all points.

61N. Weber et al. / Journal of Controlled Release 132 (2008) 55–64

GENEDELIVERY

inhibition experiments were next carried out with dendriplexes of 2G-NN16. Naked siRNAwas also tested for biological effect, and Lipofectin®was used as a comparative control. Expression of GAPDH in normalSupT1 cells was shown to be reduced in a sequence-specific way whenthe cells were treatedwith naked, Lipofectin®-delivered, and 2G-NN16-delivered siRNA (45, 46, and 47%, respectively) (Fig. 8A–C). siRNA wasalso able to inhibit HIV when bound to 2G-NN16. Inhibition wasachieved by both siRNA targeted to the HIV nef gene (siNEF) and acocktail mixture of the three siRNAs siP24, siGAG1 and siNEF (siCOCK-TAIL) (15 and 22%, respectively) compared to control cells (Fig. 8D). Tofurther investigate theHIV inhibitoryeffect, dendriplexes at different +/−charge ratios along with naked siRNA and were tested on HIV-infectedPBMC. An inhibition of 25% is seen for siNEF and nearly 40% forsiCOCKTAILwhen bound to 2G-NN16 at a +/− charge ratio of 2 comparedto control cells (Fig. 8E). The inhibition obtained with a +/− ratio of 2 isbetter than for a +/− ratio of 1 or naked siRNA. Moreover, LDH assays forthese experiments show that the treatments cause minimal toxicity.

4. Discussion

The goal of bringing such gene therapy techniques as RNAinterference and siRNA to the fight against HIV infection holds a greatdeal of promise. Themainhurdle to overcome inutilizing thesepowerfultools appears to be delivery and transfection of the infected cells.Dendrimers have long been investigated as a possible solution to this

Fig. 7. Electroporationdemonstratesefficacyof siRNAagainst ahousekeepingorHIVgenes.A. SupT1 cells electroporated with siRNA at increasing concentrations show increasinglevels of GAPDH knockdown (siGAPDH □) compared to siRNA of random sequence(siRandom ■). B. The GAPDH knockdown effect was sequence-specific and continued upthrough 6 days. C. Similar biological effect was seen with siRNA targeted to the HIV genesp24 and gag for HIV-infected cells electroporated with 500 nM of the siRNA siP24 (□) andsiGAG1 (◊) when compared to siRandom (▲) and mock treated cells (●).

Fig. 6. Transfection and toxicity profiles of dendriplexes on HIV-infected T cells.Dendriplex at varying +/− charge ratios after 3 h incubation (A) and 24 h incubation (B).Toxicity was measured by LDH enzyme release, while transfection and cell viability wasmeasured by flow cytometry. Lipofectin® was used as a comparative control for bothtoxicity and transfection.

issue [28]. Apart from being monodisperse nanostructures capable ofstably binding oligonucleotides, the method in which they aresynthesized offers a great deal of flexibility in their design [29].Variations in size, generation, and charge density can be made to

GENEDELIVERY

62 N. Weber et al. / Journal of Controlled Release 132 (2008) 55–64

optimize each dendrimer for each particular task. Furthermore,functional groups can be attached or imbedded to improve particularcharacteristics of the dendrimer or add additional functionalities (e.g.

Fig. 8. Sequence-specific silencing of GAPDH or HIV by siRNA in SupT1 and PBMC cells.(A) Naked siRNA, (B) Lipofectin® delivered, and (C) 2G-NN16 delivered siRNA allachieved sequence-specific silencing of GAPDH in SupT1. (D) A similar sequence-specific inhibition of HIV in infected SupT1 cells was obtained for siNEF siRNA andsiCOCKTAIL when delivered to SupT1 cells by 2G-NN16. (E) Inhibition of HIV in PBMCafter 24 h incubation with dendriplexes at varying +/− charge ratios with siNEF (blackbars) and siCOCKTAIL (grey bars). Toxicity values as measured by LDH enzyme releaseafter 3 h incubation are shown (white bars). Data are shown as mean±SEM; n=3.

targeting moieties, stabilizing or transfection enhancing groups, etc.)[15,30,31]. The carbosilane dendrimers characterized here have beensynthesized and screened to (1) stably bind oligonucleotides and siRNA,(2) be soluble in water, and (3) offer a time-delayed liberation of theirload due to gradual hydrolysis of the interior carbon–silicon bonds.Furthermore, their capability of protecting the siRNA from RNase is offundamental importance for the siRNA to be able to exert an effect oncein the interior of the cell [32]. Previously, we found that CBS similarlyprotect oligonucleotides from sequestration and degradation by serumproteins [33] and [34]. Starting froma foundationof positive preliminaryresults such as the ones reported here, further designs can be made toimprove the structures such as adding functional groups in order todirect the dendriplex to the target cells, improve their capability ofcrossing the plasma membrane, and improve their stability andbiocompatibility in vivo.

Results from the cytotoxicity assays with the dendriplex clearlydemonstrate its low toxicity at concentrations necessary for treat-ments of 500 nM siRNA. This siRNA dosage proved to be enough toachieve 80% HIV inhibition via electroporation and 40% using thedendrimer. The fact that the necessary siRNA concentration to observean effect for these cells is higher than what is recommended for RNAiexperiments in more conventional systems such as adherent cells islikely because of the difficulty in transfecting primary or establishedsuspension cells. The cytotoxicity results show that the dendriplexcauses less toxicity than the dendrimer alone. Non-complexed den-drimer without the neutralizing presence of siRNA has all of itspositively charged groups exposed. This indicates that the toxicity ismost likely a result of the high positive charge density, an attributethat can be improved upon or shielded through the use of stabilizingmoieties like PEG [35]. On top of the good cytotoxicity profile, thedendriplex distinguishes itself from other transfection agents likeLipofectin® in that it functions in medium containing serum andantibiotics while with Lipofectin® these additives must be removed.This is a fundamental advantage that will allow dendrimers to makethe transition to in vivo scenarios.

A substantial problem in investigating gene therapy or RNAi in thefight against HIV lies in the fact that practically all HIV-susceptible cellsare very difficult to transfect. To overcome the inherent difficulties intransfecting suspension T cell lines or primary cell cultures such asPBMC, investigators have made use of innovative techniques such asnucleofection [36] or antibody fused proteins [37]. Confocal micro-scopy images indicate uptake of siRNA by T lymphocytes via ourtransfection method. Moreover, the similarity of the compartmenta-lized fluorescent siRNA with perinuclear endosomes in terms ofmorphologyand spatial localization indicate the possibility of entrancevia endocytosis. In several polarized T cells seen in the Supplementaryvideo (Vid. S2), fluorescence appears clearly accumulated in theuropod. This peculiar localization only occurs inpolarized lymphocytes[38], offering further evidence of endocytosis. Even though the exactinternalization pathway has not yet been determined, it is most likelythat the pathway is mediated by internal vesicle formation.

The fact that we observed complete entrance of naked siRNA in theprimary cells within 24 h and almost immediately in the established cellline merits attention. This is not the first time that we have noticed thisoccurrence as we also observed the uptake of free oligonucleotides inPBMC [39]. It can be assumed that the small size of the siRNA andantisense oligonucleotides is the determining factor in their uptakesince we have not witnessed the entrance of larger plasmids by

63N. Weber et al. / Journal of Controlled Release 132 (2008) 55–64

GENEDELIVERY

themselves (data not shown). Regardless of their uptake by these cells,naked siRNA and oligonucleotideswould facemore significant obstaclesin the in vivo setting, precisely forwhich our dendrimers are designed toovercome. The design of the CBS not only intends to improve trans-fection efficiency, stability and protection in vivo, but also to possess atime-dependent release capability [23]. The timetable for the degrada-tion of the silicon–oxygen bonds of the dendrimer branches (4–24 h)will theoretically result in the liberation of the cargo after it has beendelivered and transfected into the target cells and has proceededthrough the endocytotic pathway allowing the siRNA to carry out itsbiological activity.

Currently there exist many limits in the overall efficacy of currentHIV therapy because of the ability of HIV to develop drug resistantstrains. Likewise, viral latency is a significant problem when address-ing treatment for HIV infection [40,41]. RNAi could potentiallyimprove this weakness in HIV therapy by attacking very specifictargets of the viral life cycle, reducing the opportunities for theemergence of resistant strains, andmaking use of a cocktail of siRNA toattack the virus on multiple fronts. As we have shown, a mixture ofseveral siRNA targeted specifically to the virus resulted in aninhibitory effect of nearly 40%. This inhibition was achieved by onlytargeting a mixture of HIV genes, however the possibility of com-bining siRNA targeted to HIV with other siRNA designed to down-regulate endogenous cellular genes essential for HIV replication couldfeasibly improve results. Furthermore, dendriplexes could be utilizedto selectively target HIV-infected cells or harbors of latently infectedcell pools. Taking everything into consideration, the stability andprotection provided by 2G-NN16, its relatively low cytotoxicitycompared to other dendrimers [42–44] and delivery systems, alongwith its high transfection efficiency could make CBS delivered siRNA apossible candidate for new HIV therapies.

Acknowledgments

Potential conflicts of interest: The authors do not have commercialor other associations that might pose a conflict of interest.

Sources of financial support: Thiswork has been supported bygrantsfrom Fondos de Investigación Sanitaria (FIS) del Ministerio de Sanidady Consumo (PI052476, PI061479); Red RIS RD06-0006-0035; FIPSE(36514/05, 24534/05, 24632/07), ERA-NET NAN2007-31198-E; Funda-ción Caja Navarra and Comunidad de Madrid (S-SAL-0159-2006).

We would like to thank Rafael Samaniego for assistance withconfocal microscopy imaging.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.jconrel.2008.07.035.

References

[1] E. De Clercq, AIDS in the ThirdWorld: how to stop the HIV infection? Verh. K. Acad.Geneeskd. Belg. 69 (2) (2007) 65–80.

[2] M.A. Kolber, Development of drug resistancemutations in patients on highly activeantiretroviral therapy: does competitive advantage drive evolution, AIDS Rev. 9 (2)(2007) 68–74.

[3] P.A. Sharp, RNA interference—2001, Genes Dev. 15 (5) (2001) 485–490.[4] G.A. Coburn, B.R. Cullen, siRNAs: a newwave of RNA-based therapeutics, J. Antimicrob.

Chemother. 51 (4) (2003) 753–756.[5] S.K. Singh, RNA interference and its therapeutic potential against HIV infection,

Expert. Opin. Biol. Ther. 8 (4) (2008) 449–461.[6] D.M. Dykxhoorn, C.D. Novina, P.A. Sharp, Killing the messenger: short RNAs that

silence gene expression, Nat. Rev. Mol., Cell Biol. 4 (6) (2003) 457–467.[7] M.T. Lee, G.A. Coburn, M.O. McClure, B.R. Cullen, Inhibition of human immuno-

deficiency virus type 1 replication in primary macrophages by using Tat- or CCR5-specific small interfering RNAs expressed from a lentivirus vector, J. Virol. 77 (22)(2003) 11964–11972.

[8] W. Han, M. Wind-Rotolo, R.L. Kirkman, C.D. Morrow, Inhibition of humanimmunodeficiency virus type 1 replication by siRNA targeted to the highlyconserved primer binding site, Virology 330 (1) (2004) 221–232.

[9] C.D. Novina, M.F. Murray, D.M. Dykxhoorn, P.J. Beresford, J. Riess, S.K. Lee, R.G.Collman, J. Lieberman, P. Shankar, P.A. Sharp, siRNA-directed inhibition of HIV-1infection, Nat. Med. 8 (7) (2002) 681–686.

[10] H. Nishitsuji, M. Kohara, M. Kannagi, T. Masuda, Effective suppression of humanimmunodeficiency virus type 1 through a combination of short- or long-hairpinRNAs targeting essential sequences for retroviral integration, J. Virol. 80 (15)(2006) 7658–7666.

[11] R.J. Pomerantz, RNA interferencemeets HIV-1: will silence be golden? Nat.Med. 8 (7)(2002) 659–660.

[12] J.J. Turner, M. Fabani, A.A. Arzumanov, G. Ivanova, M.J. Gait, Targeting the HIV–1RNA leader sequence with synthetic oligonucleotides and siRNA: chemistry andcell delivery, Biochim. Biophys. Acta. 1758 (3) (2006) 290–300.

[13] Y.P. Liu, J. Haasnoot, O. Ter Brake, B. Berkhout, P. Konstantinova, Inhibition of HIV-1by multiple siRNAs expressed from a single microRNA polycistron, Nucleic AcidsRes. 36 (9) (2008) 2811–2824.

[14] E. Song,P. Zhu, S.K. Lee,D. Chowdhury, S. Kussman,D.M.Dykxhoorn, Y. Feng,D. Palliser,D.B. Weiner, P. Shankar, W.A. Marasco, J. Lieberman, Antibody mediated in vivodelivery of small interfering RNAs via cell-surface receptors, Nat. Biotechnol. 23 (6)(2005) 709–717.

[15] I.S. Zuhorn, D. Kalicharan, G.T. Robillard, D. Hoekstra, Adhesion receptors mediateefficient non-viral gene delivery, Mol. Ther. 15 (5) (2007) 946–953.

[16] B. Ma, S. Zhang, H. Jiang, B. Zhao, H. Lv, Lipoplex morphologies and their influenceson transfection efficiency in gene delivery, J. Control. Release 123 (3) (2007) 184–194.

[17] R.I. Mahato, Water insoluble and soluble lipids for gene delivery, Adv. Drug Deliv.Rev. 57 (5) (2005) 699–712.

[18] A. Hirko, F. Tang, J.A. Hughes, Cationic lipid vectors for plasmid DNA delivery, Curr.Med. Chem. 10 (14) (2003) 1185–1193.

[19] D. Niculescu-Duvaz, J. Heyes, C.J. Springer, Structure-activity relationship in cationiclipid mediated gene transfection, Curr. Med. Chem. 10 (14) (2003) 1233–1261.

[20] E. Imai, Gene therapy approach in renal disease in the 21st century, Nephrol. Dial.Transplant. 16 (Suppl 5) (2001) 26–34.

[21] Y. Yang, Q. Li, H.C. Ertl, J.M. Wilson, Cellular and humoral immune responses toviral antigens create barriers to lung-directed gene therapy with recombinantadenoviruses, J. Virol. 69 (4) (1995) 2004–2015.

[22] P. Ortega, J.F. Bermejo, L. Chonco, E. de Jesus, F.J. de laMata, G. Fernández, J.C. Flores,R. Gómez, M.J. Serramía, M.A. Muñoz-Fernandez, Novel water-soluble carbosilanedendrimers: synthesis and biocompatibility, Eur. J. Inorg. Chem. (7) (2006)1388–1396.

[23] J.F. Bermejo, P. Ortega, L. Chonco, R. Eritja, R. Samaniego, M. Mullner, E. de Jesus, F.J.de la Mata, J.C. Flores, R. Gomez, A. Munoz-Fernandez, Water-soluble carbosilanedendrimers: synthesis biocompatibility and complexation with oligonucleotides;evaluation for medical applications, Chemistry 13 (2) (2007) 483–495.

[24] E. Song, S.K. Lee, D.M. Dykxhoorn, C. Novina, D. Zhang, K. Crawford, J. Cerny, P.A.Sharp, J. Lieberman, N. Manjunath, P. Shankar, Sustained small interfering RNA-mediated human immunodeficiency virus type 1 inhibition in primary macro-phages, J. Virol. 77 (13) (2003) 7174–7181.

[25] J. Capodici, K. Kariko, D. Weissman, Inhibition of HIV-1 infection by smallinterfering RNA-mediated RNA interference, J. Immunol. 169 (9) (2002)5196–5201.

[26] A.T. Das, T.R. Brummelkamp, E.M. Westerhout, M. Vink, M. Madiredjo, R. Bernards,B. Berkhout, Human immunodeficiency virus type 1 escapes from RNAinterference-mediated inhibition, J. Virol. 78 (5) (2004) 2601–2605.

[27] D. Fischer, Y. Li, B. Ahlemeyer, J. Krieglstein, T. Kissel, In vitro cytotoxicity testing ofpolycations: influence of polymer structure on cell viability and hemolysis,Biomaterials 24 (7) (2003) 1121–1131.

[28] C. Dufes, I.F. Uchegbu, A.G. Schatzlein, Dendrimers in gene delivery, Adv. Drug.Deliv. Rev. 57 (15) (2005) 2177–2202.

[29] U. Boas, P.M. Heegaard, Dendrimers in drug research, Chem. Soc. Rev. 33 (1) (2004)43–63.

[30] C.M. Paleos, D. Tsiourvas, Z. Sideratou, Molecular engineering of dendriticpolymers and their application as drug and gene delivery systems, Mol. Pharm.4 (2) (2007) 169–188.

[31] S. Svenson, D.A. Tomalia, Dendrimers in biomedical applications—reflections onthe field, Adv. Drug. Deliv. Rev. 57 (15) (2005) 2106–2129.

[32] S. Mao, M. Neu, O. Germershaus, O. Merkel, J. Sitterberg, U. Bakowsky, T. Kissel,Influence of polyethylene glycol chain length on the physicochemical andbiological properties of poly(ethylene imine)-graft-poly(ethylene glycol) blockcopolymer/SiRNA polyplexes, Bioconjug. Chem. 17 (5) (2006) 1209–1218.

[33] L. Chonco, J.F. Bermejo-Martin, P. Ortega, D. Shcharbin, E. Pedziwiatr, B. Klajnert, F.J.de la Mata, R. Eritja, R. Gomez, M. Bryszewska, M.A. Munoz-Fernandez, Water-soluble carbosilane dendrimers protect phosphorothioate oligonucleotides frombinding to serum proteins, Org. Biomol. Chem. 5 (12) (2007) 1886–1893.

[34] D. Shcharbin, E. Pedziwiatr, L. Chonco, J.F. Bermejo-Martin, P. Ortega, F.J. de laMata,R. Eritja, R. Gomez, B. Klajnert, M. Bryszewska, M.A. Munoz-Fernandez, Analysis ofinteraction between dendriplexes and bovine serum albumin, Biomacromolecules8 (7) (2007) 2059–2062.

[35] O. Germershaus, S. Mao, J. Sitterberg, U. Bakowsky, T. Kissel, Gene delivery usingchitosan, trimethyl chitosan or polyethylenglycol-graft-trimethyl chitosan blockcopolymers: establishment of structure-activity relationships in vitro, J. Control.Release 125 (2) (2008) 145–154.

[36] J. Yin, Z. Ma, N. Selliah, D.K. Shivers, R.Q. Cron, T.H. Finkel, Effective gene suppressionusing small interfering RNA in hard-to-transfect human T cells, J. Immunol. Methods312 (1–2) (2006) 1–11.

[37] D. Peer, P. Zhu, C.V. Carman, J. Lieberman, M. Shimaoka, Selective gene silencing inactivated leukocytes by targeting siRNAs to the integrin lymphocyte function-associated antigen-1, Proc. Natl. Acad. Sci. U. S. A. 104 (10) (2007) 4095–4100.

GENEDELIVERY

64 N. Weber et al. / Journal of Controlled Release 132 (2008) 55–64

[38] R. Samaniego, L. Sanchez-Martin, A. Estecha, P. Sanchez-Mateos, Rho/ROCK andmyosin II control the polarized distribution of endocytic clathrin structures at theuropod of moving T lymphocytes, J Cell Sci 120 (Pt 20) (2007) 3534–3543.

[39] J.F. Bermejo, L. Chonco, R. Samaniego, G. Fernandez, R. Eritja, M.A. Munoz-Fernandez, Comparative uptake of phosphorothioate oligonucleotides by humanperipheral blood mononuclear cells from newborns and adults, Eur. J. Sci. Res. 15(2006) 113–121.

[40] D. Persaud, Y. Zhou, J.M. Siliciano, R.F. Siliciano, Latency in human immunodefi-ciency virus type 1 infection: no easy answers, J. Virol. 77 (3) (2003) 1659–1665.

[41] D. Finzi, J. Blankson, J.D. Siliciano, J.B.Margolick, K. Chadwick, T. Pierson, K. Smith,J. Lisziewicz, F. Lori, C. Flexner, T.C. Quinn, R.E. Chaisson, E. Rosenberg, B. Walker,S. Gange, J. Gallant, R.F. Siliciano, Latent infection of CD4+ T cells provides a

mechanism for lifelong persistence of HIV-1, even in patients on effectivecombination therapy, Nat. Med. 5 (5) (1999) 512–517.

[42] T. Dutta, H.B. Agashe, M. Garg, P. Balasubramanium, M. Kabra, N.K. Jain, Poly(propyleneimine) dendrimer based nanocontainers for targeting of efavirenz tohuman monocytes/macrophages in vitro, J. Drug Target. 15 (1) (2007) 89–98.

[43] R. Duncan, L. Izzo, Dendrimer biocompatibility and toxicity, Adv. Drug Deliv. Rev.57 (15) (2005) 2215–2237.

[44] L.A. Tziveleka, A.M. Psarra, D. Tsiourvas, C.M. Paleos, Synthesis and characteriza-tion of guanidinylated poly(propylene imine) dendrimers as gene transfectionagents, J. Control. Release 117 (1) (2007) 137–146.