Characterization of a Novel Two-Component Regulatory System,HptRS, the Regulator for the Hexose Phosphate Transport System inStaphylococcus aureus

Joo Youn Park,a Jong Wan Kim,b Bo Youn Moon,a,c Juyeun Lee,a Ye Ji Fortin,a Frank W. Austin,a Soo-Jin Yang,d,e Keun Seok Seoa

Department of Basic Sciences, College of Veterinary Medicine, Mississippi State University, Mississippi State, Mississippi, USAa; Animal Diseases Diagnostic Division,Quarantine and Inspection Agency, Anyang, Gyeonggi, Republic of Koreab; Department of Microbiology, College of Veterinary Medicine, Seoul National University, Seoul,Republic of Koreac; Division of Infectious Diseases, Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center, Torrance, California, USAd; The David GeffenSchool of Medicine at UCLA, Los Angeles, California, USAe

Hexose phosphate is an important carbon source within the cytoplasm of host cells. Bacterial pathogens that invade, sur-vive, and multiply within various host epithelial cells exploit hexose phosphates from the host cytoplasm through thehexose phosphate transport (HPT) system to gain energy and synthesize cellular components. In Escherichia coli, the HPTsystem consists of a two-component regulatory system (UhpAB) and a phosphate sensor protein (UhpC) that tightly regulateexpression of a hexose phosphate transporter (UhpT). Although growing evidence suggests that Staphylococcus aureus also caninvade, survive, and multiply within various host epithelial cells, the genetic elements involved in the HPT system in S.aureus have not been characterized yet. In this study, we identified and characterized the HPT system in S. aureus that includesthe hptRS (a novel two-component regulatory system), the hptA (a putative phosphate sensor), and the uhpT (a hexosephosphate transporter) genes. The hptA, hptRS, and uhpT markerless deletion mutants were generated by an allelic re-placement method using a modified pMAD-CM-GFPuv vector system. We demonstrated that both hptA and hptRS are re-quired to positively regulate transcription of uhpT in response to extracellular phosphates, such as glycerol-3-phosphate(G3P), glucose-6-phosphate (G6P), and fosfomycin. Mutational studies revealed that disruption of the hptA, hptRS, oruhpT gene impaired the growth of bacteria when the available carbon source was limited to G6P, impaired survival/multi-plication within various types of host cells, and increased resistance to fosfomycin. The results of this study suggest thatthe HPT system plays an important role in adaptation of S. aureus within the host cells and could be an important targetfor developing novel antistaphylococcal therapies.

Staphylococcus aureus is a major human pathogen that causes adiverse array of diseases in nosocomial and community-ac-

quired settings, ranging from superficial skin infections to severediseases, such as endocarditis, septicemia, and necrotizing pneu-monia (1). S. aureus adapts extremely well to various environmen-tal conditions and hosts by regulating expression of colonizationfactors, such as microbial surface components recognizing adhe-sive matrix molecules (MSCRAMM), and virulence factors, suchas cytotoxins, proteases, and superantigens. Expression of thesefactors is regulated by global transcriptional regulatory systems,such as sigma factors (�B), SarA, Rot, and MgrA, and two-com-ponent regulatory systems (TCSs) (2–5). A TCS is a signal trans-duction system in bacteria, consisting of a membrane-bound sen-sor histidine kinase and a corresponding cytoplasmic responseregulator that enables bacteria to sense, respond, and adapt to awide range of environmental stresses, such as oxygen, pH, andosmolarity, as well as antibiotic challenges. Within the various S.aureus strains for which the genome has been sequenced, 16 to 18TCSs were identified (6). Of these TCSs, 12 TCSs have been char-acterized mainly with respect to their role in regulating expressionof virulence factors and adaptation to environmental stress con-ditions, including AgrCA and SaeRS, which regulate virulence fac-tors (3), ArlRS and LytSR, which regulate autolysis (7, 8), WalKR,GraRS, and VraRS, which regulate cell wall synthesis (9–11),HssRS, which regulates iron acquisition (12), NreBC, which reg-ulates nitrogen sensing (13), SrrAB and AirRS, which regulateoxygen sensing (14, 15), and BraRS, which regulates bacitracin

resistance (16). However, relatively little is known about the roleof TCSs on nutritional challenges.

Sugar uptake is an essential process for microorganisms togain energy and synthesize cellular compartments. The trans-port of sugar into bacterial cells is mediated by the phosphoe-nolpyruvate phosphotransferase system (PTS) (17) and bynon-PTS mechanisms, such as the hexose phosphate transport(HPT) system.

Bacterial pathogens can survive and multiply within varioushost epithelial cells by exploiting nutrients available within thehost cytoplasm, such as hexose phosphates, through the HPT sys-tem (18, 19). The HPT system has been well characterized in Esch-

Received 18 December 2014 Returned for modification 6 January 2015Accepted 30 January 2015

Accepted manuscript posted online 2 February 2015

Citation Park JY, Kim JW, Moon BY, Lee J, Fortin YJ, Austin FW, Yang S-J, Seo KS.2015. Characterization of a novel two-component regulatory system, HptRS, theregulator for the hexose phosphate transport system in Staphylococcus aureus.Infect Immun 83:1620 –1628. doi:10.1128/IAI.03109-14.

Editor: L. Pirofski

Address correspondence to Keun Seok Seo, seo@cvm.msstate.edu.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/IAI.03109-14.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/IAI.03109-14

1620 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on Novem

ber 20, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

erichia coli, where it is composed of a two-component regulatorysystem (UhpAB) (18), a phosphate sensor protein (UhpC) (20),and a hexose phosphate transporter (UhpT) (21). UhpC is re-quired to sense extracellular hexose phosphates, resulting in auto-phosphorylation of a conserved histidine residue in the cytoplas-mic domain of UhpB. Subsequently, a phosphoryl group istransferred to a conserved aspartic acid residue in the responseregulator domain of UhpA, which activates transcription of uhpT(22). UhpT is a hexose phosphate transporter that exchanges in-tracellular phosphate for extracellular hexose phosphate and fos-fomycin (23).

Although there is growing evidence that S. aureus can surviveand multiply within various types of host epithelial cells (24), littleis known about the mechanism by which S. aureus adapts to in-tracellular conditions that are nutritionally limited to host cellmetabolites. In this study, we characterized the HPT system in S.aureus, encoded by the SAUSA300_0216, SAUSA300_0217,SAUSA300_0218, and SAUSA300_0219 genes. We demonstratedthat transcription of a hexose phosphate transporter, UhpT, en-coded by SAUSA300_0216, is regulated by a novel TCS, HptRS,encoded by SAUSA300_0217 and SAUSA300_0218, and by aphosphate-sensing protein, HptA, encoded by SAUSA300_0219.We demonstrated that the HPT system is important to supportintracellular survival/multiplication of S. aureus, where the car-bon source is limited to hexose phosphate and affects the sensitiv-ity to fosfomycin.

MATERIALS AND METHODSBacterial strains, plasmids, and growth conditions. All strains used inthis study are listed in Table 1. All S. aureus strains were cultured inMueller-Hinton II (MH2) broth or agar (BBL Becton Dickinson) supple-mented with chloramphenicol (10 �g/ml) when necessary. All E. coliDH5� strains were cultured in Luria-Bertani (LB) broth or agar (BBLBecton Dickinson) supplemented with ampicillin (100 �g/ml) when nec-essary.

Construction of S. aureus deletion mutants. The gene deletion mu-tants were generated by allelic replacement using a modified pMAD-CMtemperature-sensitive shuttle vector system. To enhance the screeningprocesses without an antibiotic selection marker, to thereby generate a

markerless deletion mutant, the promoter region of the lactate dehydro-genase gene from Listeria monocytogenes was joined to the coding regionof the GFPuv gene (Clontech) by overlapping PCR using primers listedin Table 2 and cloned between BglII and StuI sites in pMAD-CM (25),which resulted in pMAD-CM-GFPuv. To generate deletion mutants,the upstream and downstream flanking regions of hptA, hptRS, oruhpT were amplified from S. aureus LAC chromosomal DNA usingprimers listed in Table 2 and cloned between the BamHI/SalI andEcoRI/BglII sites, respectively, in pMAD-CM-GFPuv. The plasmidswere constructed in E. coli DH5� and then transferred to S. aureusRN4220 prior to electroporation into S. aureus LAC by using electro-poration, as described previously (25). Constructed strains were cul-tured on MH2 plates containing chloramphenicol at a nonpermissiveplasmid replication temperature of 43°C overnight to promote the firstrecombination event. A single colony was transferred to MH2 brothand cultured at 37°C overnight to promote the second recombinationevent. The mutant candidate, showing the GFPuv-negative and chlor-amphenicol-sensitive phenotypes, was screened by PCR using theprimers listed in Table 2 and DNA sequencing analysis. To comple-ment the gene deletions, gene fragments from 500 bp upstream of thestart codon containing the putative promoter regions along with eachopen reading frame were amplified by PCR using primers listed inTable 2 and cloned into the shuttle plasmid, pMK4 vector (26).

Growth analysis. Chemically defined medium (CDM) was preparedas described previously (27). Overnight cultures from MH2 broth werewashed three times with MH2 broth or CDM supplemented with a singlecarbon source (glucose, glycerol-3-phosphate [G3P], or glucose-6-phos-phate [G6P]; 0.5%, wt/vol) and adjusted to an optical density at 600 nm(OD60) of 0.01. Cells were cultured at 37°C with shaking at 200 rpm, andbacterial growth was monitored by measuring OD600 using a Genesys 20spectrophotometer (Thermo Spectronic).

Quantitative real-time PCR (qRT-PCR). To measure transcriptionalchanges in the uhpT, glpT, and glcU genes in response to various nutri-tional conditions, strains were cultured in various nutritional conditionsas described above. To measure transcriptional changes in the genes re-lated to fosfomycin resistance, overnight cultures from MH2 broth werewashed three times and adjusted to an OD600 of 0.5 with MH2 broth orCDM supplemented with a single carbon source as described above in thepresence of fosfomycin (128 �g/ml) for 6 h. Bacterial cells were harvestedby centrifugation, and total RNA was isolated from the cell pellets using

TABLE 1 Strains and plasmids

Strain or plasmid DescriptionReferenceor source

StrainsS. aureus

RN4220 Cloning intermediate derived from 8325-4 45USA300 LAC USA300 wild-type reference strain�HptA mutant SAUSA300_0219, hptA deletion mutant This study�HptRS mutant SAUSA300_0217 and 0218, hptR hptS double deletion mutant This study�UhpT mutant SAUSA300_0216, uhpT deletion mutant This study�HptA-Comp mutant LAC �HptA mutant complemented with pMK4-HptA This study�HptRS-Comp mutant LAC �HptRS mutant complemented with pMK4-HptRS This study�UhpT-Comp mutant LAC �HptA mutant complemented with pMK4-UhpT This study

E. coli DH5� Cloning intermediate 46

PlasmidspMAD-CM-GFPuv Allelic replacement temperature-sensitive vector This studypMK4 E. coli-S. aureus shuttle vector 26pMK4-HptA pMK4 harboring complementation of the hptA deletion This studypMK4-HptRS pMK4 harboring complementation of the hptR and hptS deletions This studypMK4-UhpT pMK4 harboring complementation of the uhpT deletion This study

Characterization of an HPT System in S. aureus

April 2015 Volume 83 Number 4 iai.asm.org 1621Infection and Immunity

on Novem

ber 20, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

FastPrep (Thermo Fisher Scientific) and RNeasy kits (Qiagen), accordingto the manufacturers’ recommendations.

For qRT-PCR, cDNA samples were generated from 1 �g of total RNAusing SuperScriptase III (Invitrogen) according to the manufacturer’s in-structions. The qRT-PCR was performed using primers listed in Table 2,Power SYBR green master mix, and the ABI 7500 real-time PCR system(Applied Biosystems) according to the manufacturer’s instructions. Real-time PCR data were analyzed using sequence detector system software(Applied Biosystems). The data were normalized by calculating thethreshold cycle (CT) of the target minus the CT of the internal control (16SRNA and gyrB) (�CT). Relative quantification of the target gene was de-termined by the comparative CT method (��CT).

Intracellular survival and multiplication assay. Human monocyticcells (THP-1) and alveolar epithelial cells (A549) were obtained fromATCC. Murine bone marrow-derived macrophages (BMDM) were pre-pared as previously described (28). Cell monolayers (�80% confluence in24-well tissue culture plates) were infected with bacteria at a multiplicityof infection (MOI) of 5 (5 bacteria per cell). After 30 min of infection, cellswere washed and treated with cell culture medium containing gentamicin(100 �g/ml) to remove extracellular bacteria. After 30 min of gentamicintreatment, cells were washed and lysed, and the numbers of intracellularbacteria were determined by plate counting (t � 0). Parallel cultures were

further maintained and harvested at the indicated time points (t � 3 h andt � 6 h). The percentage of surviving bacteria was calculated by the fol-lowing formula: (the number of bacterial cells at t � 3 or t � 6/the numberof bacteria at t � 0) � 100.

Antibiotic sensitivity assays. The MIC of fosfomycin was determinedusing a fosfomycin epsilometer test (Etest; bioMérieux) according to themanufacturer’s instructions.

Statistical analysis. Statistical significance was analyzed with the Stu-dent t test using GraphPad Prism software (GraphPad).

RESULTSIdentification of a putative hexose phosphate transport systemin S. aureus. Genome sequence analysis showed that genes encod-ing a hexose phosphate transporter, UhpT (SAUSA300_216), aputative histidine kinase (SAUSA300_217), a response regulatorprotein (SAUSA300_218), and a putative iron compound bindingprotein (SAUSA300_0219) are highly conserved in all sequencedS. aureus strains, but these genes have not been characterized yet(Fig. 1A). In silico analysis showed that the SAUSA300_216 geneencodes a putative 458-amino-acid transmembrane protein witha major facilitator superfamily 1 (MFS_1) domain showing 51%

TABLE 2 Primers used in the study

Primer name Primer sequence (5=¡3=) Source

Primers for deletion mutantsHptAupF TCCTGTCGACGGATAAACGATTGATACAG This studyHptAupR TCAGACGCGTAAGGAGATATTAAGATTCGAGG This studyHptAdnF TTGAGAATTCTACTTGAGTAGATCCGTG This studyHptAdnR CACTCCCGGGCCGTTGAATATCTTGCCG This studyHptAmF TGTTTCTGACAACACACC This studyHptRSupF GCGCGGATCCGGTGTCAATATTGTAGGGAG This studyHptRSupR GCGCGTCGACCTAATTCAACAACATCAGCC This studyHptRSdnF GCGCGAATTCGTTTAGCCATATTATCTGCG This studyHptRSdnR GCGCAGATCTGGCATACAAACCTTATAGAC This studyHptRSmF GGCACTTGATAATTACAGG This studyUhpTupF AATCGGATCCAAGGCATTCCATTATCGG This studyUhpTupR ATGTGTCGACGAATCCTAAGTATCGGCC This studyUhpTdnF TTTTGAATTCCCTGGGAAATCCTGTTAT This studyUhpTdnR TTCTAGATCTCATAGAAAGCAACGATTCCT This studyUhpTmF ATCGGTGGTGCCATAGCA This study

Primers for complementationHptAF GCGCGGATCCCATAGTCATTGTAGCATG This studyHptAR GCGCGTCGACGTCTATAAGGTTTGTATGCC This studyHptRSF GCGCGGATCCGGTGTCAATATTGTAGGGAG This studyHptRSR AAAGGTCGACAGTTGCTTCTGTTGGTCC This studyUhpTF GCGCGGATCCCGTACATATAAGAAATAC This studyUhpTR GCGCGTCGACCTCCCTACAATATTGACACC This study

Primers for real-time PCRRT-UhpTF TGGATATTTTGTCGATGGACGTA This studyRT-UhpTR ACCCCGTTAAGTCCCCAAAG This studyRT-GlpTF TGATTGGGCGCCAGTCTACT This studyRT-GlpTR GGTCCACGACGACCTTTGAA This studyRT-GlcUF TCTTAATCGCACTTTTACCTGCTTT This studyRT-GlcUR GAGTGCGCCTAGCGTCGTA This studyRT-BshAF AGGCGTCGTTCCAATTGG This studyRT-BshAR CGACAAATCCAGTTTCACCATGT This studyRT-MurAF CGAAAATGCTGTTGTCGTTGA This studyRT-MurAR GCACAACCACCAGGCAATG This studyRT-FosBF GCGAATTTAAATATTGGCATCAGA This studyRT-FosBR CAGGGTCGGTAAAGTAAATTGATTG This study

Park et al.

1622 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on Novem

ber 20, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

identities and 67% positive matching with the UhpT in E. coli. TheSAUSA300_0217 gene encodes a putative 252-amino-acid proteinwith a response regulator receiver domain at the N terminus anda helix-turn-helix domain at the C terminus, which are typi-cally associated with a response regulator in TCSs (29). TheSAUSA300_0218 gene encodes a putative 518-amino-acid proteinwith a histidine kinase domain and a histidine kinase-type ATPasecatalytic (HATPase_c) domain at the C terminus, which are typ-ically associated with a sensor protein in TCSs (29). TheSAUSA300_0219 gene encodes a putative 323-amino-acid proteinwith a bacterial extracellular solute binding protein 2 (SBP II)domain, which potentially can interact with a phosphonate (30).These results suggested that the SAUSA300_216, 217, 218, and219 genes may represent the HPT system in S. aureus, similar touhpABCT in E. coli. Based on this assumption, we refer here to thisputative TCS (SAUSA300_0218 and 0217) as the hexose phos-phate transporter regulation system (HptRS), a putative ironcompound binding protein (SAUSA300_0219) as HptA, and ahexose phosphate transporter as UhpT (SAUSA300_216).

The HPT system is required for growth under nutritionalconditions specifically limited to G6P. To determine the func-tion of HptA, HptRS, and UhpT, we generated deletion mutantsof HptA (�HptA mutant), HptRS (�HptRS mutant), and UhpT(�UhpT mutant) by an allelic replacement method using a mod-ified temperature-sensitive pMAD-CM-GFPuv vector system, anefficient approach for generating and screening a markerless de-letion mutant, and a corresponding complement strain usingpMK4, in the S. aureus LAC strain background (Fig. 1B). To ana-

lyze the function of HptA, HptRS, and UhpT in carbohydratemetabolism, the growth of the wild-type, mutants, and com-plemented strains in various nutritional conditions was mea-sured. When cultured in MH2 broth, the growth of wild-typeand mutant strains was not affected (Fig. 2A). In contrast,when cultured in CDM supplemented with glucose-6-phos-phate (G6P) as a sole carbon source, the growth of the �HptA,�HptRS, and �UhpT strains was significantly inhibited com-pared to that of the wild type (Fig. 2B), and the complementedmutant strains restored the growth (see Fig. S2 in the supple-mental material). When cultured in CDM supplemented withglucose or glycerol-3-phosphate (G3P), the growth of the wildtype and mutants was not affected (Fig. 2C and D). These re-sults indicated that the hptA, hptRS, and uhpT genes are re-quired for growth under nutrition-limited conditions, espe-cially when G6P is the sole carbon source.

The hptA and hptRS genes are required for transcriptionalactivation of uhpT in response to extracellular G6P or G3P asthe sole carbon source. To determine whether the hptA and hptRSgenes regulate transcription of the uhpT gene, as in E. coli, wedetermined the transcriptional profiles of the uhpT gene in vari-ous nutritional conditions by using qRT-PCR. When cultured inMH2 broth, transcription of the uhpT gene was not significantlydifferent in the wild-type, mutant, and complemented strains(Fig. 3A; see also Fig. S1A in the supplemental material). In con-trast, when cultured in CDM supplemented with G6P as the solecarbon source, transcription of the uhpT gene in the wild-type andcomplemented strains significantly increased (approximately 18-fold), but not in the �HptA or �HptRS strains, compared to theresult obtained from the MH2 culture (Fig. 3B; see also Fig. S1B).Interestingly, when cultured in CDM supplemented with G3P,transcription of the uhpT gene in the wild-type strain also signif-icantly increased (Fig. 3C; see also Fig. S1C). When cultured inCDM supplemented with glucose as the sole carbon source, nosignificant changes were observed (Fig. 3D; see also Fig. S1D). Tofurther analyze the role of HptA and HptRS on other carbohydratetranslocases, such as GlcU and GlpT, translocases for glucose andG3P, respectively, transcription of these genes was determined butshowed no differences (Fig. 3A to D). Combined with the in silicoanalysis and the growth results, these results suggest that HptA is aphosphate sensor protein that activates HptRS TCS, resultingin transcriptional activation of the uhpT gene; thus, HptA andHptRS represent the HPT system in S. aureus.

The hptRS gene is required for intracellular survival andmultiplication of S. aureus. Since hexose phosphates are impor-tant carbon sources within the host cell cytosol, we hypothesizedthat any defect in the HPT system would negatively affect intra-cellular survival and multiplication of S. aureus. As shown in Fig.4, the intracellular survival and multiplication of the �HptRS mu-tant in murine bone marrow-derived macrophages (BMDM), hu-man monocytic cells (THP-1), and human alveolar epithelial cells(A549) were clearly impaired compared to those of the wild-typeand complemented strains. These results suggest that uptake ofhexose phosphate by the HPT system is important for intracellularsurvival and multiplication of S. aureus.

The hptRS deletion mutant exhibits fosfomycin resistance inS. aureus. Fosfomycin is a bactericidal agent that acts by inhibit-ing bacterial cell wall biosynthesis by inactivating the enzymeUDP-N-acetylglucosamine-3-enolpyruvyltransferase, also known asMurA (31). Since fosfomycin requires UhpT gene expression to

FIG 1 Identification of a putative hexose phosphate transport system in S.aureus. (A) A schematic map of the genomic organization of the hexose phos-phate transport system in S. aureus LAC and its mutant derivatives; (B) a PCRconfirmation of a deletion mutant of HptA (�HptA mutant), HptRS (�HptRSmutant), and UhpT (�UhpT mutant) and the corresponding complementedstrains, pMK4-HptA, pMK4-HptRS, and pMK4-UhpT, respectively.

Characterization of an HPT System in S. aureus

April 2015 Volume 83 Number 4 iai.asm.org 1623Infection and Immunity

on Novem

ber 20, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

enter bacterial cells (32), the fosfomycin MIC of the wild-type,�HptRS, and �UhpT strains was determined using an Etest. Asshown in Fig. 5, the fosfomycin MIC of the wild-type LAC strainwas found to be 0.5 to 1.5 �g/ml. In contrast, the �HptRSand �UhpT strains were highly resistant to fosfomycin (1,024�g/ml). Both complemented mutant strains exhibited restoredsensitivity to fosfomycin (1.0 to 2.5 �g/ml).

Resistance to fosfomycin could be induced by (i) the impaired

uptake of fosfomycin through UhpT and GlpT (33), (ii) overex-pression or mutation in MurA (33), (iii) biochemical modifica-tions of fosfomycin (bacillithiol conjugation) by FosB (34), and(iv) impaired bacillithiol synthesis by downregulation of the ba-cillithiol synthesis enzyme, BshA (35). It is noteworthy that thewild-type LAC strain is highly sensitive to the fosfomycin, al-though it harbors both the fosB and bshA genes. To understand theeffect of HptRS on the genes related to fosfomycin resistance

FIG 2 Role of the HPT system in growth under nutrition specifically limited to glucose-6-phosphate. Results shown are the growth kinetics of the wild-type,�HptA, �HptRS, and �UhpT strains in MH2 (A) or in chemically defined medium (CDM) supplemented with G6P (B), G3P (C), or glucose (Glu) (D) as thesole carbon source. Results shown are combined from triplicate measurements from three independent experiments. The asterisk indicates statistical differencefrom the wild type at P values of 0.001.

FIG 3 Role of HptA and HptRS in transcriptional regulation of the UhpT in response to extracellular G3P and G6P. Transcription of UhpT in the wild-type,�HptA, and �HptRS strains, cultured in MH2 broth (A) or in CDM supplemented with G6P (B), G3P (C), or glucose (Glu) (D) as the sole carbon source, wasmeasured using qRT-PCR. Results shown are combined from triplicate measurements from two independent experiments.

Park et al.

1624 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on Novem

ber 20, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

(glpT, uhpT, murA, fosB, and bshA) and how the wild-type LACstrain is sensitive to fosfomycin, transcription of these genes inresponse to an exposure to fosfomycin was measured using qRT-PCR. When cultured in MH2 broth, transcription of the glpT,uhpT, murA, fosB, and bshA genes was not different among thewild-type, �HptRS, and complemented strains (Fig. 6A). How-ever, when exposed to a high level of fosfomycin (128 �g/ml) for 6h, transcription of the glpT, uhpT, murA, and fosB genes increased(2- to 4-fold) but that of the bshA gene was not changed in thewild-type and complemented strains, compared to the data ob-tained from the wild-type strain cultured in MH2 broth withoutfosfomycin (Fig. 6B). On the contrary, transcription of the glpT,uhpT, murA, fosB, and bshA genes decreased in the �HptRS strain(Fig. 6B). These results suggested that, in the wild-type strain, atranscriptional increase of the glpT and uhpT genes without atranscriptional increase of the bshA gene resulted in an increasedfosfomycin uptake but not a sufficient supply of bacillithiol,thereby making the bacteria sensitive to fosfomycin. In contrast,in the �HptRS strain, a transcriptional decrease of the glpT anduhpT genes resulted in a decreased fosfomycin uptake, therebycausing resistance to fosfomycin.

DISCUSSION

For successful survival/multiplication within host cells, invad-ing pathogens must adapt to the available nutrients and otherphysiological conditions, such as pH, temperature, and oxy-gen, existing in these cells. Within host cells, glucose and re-

lated metabolic derivatives, such as G3P, G6P, pyruvate, lac-tate, and glycerol, are the most important carbon sources (36).The transport and use of nutrients by invading pathogens aremediated by multiple specific transport systems and metabolicpathways controlled by both global and specific transcriptionalregulators (37). Differential gene expression profile (DGEP)analysis of Listeria monocytogenes and Shigella flexneri grown inhost epithelial cells or macrophages, compared with laborato-ry-defined medium (38–40), showed that upregulation ofgenes involved in uptake, such as glpT and uhpT, in catabolismof G3P and G6P, such as glpF, glpK, glpD, and dhaK, and indownregulation of glycolysis genes suggested the importanceof G3P and G6P for intracellular growth.

In this study, we identified and characterized the HPT sys-tem in S. aureus. We demonstrated that the disruption of thehptA, hptRS, and uhpT genes impaired the growth under nu-trition-limited conditions when the available carbon sourcewas limited to G6P but not to glucose or MH2 broth. Similarly,transcription of the uhpT gene in the wild-type strain was in-creased when phosphate substrates, such as G3P, G6P, andfosfomycin, were present. The disruption of the hptA or hptRSgene abolished transcriptional activation of the uhpT gene.These results demonstrate that UhpT is the only transporter forG6P in S. aureus and that transcriptional activation of uhpT bythe HPT is required for G6P or fosfomycin uptake. In combi-nation with the in silico analysis data, these results strongly

FIG 4 Role of HptRS in intracellular survival/multiplication of S. aureus. A cell monolayer of murine bone marrow-derived macrophages (BMDM), humanmonocytic cells (THP-1), and human alveolar epithelial cells (A549) was infected with the wild-type or �HptRS strains at an MOI of 5. After 30 min of infection,extracellular bacteria were removed by gentamicin treatment, and survival/multiplication of S. aureus within the host cells were measured at the indicated timepoints. Results shown are combined from triplicate measurements from three independent experiments. The asterisk indicates statistical difference from the wildtype at P values of 0.05.

FIG 5 Role of HptRS and UhpT in fosfomycin sensitivity. The fosfomycin MIC of the wild-type, �HptRS, and �UhpT strains was determined using the Etestby following the manufacturer’s instructions.

Characterization of an HPT System in S. aureus

April 2015 Volume 83 Number 4 iai.asm.org 1625Infection and Immunity

on Novem

ber 20, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

suggest that the HPT system in S. aureus consists of HptA,HptRS, and UhpT, in which HptA senses extracellular phos-phates, such as G3P, G6P, and fosfomycin, and activates HptRS,resulting in transcriptional activation of the uhpT gene, similar tothe HPT system described in E. coli (22).

We also demonstrated that the disruption of the hptRSgenes impaired survival/multiplication of S. aureus within var-ious types of host cells, possibly due to the lack of transcriptionalactivation of the uhpT gene, resulting in an impaired uptake ofhexose phosphates. In agreement with our findings, previousstudies demonstrated that a high risk of S. aureus respiratory in-fection is correlated with an increased glucose concentration inblood and airway spaces (41). Another recent study demon-strated that S. aureus, upon internalization in A549 cells, highlyincreased transcription of transporters of inorganic ions, nucleo-tides, and carbohydrates, including UhpT (42). These results sug-gest that hexose phosphates are important nutritional resourceswithin the host cytoplasm for survival/multiplication of S. aureus,and the HPT system plays an important role in this process.

Fosfomycin is a broad-spectrum bactericidal antibiotic in clin-ical use against both Gram-positive and -negative bacteria (43). Itacts as a phosphoenolpyruvate (PEP) analogue, which inhibits theactivity of MurA, preventing the formation of UDP-N-acetylglu-cosamine-3-O-enolpyruvate, a peptidoglycan precursor, fromUDP-GlcNAc, which is the first step in the peptidoglycan biosyn-thesis pathway (31). Fosfomycin can be administered in a highdose since it has very few side effects in humans and is excretedfrom the body without being metabolized. Because of the uniquemechanism of its action and advantages, fosfomycin showed clin-

ical usefulness for treating osteomyelitis, endocarditis, and necro-tizing pneumonia caused by multidrug-resistant S. aureus, incombination with daptomycin, rifampin, and vancomycin, exert-ing synergistic effects (44). Fosfomycin uptake is essential for an-tibiotic activity, and intrinsic resistance to the antibiotic in somepathogenic species is caused by either mutations in transportergenes or the lack of transport. While fosfomycin is transportedinto E. coli through both UhpT and GlpT, it has been reported thatGlpT is the only fosfomycin transporter in P. aeruginosa, due tothe absence of the uhpT gene on its chromosome (32). Conse-quently, a dysregulation of either UhpT or GlpT confers increasedfosfomycin resistance in these species. Consistent with these find-ings, our results also showed that a disruption of HptA, HptRS, orUhpT resulted in a high level of fosfomycin resistance, indicatingthat UhpT is the main transporter for taking up fosfomycin in S.aureus LAC. Furthermore, in the wild-type strain, transcriptionalactivation of uhpT without sufficient activation of the bshA gene,which supplies substrates for the fosfomycin modification enzyme(FosB), resulted in high sensitivity to fosfomycin. A recent studydemonstrated that a disruption of the bshA gene, which is respon-sible for conjugating L-malic acid to UDP-GlcNAc, highly in-creases transcription of UhpT (�20-fold), suggesting the presenceof interactions between the HPT system and the intracellularUDP-GlcNAc level (35).

In summary, we identified and characterized the hptRS regulon(hptA-hptRS-uhpT) encoding major components for the HPTsystem in S. aureus. The staphylococcal HPT system is importantfor intracellular survival/multiplication by sensing extracellularphosphate substrates and triggering an adaptive response to takeup a particular carbon source. Given the fact that HptRS is highlyresponsive to extracellular phosphates that activate transcriptionof the uhpT gene, the main transporter for fosfomycin, the HPTsystem might be a useful target for developing novel antistaphy-lococcal therapies.

ACKNOWLEDGMENTS

This study was supported by NIH grant 1P20GM103646-01A from theNIGMS Center for Biomedical Research Excellence in Pathogen-Host In-teractions, an ORGS MSU-CVM internal grant, and a QIA internationalresearch grant to K.S.S.

We thank Stephen Pruett for revising the manuscript.

REFERENCES1. DeLeo FR, Chambers HF. 2009. Reemergence of antibiotic-resistant

Staphylococcus aureus in the genomics era. J Clin Invest 119:2464 –2474.http://dx.doi.org/10.1172/JCI38226.

2. Cheung AL, Koomey JM, Butler CA, Projan SJ, Fischetti VA. 1992.Regulation of exoprotein expression in Staphylococcus aureus by a locus(sar) distinct from agr. Proc Natl Acad Sci U S A 89:6462– 6466. http://dx.doi.org/10.1073/pnas.89.14.6462.

3. Novick RP, Projan SJ, Kornblum J, Ross HF, Ji G, Kreiswirth B,Vandenesch F, Moghazeh S. 1995. The agr P2 operon: an autocatalyticsensory transduction system in Staphylococcus aureus. Mol Gen Genet248:446 – 458. http://dx.doi.org/10.1007/BF02191645.

4. McNamara PJ, Milligan-Monroe KC, Khalili S, Proctor RA. 2000.Identification, cloning, and initial characterization of rot, a locus encod-ing a regulator of virulence factor expression in Staphylococcus aureus. JBacteriol 182:3197–3203. http://dx.doi.org/10.1128/JB.182.11.3197-3203.2000.

5. Kullik II, Giachino P. 1997. The alternative sigma factor sigmaB in Staph-ylococcus aureus: regulation of the sigB operon in response to growth phaseand heat shock. Arch Microbiol 167:151–159. http://dx.doi.org/10.1007/s002030050428.

6. Ibarra JA, Perez-Rueda E, Carroll RK, Shaw LN. 2013. Global analysis of

FIG 6 Effect of an exposure to fosfomycin on transcription of genes related tofosfomycin resistance. The wild-type and �HptRS strains were grown in MH2broth (A) or in MH2 broth supplemented with a high level of fosfomycin (128�g/ml) for 6 h (B). Transcription of genes related to fosfomycin resistance wasmeasured using qRT-PCR. Results shown are combined from triplicate mea-surements from two independent experiments.

Park et al.

1626 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on Novem

ber 20, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

transcriptional regulators in Staphylococcus aureus. BMC Genomics 14:126. http://dx.doi.org/10.1186/1471-2164-14-126.

7. Fournier B, Klier A, Rapoport G. 2001. The two-component systemArlS-ArlR is a regulator of virulence gene expression in Staphylococcusaureus. Mol Microbiol 41:247–261. http://dx.doi.org/10.1046/j.1365-2958.2001.02515.x.

8. Brunskill EW, Bayles KW. 1996. Identification and molecular character-ization of a putative regulatory locus that affects autolysis in Staphylococ-cus aureus. J Bacteriol 178:611– 618.

9. Meehl M, Herbert S, Gotz F, Cheung A. 2007. Interaction of theGraRS two-component system with the VraFG ABC transporter tosupport vancomycin-intermediate resistance in Staphylococcus aureus.Antimicrob Agents Chemother 51:2679 –2689. http://dx.doi.org/10.1128/AAC.00209-07.

10. Gardete S, Wu SW, Gill S, Tomasz A. 2006. Role of VraSR in antibioticresistance and antibiotic-induced stress response in Staphylococcus aureus.Antimicrob Agents Chemother 50:3424 –3434. http://dx.doi.org/10.1128/AAC.00356-06.

11. Delaune A, Poupel O, Mallet A, Coic YM, Msadek T, Dubrac S. 2011.Peptidoglycan crosslinking relaxation plays an important role in Staphy-lococcus aureus WalKR-dependent cell viability. PLoS One 6:e17054. http://dx.doi.org/10.1371/journal.pone.0017054.

12. Torres VJ, Stauff DL, Pishchany G, Bezbradica JS, Gordy LE, IturreguiJ, Anderson KL, Dunman PM, Joyce S, Skaar EP. 2007. A Staphylococcusaureus regulatory system that responds to host heme and modulates viru-lence. Cell Host Microbe 1:109 –119. http://dx.doi.org/10.1016/j.chom.2007.03.001.

13. Schlag S, Fuchs S, Nerz C, Gaupp R, Engelmann S, Liebeke M, Lalk M,Hecker M, Gotz F. 2008. Characterization of the oxygen-responsive Nre-ABC regulon of Staphylococcus aureus. J Bacteriol 190:7847–7858. http://dx.doi.org/10.1128/JB.00905-08.

14. Yarwood JM, McCormick JK, Schlievert PM. 2001. Identification of anovel two-component regulatory system that acts in global regulation ofvirulence factors of Staphylococcus aureus. J Bacteriol 183:1113–1123.http://dx.doi.org/10.1128/JB.183.4.1113-1123.2001.

15. Sun F, Ji Q, Jones MB, Deng X, Liang H, Frank B, Telser J, Peterson SN,Bae T, He C. 2012. AirSR, a [2Fe-2S] cluster-containing two-componentsystem, mediates global oxygen sensing and redox signaling in Staphylo-coccus aureus. J Am Chem Soc 134:305–314. http://dx.doi.org/10.1021/ja2071835.

16. Hiron A, Falord M, Valle J, Debarbouille M, Msadek T. 2011. Bacitracinand nisin resistance in Staphylococcus aureus: a novel pathway involvingthe BraS/BraR two-component system (SA2417/SA2418) and both theBraD/BraE and VraD/VraE ABC transporters. Mol Microbiol 81:602–622. http://dx.doi.org/10.1111/j.1365-2958.2011.07735.x.

17. Postma PW, Lengeler JW, Jacobson GR. 1993. Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol Rev 57:543–594.

18. Island MD, Wei BY, Kadner RJ. 1992. Structure and function of the uhpgenes for the sugar phosphate transport system in Escherichia coli andSalmonella typhimurium. J Bacteriol 174:2754 –2762.

19. Chico-Calero I, Suarez M, Gonzalez-Zorn B, Scortti M, Slaghuis J,Goebel W, Vazquez-Boland JA. 2002. Hpt, a bacterial homolog of themicrosomal glucose-6-phosphate translocase, mediates rapid intracellularproliferation in Listeria. Proc Natl Acad Sci U S A 99:431– 436. http://dx.doi.org/10.1073/pnas.012363899.

20. Island MD, Kadner RJ. 1993. Interplay between the membrane-associated UhpB and UhpC regulatory proteins. J Bacteriol 175:5028 –5034.

21. Weston LA, Kadner RJ. 1988. Role of uhp genes in expression of theEscherichia coli sugar-phosphate transport system. J Bacteriol 170:3375–3383.

22. Verhamme DT, Arents JC, Postma PW, Crielaard W, Hellingwerf KJ.2001. Glucose-6-phosphate-dependent phosphoryl flow through the Uhptwo-component regulatory system. Microbiology 147:3345–3352.

23. Sonna LA, Ambudkar SV, Maloney PC. 1988. The mechanism of glucose6-phosphate transport by Escherichia coli. J Biol Chem 263:6625– 6630.

24. Fraunholz M, Sinha B. 2012. Intracellular Staphylococcus aureus: live-inand let die. Front Cell Infect Microbiol 2:43. http://dx.doi.org/10.3389/fcimb.2012.00043.

25. Memmi G, Filipe SR, Pinho MG, Fu Z, Cheung A. 2008. Staphylococcusaureus PBP4 is essential for beta-lactam resistance in community-

acquired methicillin-resistant strains. Antimicrob Agents Chemother 52:3955–3966. http://dx.doi.org/10.1128/AAC.00049-08.

26. Sullivan MA, Yasbin RE, Young FE. 1984. New shuttle vectors for Bacillussubtilis and Escherichia coli which allow rapid detection of inserted frag-ments. Gene 29:21–26. http://dx.doi.org/10.1016/0378-1119(84)90161-6.

27. Lee DS, Burd H, Liu J, Almaas E, Wiest O, Barabasi AL, Oltvai ZN,Kapatral V. 2009. Comparative genome-scale metabolic reconstructionand flux balance analysis of multiple Staphylococcus aureus genomes iden-tify novel antimicrobial drug targets. J Bacteriol 191:4015– 4024. http://dx.doi.org/10.1128/JB.01743-08.

28. Weischenfeldt J, Porse B. 2008. Bone marrow-derived macrophages(BMM): isolation and applications. CSH Protoc 2008:pdb prot5080. http://dx.doi.org/10.1101/pdb.prot5080.

29. Jung K, Fried L, Behr S, Heermann R. 2012. Histidine kinases andresponse regulators in networks. Curr Opin Microbiol 15:118 –124. http://dx.doi.org/10.1016/j.mib.2011.11.009.

30. Tam R, Saier MH, Jr. 1993. Structural, functional, and evolutionaryrelationships among extracellular solute-binding receptors of bacteria.Microbiol Rev 57:320 –346.

31. Brown ED, Vivas EI, Walsh CT, Kolter R. 1995. MurA (MurZ), theenzyme that catalyzes the first committed step in peptidoglycan biosyn-thesis, is essential in Escherichia coli. J Bacteriol 177:4194 – 4197.

32. Castaneda-Garcia A, Rodriguez-Rojas A, Guelfo JR, Blazquez J. 2009.The glycerol-3-phosphate permease GlpT is the only fosfomycin trans-porter in Pseudomonas aeruginosa. J Bacteriol 191:6968 – 6974. http://dx.doi.org/10.1128/JB.00748-09.

33. Thompson MK, Keithly ME, Goodman MC, Hammer ND, Cook PD,Jagessar KL, Harp J, Skaar EP, Armstrong RN. 2014. Structure andfunction of the genomically encoded fosfomycin resistance enzyme, FosB,from Staphylococcus aureus. Biochemistry 53:755–765. http://dx.doi.org/10.1021/bi4015852.

34. Roberts AA, Sharma SV, Strankman AW, Duran SR, Rawat M,Hamilton CJ. 2013. Mechanistic studies of FosB: a divalent-metal-dependent bacillithiol-S-transferase that mediates fosfomycin resis-tance in Staphylococcus aureus. Biochem J 451:69 –79. http://dx.doi.org/10.1042/BJ20121541.

35. Posada AC, Kolar SL, Dusi RG, Francois P, Roberts AA, Hamilton CJ,Liu GY, Cheung A. 2014. Importance of bacillithiol in the oxidative stressresponse of Staphylococcus aureus. Infect Immun 82:316 –332. http://dx.doi.org/10.1128/IAI.01074-13.

36. Brown SA, Palmer KL, Whiteley M. 2008. Revisiting the host as a growthmedium. Nat Rev Microbiol 6:657– 666. http://dx.doi.org/10.1038/nrmicro1955.

37. Deutscher J, Francke C, Postma PW. 2006. How phosphotransferasesystem-related protein phosphorylation regulates carbohydrate metabo-lism in bacteria. Microbiol Mol Biol Rev 70:939 –1031. http://dx.doi.org/10.1128/MMBR.00024-06.

38. Lucchini S, Liu H, Jin Q, Hinton JC, Yu J. 2005. Transcriptional adaptationof Shigella flexneri during infection of macrophages and epithelial cells: in-sights into the strategies of a cytosolic bacterial pathogen. Infect Immun 73:88–102. http://dx.doi.org/10.1128/IAI.73.1.88-102.2005.

39. Joseph B, Mertins S, Stoll R, Schar J, Umesha KR, Luo Q, Muller-Altrock S, Goebel W. 2008. Glycerol metabolism and PrfA activity inListeria monocytogenes. J Bacteriol 190:5412–5430. http://dx.doi.org/10.1128/JB.00259-08.

40. Chatterjee SS, Hossain H, Otten S, Kuenne C, Kuchmina K, Machata S,Domann E, Chakraborty T, Hain T. 2006. Intracellular gene expressionprofile of Listeria monocytogenes. Infect Immun 74:1323–1338. http://dx.doi.org/10.1128/IAI.74.2.1323-1338.2006.

41. Garnett JP, Braun D, McCarthy AJ, Farrant MR, Baker EH, Lindsay JA,Baines DL. 2014. Fructose transport-deficient Staphylococcus aureus re-veals important role of epithelial glucose transporters in limiting sugar-driven bacterial growth in airway surface liquid. Cell Mol Life Sci http://dx.doi.org/10.1007/s00018-014-1635-y.

42. Garzoni C, Francois P, Huyghe A, Couzinet S, Tapparel C, Charbon-nier Y, Renzoni A, Lucchini S, Lew DP, Vaudaux P, Kelley WL,Schrenzel J. 2007. A global view of Staphylococcus aureus whole genomeexpression upon internalization in human epithelial cells. BMC Genomics8:171. http://dx.doi.org/10.1186/1471-2164-8-171.

43. Barry AL, Brown SD. 1995. Antibacterial spectrum of fosfomycin tro-metamol. J Antimicrob Chemother 35:228 –230. http://dx.doi.org/10.1093/jac/35.1.228.

44. Miro JM, Entenza JM, Del Rio A, Velasco M, Castaneda X, Garcia de la

Characterization of an HPT System in S. aureus

April 2015 Volume 83 Number 4 iai.asm.org 1627Infection and Immunity

on Novem

ber 20, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

Maria C, Giddey M, Armero Y, Pericas JM, Cervera C, Mestres CA,Almela M, Falces C, Marco F, Moreillon P, Moreno A. 2012. High-dosedaptomycin plus fosfomycin is safe and effective in treating methicillin-susceptible and methicillin-resistant Staphylococcus aureus endocarditis.Antimicrob Agents Chemother 56:4511– 4515. http://dx.doi.org/10.1128/AAC.06449-11.

45. Kreiswirth BN, Lofdahl S, Betley MJ, O’Reilly M, Schlievert PM, Berg-

doll MS, Novick RP. 1983. The toxic shock syndrome exotoxin structuralgene is not detectably transmitted by a prophage. Nature 305:709 –712.http://dx.doi.org/10.1038/305709a0.

46. Taylor RG, Walker DC, McInnes RR. 1993. E. coli host strains signifi-cantly affect the quality of small scale plasmid DNA preparations used forsequencing. Nucleic Acids Res 21:1677–1678. http://dx.doi.org/10.1093/nar/21.7.1677.

Park et al.

1628 iai.asm.org April 2015 Volume 83 Number 4Infection and Immunity

on Novem

ber 20, 2020 by guesthttp://iai.asm

.org/D

ownloaded from