28

CHAPTER 3

Materials and Methods

3.1 General

The glassware was soaked overnight in chromic acid solution (10% potassium

dichromate solution in 25% concentrated sulphuric acid) and then washed thoroughly in

running tap water. Finally, they were rinsed with distilled water and dried in a hot air oven.

3.2 Sterilization

The glassware and culture medium were sterilized in an autoclave at 121°C at 15 psi for

20 minutes.

3.3 Culture media and Chemicals

Antibiotics powder - ciprofloxacin, norfloxacin, Nalidixic acid, CCCP (Carbonyl

Cyanide m-Chlorophenylhydrazone), magnesium sulphate, glycine Hydrocholride,

Potassium L-lactate, 3-(N-morpholino) propanesulfonic acid, Juglone (5-Hydroy-1,4-

napthoquinone) and Trizma hydrochloride all these chemicals are from Sigma-Aldrich.

Resazurin, sodium hydroxide, Mueller-Hinton broth and agar, Luria bertani broth and agar,

nurient broth and agar, dimethyl sulfoxide, (HiMedia Laboratories Pvt. Ltd., Mumbai,

India). Solvents-ethanol (Jiangsu Huaxi international Trade co. Ltd), n-hexane, n-butanol

from Qualigens and chloroform from Merck, 96-well micro titre plate (Nest Biotech Co.,

Ltd, China).

3.4 Preparation of natural compounds

The following natural compounds were dissolved at a concentration of 10 mg/mL in

dimethylsulfoxide (DMSO, Loba-Chemie, Pvt. Ltd. Mumbai, India), reserpine (Sigma-

Aldrich Co. LLC.,USA), berberine (Sigma-Aldrich Co. LLC.,USA), ciprofloxacin (Sigma-

Aldrich Co. LLC.,USA), eugenol (HiMedia Laboratories Pvt. Ltd., Mumbai, India),

29

linoleic acid (Sisco Research Laboratories Mumbai Pvt. Ltd.), chitosan (Axiogen Pvt. Ltd.,

India) and curcumin (M/S. Agrihub Pvt.Ltd., Tuticorin, India).

Table 3.1 Antibiotic stock concentrations

Antibiotic Stock concentration Concentration in LB

Ampicillin 10mg / 1mL 1µl / mL (10µg / mL)

Ciprofloxacin 10mg in 1ml along with few drops of 1N NaOH 1µl / mL (10µg / mL)

Norfloxacin 10mg in 1ml along with few drops of 1N NaOH MIC – starting Conc.

Nalidixic acid 10mg in 1ml along with few drops of 1N NaOH 1µl / mL (10µg / mL)

The stock solutions of antibiotics was prepared at appropriate concentrations and stored at

-20oC.

3.5 Storage of commercial antimicrobial discs

Commercially bought antibiotic discs from Hi-Media, INDIA were stored in the

refrigerator at 4ºC or below. List of antibiotics used as follows in the table 3.2

Table 3.2 Commercially available antibiotic discs mcg/discs

S.NO ANTIBIOTIC DISC USED ANTIBIOTIC GROUP MODE OF ACTION

1. Nalidixic Acid (NA-30mcg) 1st

generation Fluoroquinolone Inhibits DNA synthesis

2. Ciprofloxacin(CIP-5mcg) 2nd

generation Fluoroquinolone Inhibits DNA synthesis

3. Norfloxacin(NX-10mcg) 2nd

generation Fluoroquinolone Inhibits DNA synthesis

4. Levofloxacin(LE-5mcg) 2nd

generation Fluoroquinolone Inhibits DNA synthesis

5. Cefotaxime(CTX-30 mcg) 3rd

generation Cephalosporin

antibiotics.

Inhibits synthesis of

Peptidoglycon layer.

6. Cefepime(CPM-30mcg) 4th

generation Cephalosporin

antibiotics.

Inhibits synthesis of

peptidoglycon layer

7.

Amoxyclav(AMC-30 mcg)

Amoxillin-Penicillin antibiotic

Clavulanic acid-cephalosporin

antibiotic

Class-A ESβL inhibitor

8. Imipenem(IPM-10mcg) Carbapenem antibiotic Inhibiting cell wall

synthesis

30

3.6 Buffer preparations

3.6.1 Phosphate buffer preparation

The most commonly used phosphate buffers consist of a mixture of monobasic

dihydrogen phosphate and dibasic monohydrogen phosphate. By varying the amount of

each salt, a range of buffers can be prepared that buffer well between pH 5.8 and pH 8.0.

Phosphates have a very high buffering capacity and are highly soluble in water. For

making 2M sodium phosphate monohydrate (solution A), 13.799 gm of sodium phosphate

monohydrate was weighed and dissolved in 50 mLof autoclaved distilled water. For 2M

sodium phosphate dehydrate (solution B), 17.80 gm of sodium phosphate dehydrate was

weighed and dissolved in 50 mL of autoclaved distilled water. These two solutions were

autoclaved separately. Then 14 mL of solution A and 36 mL of solution B were pipetted

out for 50mL and further ionic concentration was checked pH 7.2

3.6.2 EDTA –Molecular weight 372.24 gm EDTA, 0.5M (200 ml stock, pH 8.0)

EDTA Ethylenediaminetetraacetic acid is a chelating agent; solubility of EDTA is very

poor in water. 37.224 gms of EDTA (disodium ethylenediaminetetra-acetate·2H2O) was

taken in 100mLof Millipore distilled water and pH was adjusted to 8.0 by adding

approximately 10 gms of sodium hydroxide pellet. Once the pH 8.0 reached, EDTA

dissolved completely and final volume was made up to 200mL.

3.6.3 Preparation of TAE buffer

TAE buffer is a buffer solution containing a mixture of Tris base, Glacial acetic acid

and EDTA in the appropriate composition shown in the table 3.3 TAE buffer is usually

used in agarose gel electrophoresis for the separation of nucleic acids, DNA and RNA.

Table 3.3 TAE buffer composition

50X TAE

Stock solution/Liter

50X TAE /100mL

242 gm of Tris base 24.2 gm of Tris base

57.1 mLof glacial acetic acid 5.71 mL of glacial acetic acid

100 mLof 0.5M EDTA 10mL of 0.5M EDTA

For 1X TAE preparation, 20mL of the stock (50X TAE) was taken and the total volume

was made up to 1000 mLwith sterile Millipore water.

31

3.6.4 Preparation of Ethidium bromide (EtBr)

To detect the presence of DNA/RNA, ethidium bromide is used as an intercalating

agent. (EtBr possesses UV absorbance maxima at 300 and 360 nm. Additionally, it can

absorb energy from nucleotides excited by absorbance of 260 nm radiation. Ethidium

bromide re-emits this energy as fluorescent orange light centred at 590 nm). Stock

concentration of EtBr was prepared by weighing 10 mg/mL of distilled water. EtBr was

mixed with a magnetic stirrer continuously for 5 hours and then it was stored at 4°C

wrapped in aluminium foil .When agarose gel was prepared 2 μl or 3 μl of EtBr was added.

3.6.5 Preparation of loading dye (6X)

6X DNA Loading Dye are used to prepare DNA markers and samples for loading on

agarose or polyacrylamide gels. The gel loading dye contains surcose, bromophenol blue

and xylene cyanol. Surcose makes the sample dense enough sink to the bottom of the well,

bromophenol blue and xylene cyanol to visually monitoring electrophoresis. It was

prepared by dissolving 4gm sucrose, 25mg bromophenol blue (0.25%) and 25mg Xylene

cyanol (0.25%) in 10 mL of sterile Millipore water.

3.6.6 Preparation of Dimethylsulfoxide

Dimethyl sulfoxide (DMSO) is an organosulfur compound with the formula (CH3)2SO.

This colorless liquid is an important polaraprotic solvent that dissolves both polar and

nonpolar compounds and is miscible in a wide range of organic solvents as well as water.

The 30% Dimethylsulfoxide (DMSO)-30ml of DMSO was added to 70mL of Distilled

water.

EXPERIMENTATION

3.7 Collection of isolates

Bacterial cultures

3.7.1 Strains used for qnr gene determination

Twenty-three clinical isolates of K. pneumoniae collected from tertiary care hospitals

(Madras Medical College) in Chennai during October 2009 were subjected to routine

culture and antibiotic susceptibility testing. Antibiotic susceptibility testing was performed

according to standard methods on Mueller Hilton agar (Himedia Laboratories Pvt. Ltd.,

Mumbai, India). The antibiotics norfloxacin (10 μg disk-1, Himedia Laboratories Pvt. Ltd.,

32

Mumbai, India), levofloxacin (5 μg disk- 1, Himedia Laboratories Pvt. Ltd., Mumbai,

India) and ciprofloxacin (5 μg disk-1, Himedia Laboratories Pvt. Ltd., Mumbai, India)

were used for antibiotic susceptibility screening. The results were interpreted as per the

CLSI guidelines. Minimum inhibitory concentration of Ciprofloxacin was determined by

the HiCombTM E-Strip from Himedia Laboratories Pvt. Ltd., Mumbai, India, following

the manufacturer’s instructions.

3.7.2 Strains used for Biofilm Inhibition

Clinical isolates (35) of multidrug resistant K. pneumoniae were collected from a tertiary

care hospital (Department of Microbiology, Sri Ramachandra University) in Chennai during

November 2009-February 2010. The isolates were numbered from 1 - 35. Based on the

source of the isolate, a prefix U for urine, B for blood and S for sputum was given. The

isolates were tested for their antimicrobial sensitivity to ciprofloxacin (5 μg disk-1

, HiMedia

Laboratories Pvt. Ltd., Mumbai, India), cefotaxime (30 μg disk-1

, HiMedia Laboratories

Pvt. Ltd., Mumbai, India), and amoxyclav (30 μg disk-1

, HiMedia Laboratories Pvt. Ltd.,

Mumbai, India) using recommended guidelines. The isolates were scored for their

antimicrobial resistance according to the CLSI guidelines (CSLI, 2010).

3.7.3 Strains used for plant activity and Efflux pumps inhibition assay

Five representative MDR isolates were chosen for this study. These included three

isolates of Klebsiella pneumoniae, U6 and U25 collected from urine, B7 from blood, one

E. coli isolate E6 from bile, and one isolate of Pseudomonas aeruginosa P3 from urine,

which were collected from tertiary care hospitals during February 2010 and November

2011 (Sri Ramachandra University and Stanley Medical College, Chennai) were subjected to

routine culture and antibiotic susceptibility testing. Antimicrobial susceptibility testing

(Kirby-Bauer method) was performed according to standard methods on Mueller Hilton

agar (Himedia Laboratories Pvt. Ltd., Mumbai, India). The antibiotics Norfloxacin (NX-

10μg), Nalidixic acid (NA - 30μg), Ciprofloxacin (CF-5μg) Amoxyclav (AMC-30μg),

Cefotaxime (CTX-30μg) Cefepime (CPM-30μg), Cefoxitin (CX-30 μg), Imepenem (IMP-

10μg) from (Himedia Laboratories Pvt. Ltd., Mumbai, India) were used for antibiotic

susceptibility screening. The results were interpreted as per the CLSI (CLSI, 2010). K.

pneumoniae MTCC 432 and E.coli ATCC 25922 was used as sensitive strains.These

33

isolates were cultured in ampicillin and ciprofloxacin plates and further the cultures was

stored as a glycerol stock and maintained at -80 ˚C.

3.8 Antimicrobial Susceptibility Test

3.8.1 Inoculum Preparation

The culture were taken from the appropriate micro streak and transfer to the Luria

bertani media containing ampicillin (concentration 10μg/mL) with the help of inoculation

loop. All the test cultures were incubated at 37ºC overnight (approx. 12-16 hours).

3.8.2 Inoculation of Test Plates

A sterile cotton swab is dipped into the culture. The swab should be rotated several

times and pressed firmly on the inside wall of the tube above the fluid level. This will

remove excess inoculum from the swab. The dried surface of a Mueller-Hinton agar (Hi-

Media, INDIA) plate is inoculated by swabbing over the entire sterile agar surface. This

procedure is repeated for two more times, rotating the plate. The antibiotics discs used are

norfloxacin, nalidixic acid, ciprofloxacin, levofloxacin, cefotaxime, cepefime, amoxycla

and imipenem. The results were interpreted as per the guidelines of the NCCLS control

(CLSI, 2010).

3.9 Polymerase Chain Reaction

PCR reactions were performed for DNA/plasmid DNA from the clinical isolates

(Klebsiella pneumoniae). PCR cocktail mixture contains 2ul of plasmid DNA, 2μl of

10pmols of each primer, 50mM Dntps, 1000 units Taq polymerase, 10X Standard reaction

buffer (Biotools, B&M Labs made in Spain) and made up for 50 µl reaction per tube with

distilled nuclease free water. The resulting PCR products were run in 1.5% agarose gels

along with DNA ladder 100bp, 500 bp and 1kb from MEDOX, INDIA.

Stock concentration of forward and reverse primers -100 pmols/µl

Working concentration of forward and reverse primers -10 pmols/µl

3.9.1 PCR amplification and sequence analysis

Amplification of the qnrA, qnrB and qnrS genes was performed for all the K.

pneumoniae isolates using the primer sets described in a previous report (Wu et al 2007).

PCR experiments were carried out according to standard conditions (annealing temperature

at 55°C [for qnrA], 60°C [for qnrB and qnrS] and extension 1 min at 72°C, 35 cycles)

using primers synthesised by Eurofins Genomics India Pvt. Ltd, Bangalore, India. Taq

DNA polymerase (Biotools, B and M Labs, Madrid, Spain) and dNTP’s (Cinna Gen Inc.

34

Tehran, Iran) were used as per standard protocols. For detecting the aac(6’)-1b, primers

were chosen to amplify all known aac(6’)-Ib variants (Park et al. 2006). The primers used

were forward primer - 5’-TTGCGATGCTCTATGAGTGGCTA-3’ and reverese primer 5’-

CTCGAATGCCTGGCGTGTTT-3’ which produce a 482-bp product. PCR conditions

were 94°C for 45 s, 55°C for 45 s and 72°C for 45 s for 34 cycles. The aac(6’)-Ib variants

allele was identified by direct sequencing of the PCR product with primer 5’

CGTCACTCCATACATTGCAA 3’.

Table 3.4 PCR condition for qnrA, qnrB, qnrS and aac(6’)-Ib-cr genes (Wu et al 2007)

DNA was prepared for the PCR reaction by suspending a single colony of the clinical

isolate in 500 μl of sterile Millipore water in a 1.5 eppendorf tube, followed by boiling at

100ºC for 5 minutes and centrifuged at 5,000 rpm for 10 minutes (Cattoir et al 2007).Two μl

of supernatant was used as DNA source for the PCR reaction. PCR experiments were carried

out according to conditions given. The PCR products were analysed on a 1.5% agarose gel

(Himedia Laboratories Pvt. Ltd., Mumbai, India) and the DNA bands were visualised by

staining with Ethidium Bromide (Himedia Laboratories Pvt. Ltd., Mumbai, India). The 100

bp DNA Marker from Medox BiotechIndia Pvt. Ltd., Chennai, India, was used for sizing

thePCR bands. The PCR-amplified products were sequenced by SciGenom Labs Pvt. Ltd.,

Cochin, Kerala, India. The sequence from the chromatogram were analysed by NCBI -

BLAST and compared with known alleles to identify the correct allele.

Gene specific primer

Initial

Denaturation

And no:of

cycle

Denaturation

Annealing

Extension

Final

Extension

Amplified

product

QNRA/F-

5’-TTCAGCAAGAGGATTTCTCA-3’

QNRA/R-

5’-GGCAGCACTATTACTCCCAA-3’

5mins 94ºC

and 35 cycles

1 mins at

94º C

1 misn at

55º C

1 min at

72º C

10 mins at

72º C

628bp

QNRB/F-

5’-CCTGAGCGGCACTGAATTTAT-3’

QNRB/R-

5’-GTTTGCTGCTCGCCAGTCGA-3’

5mins 94ºC

and 35 cycles

1 mins at

94 º C

1 mins at

60º C

1 min at

72º C

10 mins at

72º C

408bp

QNRS/F-

5’-CAATCATACATATCGGCACC-3’

QNRS/R-

5’-TCAGGATAAACAACAATACCC-3’

5mins 94ºC

and 35 cycles

1 mins at

94º C

1 mins at

60º C.

1 min at

72º C

1

0 mins at

72º C

417bp

aac(6’)-Ib-cr/F-

5’-TTGCGATGCTCTATGAGTGGCTA-3’

aac(6’)-Ib-cr/R

-5’-CTCGAATGCCTGGCGTGTTT-3’

Internal primer –

5’ CGTCACTCCATACATTGCAA 3’

5mins 94ºC

and 34 cycles

45 sec at

94º C

45 sec at

55º C

45 sec at

72º C

10 mins at

72º C

482bp

35

3.10 Plasmid isolation and transformation

Plasmids from the clinical isolates of K. pneumoniae were isolated using HiPurATM

Plasmid DNA Mini and Midi prep purification Spin Kit (HiMedia Laboratories Pvt. Ltd.,

Mumbai, India). For transformation experiments, plasmid DNA was isolated from two

fluoroquinolone isolates of K. pneumoniae (Isolate P12 and P13) and transformed into a

recipient strain (E. coli JM109). E. coli JM109 is resistant to nalidixic acid (Sigma-Aldrich

Co., St. Louis, MO, USA) but sensitive to ciprofloxacin. The plasmid DNA was transformed

into E. coli by electroporation using PEPTM

(Personal Electroporation Pak Electroporator -

BTX® Genetronics Inc) giving two electric pulses of 180 V at an interval of two seconds of

each. The transformants were selected in LB agar (Himedia Laboratories Pvt. Ltd., Mumbai,

India) containing ciprofloxacin (Sigma-Aldrich Co., St. Louis, MO, USA) at a concentration

of 1 μg/mL. These transformants were analysed further for antibiotic resistance pattern and

PCR amplification.

3.11 Electrophoresis

1x electrophoresis TAE (Tris-acetate-EDTA) buffer was prepared for both agarose gel

preparation and electrophoresis. 1.5 gm of agarose was weighed and dissolved it in 100mL

of TAE buffer. It was heated in microwave oven or boiling water bath, while rotating the

flask occasionally, until the agarose was dissolved. The agarose was cooled to 55-60˚C

and add 2μl of ethidium bromide was added. The agarose solution was poured on to the

electrophoresis boat. Before pouring the molten agarose into the boat, the open edges of

the boat was sealed by using cellophane tape and the comb was placed to make wells. The

set up was left for 15 minutes to let the gel set. The boat was kept with gel in

electrophoresis tank and filled with 1x TAE buffer so that gel was submerged in the buffer.

10 μl of DNA sample and 3μl of gel loading dye was mixed and loaded in the well. 2μl

DNA marker was loaded and the gel was run on power supply of 50 V for 2-3 hrs. The

bands were observed under high performance UV Transilluminator and the photo was

saved in the gel documentation system UVP (VisiDOC-ItTM

Imaging System).

3.12 Electroporation

This method is based on the use of short electrical pulses of high field strength. This

pulse temporarily disturbs the phospholipid bilayer, allowing molecules like DNA to pass

into the cell, provided the DNA is in direct contact with the membrane. The concept of

electroporation capitalizes on the relatively weak nature of the phospholipid bilayer's

36

hydrophobic/hydrophilic interactions and its ability to spontaneously reassemble after

disturbance (Purves, 2001).Thus, a quick voltage shock may disrupt areas of the membrane

temporarily, allowing polar molecules to pass, but then the membrane may reseal quickly

and leave the cell intact. Electroporation were performed using electro cell manipulator

protocol, BTX Division of Gentronics –PR0013D [www.btxonline.com]. 1 mL of

overnight culture E.coli JM109 were transferred to 100mL LB media and incubated for 37º

C for 3 hours in the shaker. The culture was centrifuged at 5,000rpm for 15mins.The pellet

was resuspended with ice colds water (1 volume). The culture was centrifuged at 5,000rpm

for 15mins. The pellet was resuspended with ice cold water (0.5 volumes). The culture was

centrifuged at 5,000rpm for 15mins (Repeat the step again) and 95µl of competent cell and

5µl of plasmid was added to the electroporator cuvette (1mm gap HARVARD

APPARATUS, BTX-ECM399) and cooled by placing it in ice for 5 mins. Electroporation

is performed by giving two pulses of 150 volts. Immediately after the pulse 500µl of LB

broth is added and transferred to eppendrof containing 900µl of LB-glucose (1%) broth

and incubated for 1hour 30mins at 37˚C. After incubation the tubes were centrifuged at

10,000 rpm for 3mins, the cell pellet was plated on LB agar plate with suitable antibiotic

by spread plate technique and incubated for overnight.

3.13 Determination of minimum inhibitory concentration (MIC) of natural compounds

The MIC for each of the natural compounds was determined using the tissue culture plate

method (Kuete et al 2011; Schwarz Silley et al 2010).The bacterial isolates were maintained

in LB agar (HiMedia Laboratories Pvt. Ltd. Mumbai, India) plate and inoculated into 5 mL

of Mueller Hinton broth (HiMedia Laboratories Pvt. Ltd. Mumbai, India) and incubated for

18 h at 37 °C in shaker. The overnight culture was adjusted to 0.5 McFarland standards

[0.5 mL 1.17% (w/v) BaCl2 × 2H2O + 99.5 mL 1% (w/v) H2SO4]. Overnight culture (10

µl, corresponding to 0.5 × 106

cfu) was added to 100 µl of Mueller Hinton broth and

incubated overnight. To the 96-well micro titer plate, 150 µl of sterile Mueller Hinton

broth (HiMedia Laboratories Pvt. Ltd. Mumbai, India) was added and two fold serial

dilutions of the natural compounds were made starting with the first well by adding 50 µl

of the test compound dissolved at a concentration of 4 mg/ml. To each of the wells 10 µl

of the diluted culture (0.5 McFarland standards) was added. This resulted in the final

concentration of the compound ranging from 2 mg/mL in the first well to 0.0078 mg/mL in

37

the 9th

well. In curcumin, higher concentrations were used to determine its MIC. The tissue

culture plate was then incubated at 37 °C in stationary condition for overnight. The growth

of the bacterial culture was measured at a wave length of 595 nm with Bio-Rad Model

iMark Micro plate Absorbance Reader. Two types of negative controls and one positive

control were used in each assay. The ‘Vehicle control’ contained the solvent used for

dissolving the test compounds (10 µl DMSO) and 100 µl of media in 10th

well. The ‘Media

control’ lacked bacteria and plant compounds, and only contained media (100 µl of MHB

broth in the 11th

well). The “untreated control” lacked plant compounds, but contained

growing bacteria (positive control: 10 µl bacterial culture and 100 µl of sterile MHB media

in 12th

well).The MIC was defined as the minimum concentration of the extract that did not

allow any visible growth or turbidity of the organism in broth. MIC90 refers to

concentration of the test compound required to prevent the growth of 90% of organisms

tested. For each compound the MIC was tested for the nine isolates in duplicates. The

concentration at which all the isolates failed to grow is taken as MIC.

3.14 Screening of K. pneumoniae for biofilm formation

In this method, test strains were cultured on fresh brain heart infusion agar (BHI) plate

and inoculated in sterile brain heart infusion broth and incubated overnight at 37 °C

without shaking. The overnight culture was diluted to 0.5 McFarland standards in fresh

BHI medium. The modified Tissue Culture Plate (TCP) method was used for screening

biofilm formation in K. pneumoniae isolates (Christensen et al 1985; Mathur et al 2006). In

the TCP method, an overnight culture of each isolate was adjusted to a McFarland standard

of 0.5. An aliquot of 10 µl of the culture was added to 100 µL of the fresh BHI broth and

incubated overnight. After 24 h, the planktonic cells were aspirated, and wells were

washed with phosphate buffer saline (PBS, pH 7.2) to remove free floating bacteria.

Biofilms which adhered to the wells were fixed with 2% sodium acetate and stained with

0.1% crystal violet (0.1% w/v, aqueous solution, HiMedia Laboratories Pvt. Ltd., Mumbai,

India). Excess stain was washed with deionized water and plates were dried. The

absorbance of stained adherent bacteria (dried polysaccharides) were determined by Bio-

Rad Model iMark Micro plate Absorbance Reader at 595 nm. To compensate for

background absorbance, OD values from sterile medium well were averaged and

subtracted from all test values. The experiment was repeated twice. Each isolate was

38

analysed in triplicate. Thirty five clinical isolates and a control strain MTCC K.

pneumoniae 432 was screened by the TCP assay.

3.15 Quantitation of biofilm data

Biofilm forming potential of all 35 test cultures could be quantitatively compared as the

incubation was started with the same cell number for each of isolate. Further, free forming

(planktonic) cells did not contribute to biofilm formation since they were removed at the

start of the experiment. Therefore, varying amounts of biofilm formation by various

isolates could be quantitated by comparing OD values of stained adherent cells. Isolates

which gave an OD< 0.120 were classified as non-adherent and weak biofilm producers;

O.D. values of 0.120 to 0.240 were classified as moderately adherent and moderate biofilm

producers; O.D. value of > 0.240 was classified as strongly adherent and high biofilm

producers.

3.16 Microscopic determination of biofilm formation

The test strain was cultured in brain heart infusion broth. A sterile glass slide was kept

in a sterile petriplate and overlaid with 20 mL of test strain inoculated in Brain Heart

Infusion broth. After 24 and 48 h of incubation, the slide was taken out aseptically and

washed with phosphate buffer saline (pH 7.2) to remove free floating planktonic bacteria.

The biofilm was fixed with 2% sodium acetate and stained with 0.1% crystal violet stain,

washed and air dried. The slide was examined under Trinocular microscope at 100x oil

immersion. Photomicrographs of adhered bacterial biofilms were recorded (Christensen et

al 1985).

3.17 Biofilm inhibition assay

Only those isolates of K. pneumoniae which were classified as strong biofilm producers

were used. Test compounds were dissolved in DMSO (10 mg/mL), and two fold dilutions

were made to result in a final concentration ranging from 2 - 0.0078 mg/mL in the wells

after the addition of the freshly diluted brain heart infusion broth culture containing 106cfu

of the strong biofilm forming isolate per well. After incubation for 24 h at 37 ºC, the tissue

culture plate was washed, fixed and biofilms were stained and visualized as outlined

above. The inhibitory effect of the plant compound on biofilm production was calculated

by subtracting the media control. The MBIC is the concentration of the natural compound

39

at which the biofilm formation was reduced to an Absorbance 595 <0.12 OD. Each assay

for MBIC determination was performed in triplicate.

3.18 Statistical analysis

Statistical analyses were performed with MS-Excel 2010. Data are shown as mean ±

SD unless otherwise stated. For each bacterium, the biofilm formation assay was

performed in triplicates and the mean OD was taken for the analysis. The data from a total

of 35 bacteria were considered for the test. The biofilm formation of the bacteria was

significantly different at OD>0.240 and the level of significance were tested by Sign test as

the data were not normally distributed (Shapiro–Wilks statistics). The null hypothesis

H0:<0.240 against the alternative H1:=> 0.25 was tested. Statistical significance was set at

P< 0.05.

3.19 Collection of plant materials and Preparation of plant extracts:

The leaves of Tectona grandis, bark of Acacia nilotica, root of Hemidesmus indicus, the

white papery layer – rind of Punica granatum and whole fruit with seed of Syzygium

cumini were collected from different localities of Tamil Nadu and also from dealers of

traditional medicinal products. The plant materials were collected washed and shade dried

at room temperature. The dried plant material was powdered by using a mechanical

grinder. 500 grams of the powdered plant material was weighed and was soaked in 2 L of

ethanol and kept in the shaker for 72 hrs. The sample filtrate was then filtered with

Whatmann number 1 filter paper and then it was evaporated using Rotary vaccum

evaporator (KIKA-WERKE HB4 basic) then the residue was scraped and the percentage

yield of each plant was calculated.

40

Table 3.5 Medicinal plants taken for the study

S.NO. PLANT COMMON NAME PART USED FAMILY

1.

Tectona grandis

Tamil: Thekku

Hindi: Sagwan

Sanskrit: Saka

Leaves

Lamiaceae

2.

Punica granatum

Tamil: Madulam

Hindi: Anar

Sanskrit: Dadim

Papery

layer(rind)

Lythraceae

3.

Hemidesmus

indicus

Tamil: Nannari

Hindi: Anantamul

Sanskrit: Shirini

Root

Apocynaceae

4.

Syzygium cumini

Tamil: Navva

Pazham

Hindi:Jamun

Sanskrit: Rajajambu

Whole fruit

with seed

Myrtaceae

5.

Acacia nilotica

Tamil: karuvela

maram

Hindi: Babool

Sanskrit: Babbula

Bark

Fabaceae

41

Figure 3.1 Medicinal plants used for the study

3.20 Extraction and Partition of Plant extracts

The ethanolic extract of Tectona grandis leaves and rind of Punica granatum were

fractionated successively with n-hexane, chloroform, n-butanol and water (Shukla Nivedita

et al 2010). Dried leaves of Tectona grandis (1.0 Kg) and rind of Punica granatum (1.0

Kg) were extracted with ethanol (4 times). The combined extract was filtered and

concentrated under reduced pressure at 45oC to produce a dark brown viscous mass (120

gm). Part of this (100 gm) was dissolved in water and successively partitioned with n-

hexane, chloroform and n-butanol.

Figure 3.2 Rotary Vacuum Evaporator and Sequential extraction

42

3.21 Antibacterial assay

Antibacterial activity was tested by determining the minimum inhibitory concentration

(MIC) and minimum bactericidal concentration (MBC) (Stefanovic Olgica et al 2011)

using microdilution plate method with resazurin (Satyajit et al 2007). In the 96 well

micriplate, 150 µl of Mueller Hilton broth was added in the first column. In the other

coloums, 100 µl of MHB was added. The two-fold dilutions were made by adding 50 μl

aliquot of the stock solution of tested extract (concentration 100 mg/mL) into the first row

of the plate. Two-fold, serial dilutions were made by transferring 100 μl of solution from

one row to another using a multichannel pipette. The obtained concentration range was

from 25 mg/mL to 195µg/mL. Similarly ciprofloxacin concentration ranging from

50mg/mL to 195µg/ml dilution was obtained and 10 µl of culture corresponding to

0.5x106cfu was added to wells. Finally, 10μl of resazurin (0.62%) solution was added. The

inoculated plates were incubated at 37°C for 24 h. All tests were performed in duplicate

and MICs were constant. Minimum bactericidal concentration (MBC) was determined. The

MIC index (MBC/MIC) was calculated for each extract to determine whether an extract

has bactericidal (MBC/MIC≤4) or bacteriostatic (>4) MBC/MIC<32) or no effect on

growth of bacteria.

3.22 Combination assay

The synergistic interactions were evaluated by checkerboard method (Satish et al 2005).

Briefly, a series of twofold dilutions of ciprofloxacin concentration from its MIC to 1/32

MIC and a series of twofold dilutions of plant extracts concentration from its MIC to 1/32

MIC were prepared. The antibiotic and the plant extract were mixed together so that each

row (and column) in a microplate contained a fixed amount of one agent and increasing

amounts of the second agent. By this method, 36 different combinations of the antibiotic

and plant extract were tested. Each well contained unique combination of plant

extract/antibiotic concentration in a volume of 200 μl. Each well in microtitre plate was

inoculated with 10 μl of the bacterial suspension (0.5 McFarland Standard). The plate was

incubated at 37°C for 24 h. To analyse the growth, 10 μl of resazurin (0.62%) solution

was added to each well and incubated at 37 C for 2 hours. Color change from blue to pink

indicates the growth of bacterial inolculum. The concentration combination at which there

was no visible growth, i.e. the well before the color change was observed was taken for the

calculation of FIC. Each titre plate included growth control, solvent/vehicle control and

43

sterility control. In vitro interactions between antimicrobial agents were determined and

quantified by calculating the fractional inhibitory concentration index (FICI). FIC index

was calculated by MIC of plant extract in combination / MIC of plant extract alone + MIC

of antibiotic in combination/ MIC of antibiotic alone. Interpretation of the FIC index

(FICI), FICI ≤ 0.5 synergy; FICI > 0.5 to 4 indifference and FICI > 4 antagonism (Satish et

al 2005 et al; Roger LWhite et al 1996)

Figure 3.3 Checkerboard assay Template

(MIC E – MIC of Plant extract, MIC A – MIC of Antibiotic)

3.23 Time-kill assay

Time-kill indicates that 90 % of bacteria killed at 6 h are equivalent to a 99.9 % kill at

24 hours. In this study the kill measurement was determined by the actual reduction in

viable count at 6 hours for the bacterial isolate. The test strain was cultured overnight and

was adjusted to 0.5 McFarland standard. Time kill assay was performed with the antibiotic

and plant extracts at their respective Minimum inhibitory concentrations and synergistic

interactions. The cultures were incubated at 37 °C. For 0, 1, 2, 3, 4, 5, 6 and 7 h and an

aliquot of 100 μl was removed at each time interval and diluted with 10 mL sterile nutrient

44

broth. From the diluted suspension, 100 μl was spread on nutrient agar. After 24 h

incubation at 37 °C, the viability of microorganisms was evaluated by the presence of

colonies on the plates. The experiment was carried out in triplicate. (Konate, Mavoungou

et al 2012).

3.24 Norfloxacin efflux assay reagent preparation:

Norfloxacin (Mol.wt-319.33)

Stock10mM-weigh 0.003gm of norfloxacin and add half the volume of sterile water and

add 0.1M NaOH dropwise until the white precipitate dissolves, make up the volume with

sterile water to 1ml.

Table 3.6: Preparation of Norfloxacin

CHEMICAL STOCK WORKING ALIQUOTE(BUFFER)/ML

Norfloxacin

10mM

100µm

500µl/50mL

400µl/40mL

300µl/30mL

200µl/20mL

100µl/10mL

Potassium lactate (Mol. Wt-128.17)

Table 3.7: Preparation of Potassium lactate

CHEMICAL STOCK WORKING ALIQUOTE(BUFFER)/ML

Potassium lactate

1M 40mM 2ml/50mL

1ml/25mL

1.2ml/30mL

Potassium lactate

10mM 100µl/100mL

50µl/50mL

300µl/30mL

250µl/25mL

300µl/30mL

3.25 Glycine HCl (Mol.wt-111.53) (pH3.0)

Stock (0.1M), Working (100mM)

Weigh 1.1153gm of glycine HCl; dissolve in 70mL of water followed by adjusting the

pH to 3.0 by using NaOH pellet, and make up the final volume to 100mL.

45

3.26 CCCP (Carbonyl cyanide m-chlorophenylhydrazone)

(Mol.wt-204.62) Stock (10mM), Working (100µM)

Weigh 0.0102gm of CCCP; dissolve it in 5mL of distilled water. Add 80µl of 1M

NaOH to dissolve completely.

Table 3.8: Preparation of CCCP

CHEMICAL STOCK WORKING ALIQUOTE(BUFFER)/ML

CCCP

10mM

100µm

500µl/50mL

300µl/30mL

200µl/20mL

3.27 MgSO4 (Magnesium sulphate) (Mol.wt-246.47)

Weigh 1.2323gm of MgSO4; dissolve it in 50ml of distilled water.

Table 3.9: Preparation of MgSO4

CHEMICAL STOCK WORKING ALIQUOTE(BUFFER)/ML

MgSO4

100mM

10mM

10ml/100mL

5ml/50mL

3ml/30mL

2ml/20mL

3.28 Tris Buffer 1M (Mol.wt-121.14)

Weigh 12.14gm in 100mL of distilled water.

Table 3.10: Preparation of Tris Buffer

CHEMICAL STOCK WORKING ALIQUOTE(BUFFER)/ML

Tris

1M

0.2M

20ml/100mL

10ml/50mL

6ml/30mL

3.29 MOPS 1M (Mol.wt-209.26)

Weigh 10.46 gm of MOPS; dissolve it in 50mL of distilled water.

46

Table 3.11: Preparation of MOPS 1M

CHEMICAL STOCK WORKING ALIQUOTE(BUFFER)/ML

MoPS

1M

0.2M

20ml/100mL

10ml/50mL

6ml/30mL

0.2M MoPS- Tris +10mM MgSO4 (100mL)

Add 20mLof 1M MoPS solution + 20mL of 1M Tris buffer + 0.187gm of

EDTA+1.36gm of sodium acetate, dissolve it in 30mL of distilled water, to this add 10mL

of 10mM MgSO4. Adjust pH to 7.0 and make up the volume to 100mL.

0.2M MoPS+10mM MgSO4+10mM Potassium lactate (100mL)

To 99mL of 0.2M Mops and10mM MgSO4 solution, add 1mL of 1M potassium lactate

solution.

3.30 Norfloxacin accumulation assay

The test Bacterial strains were grown in the LB broth supplemented with 40 mM

potassium lactate to the late, exponential phase of growth under aerobic condition at 37 °C,

harvested, and the bacterial pellets were washed with 20ml of 0.2 M MOPS Tris buffer

(pH7.0) containing 10 mM MgSO4, after centrifugation at 10,000 rpm for 3minutes at 4 °C

the washed bacterial pellets were suspended in the same buffer to 50 mg (wet weight)/mL.

The assay mixture contained cells (10 mg (wet weight)/mL) in the same buffer and 10 mM

potassium lactate. For example, for a 30mL assay mixture 300mg (wet weight)/30mL)

bacterial pellet is needed. After incubation in shaker incubator at 37 °C for 5 minutes, 3mL

of the sample was collected and kept in ice. To the rest 27mL of the assay mixture 270µl of

10mM norfloxacin (100 mM, final concentration) was added to initiate the assay. Samples

(3 mL each) were taken at 5 minute intervals, like 5, 10, 15, up to 45 minutes, centrifuged

at 10,000 rpm for 3 minutes at 4 °C, and washed once with the same buffer. After 15

minutes of initiating, 180 µl of 10mM carbonyl cyanide m-chlorophenylhydrazone (CCCP)

was added to the assay mixture at 100 µM concentration to disrupt the proton gradient

across the membrane. The pellet was suspended in 3 mL of 100 mM glycine-HCl (pH 3.0).

The suspension was shaken vigorously for 1 hour at room temperature to release their

fluorescent contents and then centrifuged at 15,000 rpm for 10 min at room temperature.

47

The fluorescence of supernatants was measured (EX - excitation at 281 nm and EM-

emission at 440 nm) with a Shimadzu RF-5301pc fluorescence spectrophotometer. The

experiment was carried out in triplicate (Li, He et al 2002).

Figure 3.4 Norfloxacin Standards (EX-281, EM-440) by Spectrofluorometer

Table 3.12 Standardization of Norfloxacin value (EX-281, EM-440) by

Spectrofluorometer

Concentration of

Norfloxacin (nmol)

Spectrofluorimetric

Emission value(EX-281,EM-440) Average

Standard

Deviation

100 3.312 3.523 3.584 3.473 0.142727

200 6.624 7.742 6.681 7.01566667 0.629668

300 9.841 9.921 11.233 10.3316667 0.781602

400 13.448 12.99 13.529 13.3223333 0.290645

500 16.242 16.971 17.025 16.746 0.437311

600 20.049 21.022 20.889 20.6533333 0.527576

700 23.372 24.955 22.842 23.723 1.09936

800 26.483 26.561 27.028 26.6906667 0.294731

900 29.059 30.541 28.777 29.459 0.947589

1000 32.996 33.246 36.948 34.3966667 2.213052

0

5

10

15

20

25

30

35

0 100 200 300 400 500 600 700 800 900 1000

Flu

ore

scen

ce in

ten

sity

Norfloxacin concentration (nmol)

Norfloxacin

Linear

(Norfloxacin)

48

3.31 Preparation of 0.2%Tetrazolium chloride dye

0.2% solution of tetrazolium chloride (Hi-Media, INDIA) dye was prepared in

autoclaved distilled water and to indicate the presence of uninhibited bacterial growth (a

pink/purple colour) or the inhibition (colourless) of bacterial growth. Tetrazolium dye is an

indicator which is colourless in its oxidised form, but pink when it is reduced. When

organism metabolism carbon compounds they make waste products that serve as reducing

reagents and called as reductants or electron donors. Thus, reductants or electron donors

will reduce tetrazolium into pink colour however the oxidised form is colourless.

3.32 Chromatographic Analysis of medicinal plant extracts

Thin Layer Chromatography (TLC) was performed for the fractions ofethanolic extract

of Tectona grandis leaves and rind of Punica granatum to determine the best solvent for

the column chromatography as well as bioautography (El-Baroty et al 2010; Iqbal Ahmad

& Arina, 2001). A set of twoplates (5 x 20 cm, silica gel G, 60F 254 Merck, Darmstadt,

Germany) were used one plate foreach bacterial strain and in each experiment, a 5 μl

(0.5mg) of the ethanolic plant extract was applied to each plate. The plates were then

developed with the solvent system which was standardized for best resolution, the solvent

proportion which was standardized for Tectona grandis is Dichloromethane and water in

the ratio of 10:1 and for Punica granatumis Toluene, Ethyl acetate, Formic acid and

Methanol in the ratio of 3: 3: 0.8: 0.2 was used for running the silica gel TLC plate. The

developed TLC plates were dried. One of the strips was inspected under UV light (254 nm)

and also by visualization with 1% p-Anisaldehyde – sulfuric acid reagent by spraying

(Anisaldehyde, glacial acetic acid and sulphuric acid in the ratio of 0.5: 50: 1) and then

heated at 105°C until maximum visualization of spots; the second was used for the

bioautography assay.

49

3.33 TLC-Bioautography

A TLC bioautography assay was used to detect active components in ethanolic extract

of Tectona grandis leaves and rind of Punica granatum as well as the most bio-active

constituents (as antibacterial agent). This was done by running the TLC plates using the

solvent system mentioned above and the developed plates were placed in a sterile

petriplate, log phase culture was added to the semi-solid nutrient agar medium at palm

bearable temperature and mixed slowly and poured over the chromatograms. Plates were

incubated at 37ºC, for 24 hours. Zone of inhibition of bacterial growth could be seen

around the active chromatogram spot and 0.1% 2,3,5-Triphenyl tetrazolium chloride (TTC)

media individually distributed over theTLC plate (second) was then incubated at 37°C for

48 h. Inhibition zones were shown as clear areas against a pink background (El-Baroty G S

et al 2010). Visualization of these zones is usually carried out using dehydrogenase

activity-detecting reagents; the most common are tetrazolium alts. The dehydrogenase of

living microorganisms converts tetrazolium salt into intensely colored formazan.As a

result, cream white spots appear against a pink background on theTLC plate surface,

pointing the presence of antibacterial agents (Irena M Choma & EdytaM Grzelak, 2011).