Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular...

58
Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Transcript of Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular...

Page 1: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Chapter 16

Transcription and Posttranscriptional Processing

The term transcription in molecular biology means RNA

biosynthesis.

Page 2: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

In 1955 Francis Crick hypothesized that there were intermediate molecules which participated in trans-

ferring genetic information from DNA to protein.

The intermediate molecule was RNA.

In 1958 he put forth the famous central dogma.

--- --DNA-------- RNA------ protein -------- Temin 1970

Page 3: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

In 1961 the DNA dependent RNA polymerase was discovered

in E coli and the study on the mechanism of transcription began.

In 1982 Thomas Cech discovered that one of the precursor

RNA in Tetrahymena chould act as a catalyst and catalyzed

self-splicing. It is a ribozyme.

Page 4: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Section 1

DNA dependent RNA synthesis

RNA synthesis is catalyzed by DDRP ( or simply RNA

polymerase. )

Page 5: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Characteristics of RNA synthesisTemplate DNA ( one strand DNA in dsDNA, template strand )

Substrate four kinds of NTP

Enzyme DDRP ( no reqirement of primer, no proof-reading function )

Direction ofRNA chain 5’ to 3’ synthesis

Base pairing GC TA AU rule Inorganic Mg++ Zn++ ion

Page 6: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The process of transcription can be divided into three stages:

initiation, elongation and termination.

see the fig. on the blackboard

Page 7: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The two strands in dsDNA are complementary.

They are the coding strand and the template strand.

The template strand works as the template for the synthesis of RNA.

The synthesized RNA is complementary to the template strand.

Its sequence is the same as that of the coding strand with the exception of the substitution of U for T.

Page 8: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

eg. 5’ CGCATTAACG 3’ coding strand

3’ GCGTAATTGC 5’ template strand

5’ CGCAUUAACG 3’ RNA transcript

The Reaction

( NMP )n + NTP ---------- ( NMP )n+1 +PPi

Page 9: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Asymmetric Transcription

--------------- ----------------

________________________________________________

________________________________________________

---------- -----------

In dsDNA one strand is coding strand. It is not transcribed.

The other strand is template strand. It is transcribed.

In a segment of dsDNA the coding information of genes may

be in different strands.

Page 10: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

RNA polymerase

There is only one type of RNA pol in prokaryotes while

there are three types of RNA pols in eukaryotes.

E coli RNA polymerase

E coli RNA pol catalyzes synthesis of all the RNAs ( mRNA , rRNA , tRNA etc )

Page 11: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Structure of E coli RNA polymerase

The holoenzyme of E coli RNA pol contains α2ββ’(ω)σ subunits

The σ subunit can be dissociated from the holoenzyme.

The RNA pol without σ subunit is called core enzyme: α2ββ’(ω)

Page 12: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Function of the Subunit

σ can recognize promoters and initiate transcription.

α can bind regulatory proteins and control the transcriptional . rate.

β+β’ catalyzes RNA synthesis.

There may be ω subunit. Its function is unknown.

There are different kinds of σ subunits. The most common one is σ70.

Page 13: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Eukaryotic RNA polymerases

RNA pol I RNA pol II RNA pol III____________________________________________________ Product 45SrRNA hnRNA tRNA synthesized ( precursor ( precursor 5SrRNA precursors of 18S, 28S of mRNA) snRNA 5.8S rRNAs)____________________________________________________ Sensitivity to no high intermediate α-amanite____________________________________________________

Page 14: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Structure of Eukaryotic RNA pols

Each type of eukaryotic RNA pols contains two different large

subunits and ten odd small subunits.

The largest subunit of RNA pol II contains consensus sequence

at the carboxyl terminal called CTD.

CTD is composed of several dozens of heptad ( YSPTSPS )

repeats.

Page 15: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

CTD Function

RNA pol II with the unphosphorylated CTD participates in the beginning of transcriptional initiation.

During the process of intiation many Ser and some Tyr residues of CTD are phosphorylated.

RNA pol II with the phosphorylated CTD fulfills the initia- tion and leaves the promoter.

RNA synthesis enters in the stage of elongation.

Page 16: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Prokaryotic Transcriptional Initiation

Prokaryotic RNA pol binds the promoter and initiates transcrip- tion.

Promoter : DNA sequence that is usually upstream of a gene’s coding sequence and that RNA pol binds and initiates transcrip- tion.

σ subunit can recognize the promoter

E coli promoters extend from –70 to +30 of the initiation site (+1)

Page 17: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Most of them have two regions of consensus sequence , the-35 region ( TTGACA ) and the -10 region ( Pribnow box TATAAT ).

σ70 can recognize the consensus sequence.

Some promoters of genes with high transcriptional rate have another consensus region , the AT-rich up-element (-40 to -60 ) which α subunit binds.

The holoenzyme of RNA pol binds the promoter via σ subunit.

Page 18: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

strong promoter / weak promoter

It is the -35 and -10 regions and the distance between them and the distance between –10 region and the transcriptionnal initiation site , that determines the transcriptional rate.

The more similar the –35 and –10 regions of a promoter to the consensus sequences of TTGACA and TATAAT , the stronger affinity it has for RNA pol binding.

That results in the higher transcriptional rate.

And vice versa.

Page 19: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Process of Prokaryotic Trancriptional Initiation

RNA pol recognizes and binds the promoter.

That forms a close transcription complex.

DNA double helix near –10 region unwinds.

That results in an open transcription complex.

Transcription begins. A triple-element complex of DNA,RNA pol and the newly synthesized RNA forms

The formation of the triple-element complex causes con- formation change.

Page 20: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

RNA pol leaves the promoter and elongation begins.

As the elongation begins the σ subunit dissociates from RNA pol.

It is the core enzyme of RNA pol that is responsible for the elongation.

Page 21: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Eukaryotic Transcriptional Initiation

Eukaryotic RNA pols alone can not initiate transcription.

Only with the help of transcription factors can they fulfill the task of initiation.

Transcriptional initiation of RNA pol II needs not only the enzyme but also multiple transcription factors.

Page 22: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

There are consensus sequences in many of the RNA pol II recognized promoters.

They are –30 region ( TATA box ) and +1 region ( the ini- tiation site , initiator , Inr ).

The initiation stage of RNA pol II can be divided into two steps : the assembly step and the initiation step.

Page 23: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The Assembly Step

TBP ( TATA-binding protein ) binds TATA box.

TFIIB ( or with TFIIA ) binds TBP and promoter.

With the help of TFIIF , RNA pol II- TFIIF complex inter- actes with TFIIB and binds TFIIB and promoter.

Then TFIIE and TFIIH join them.

RNA pol II and the TFII factors form a close initiation com- plex on the promoter.

Page 24: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The Initiation Step

TFIIH has both the helicase and the kinase activities.

It unwinds dsDNA.

The close initiation complex becomes the open initiation com- plex.

TFIIH also catalyzes phosphorylation of CTD.

RNA pol II with phosphorylated CTD initiates transcription.

Page 25: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The Initiation Stage of RNA pol I or RNA pol III

The initiation stage of RNA pol I or RNA pol III is similar to that of RNA pol II.

The transcription factors recognize and bind the promoter.

RNA pol I or RNA pol III joins them to form an initiation complex.

Initiation begins.

Page 26: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Initiation Stage of RNA pol I

rDNA ( contains genes of 18 S rRNA, 28 S rRNA and 5.8 S rRNA ) is transcribed by RNA pol I. The product is 45SrRNA

There are two consensus sequences in rDNA promoter : core element ( +1 region ) and UCE ( upstream control element ).

Transcription factor UBF binds UCE first.

Then transcription factor SL1 binds core element.

RNA pol I joins them. They form a complex on promoter.

Initiation begins.

Page 27: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

RNA pol III initiates transcription of 5SrRNA gene or tRNA gene.

There are internal promoters in such genes.

Internal promoter means the promoter within the coding region of the gene.

tRNA gene’s promoter has two consensus sequences : A box and B box, while 5SrRNA gene’s promoter has only one con- sensus sequence : C box.

Page 28: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Transcriptional Initiation of 5SrRNA Gene

TFIIIA binds C box.

TFIIIC and TFIIIB bind TFIIIA.

RNA pol III binds them. A complex is formed.

RNA pol III initiates transcription.

Page 29: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Initiation RNA pol I RNA pol III RNA pol II__________________________________________________ATP requirement no no yes__________________________________________________ A and B or TATA box core consensus sq. core element C box Inr __________________________________________________ CAAT box upstream element UCE GC box etc__________________________________________________ general TFs SL1 TFIIIA B C various TFIIs___________________________________________________ upstream factors UBF various up- stream factors_____________________________________________________

Page 30: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Transcriptional Termination

There are two types of transcriptional termination in prokaryotes ρ independent and ρ dependent.

ρ independent termination

There are two characteristics of ρ independent termination sq.( terminator ).

A segment of GC-rich , self-complementary sq.

It is followed by a series of T. eg

GCCGCCAGTTCGGCTTGCCGCCTTTT

Page 31: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The RNA synthesized is also self-complementary and forms a stem-loop structure followed by aseries of U. U U 5’ GCCGCCAG C CGGCGGUC U U GG U U U 3’

RNA pol interacts with the structure and stops at the template

The UA pairs are unstable. The newly synthesized RNA re- leases from the template. Transcription terminates.

Page 32: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

ρ dependent termination

The terminator of the ρ dependent termination is not typical.

It contains CA-rich region which ρ factor can recognize.

ρ factor is a homo-hexamer protein factor , can bind the newly

synthesized RNA and moves to the RNA-DNA hybrid region.

ρ factor has helicase activity and unwinds the RNA-DNA helix depending on the energy released from ATP hydrolysis.

Page 33: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Section 2 Posttranscriptional Processing

Mature eukaryotic mRNA has experienced 5’- and 3’ end processing and splicing.

hnRNA ( or mRNA ) is capped at 5’ end

Most hnRNA have a cap of 7-methylguanosine triphosphate( m7Gppp-) at the 5’ end.

It is added to the 5’ end of the growing transcript of 25-30 nucleotides via 5’5’ triphosphate linkage.

The cap protects hnRNA ( and mRNA ) from Rnase attack and participates in the binding of mRNA and ribosome.

Page 34: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

hnRNA ( or mRNA ) has a poly A tail at the 3’end

Almost all of eukaryotic hnRNAs ( or mRNAs ) have a poly A tail of 80-250 nucleotides at the 3’end.

It is enzymatically added to the primary transcript intwo stages.

Cleavage

The transcript is cleaved 10 to 30 nucleotides past a highly conserved AAUAAA sq ( the polyadenylation signal sq ) and within 50 nucleotides before a GU-rich sq.

Page 35: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

10-30nts < 50nts-----------AAUAAA----------------I-------------------GU-rich— cleavage site

Polyadenylation

The poly A tail is subsequently generated from ATP through stepwise action of poly A polymerase.

Multiple enzymes and protein factors participate in the two stages.

Page 36: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Splicing.

Split Gene , Exon and Intron

Eukaryotic genes consist of alternating coding and non-

coding sequences. In other words the coding sq of eu-

karyotic genes is not continuous.

They are split genes. The coding sq in the split gene is

called the exon, the non-coding sq, the intron.

Page 37: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

hnRNA is co-linear to its template DNA except the cap and

the tail.

It also contains alternating exons and introns.

The coding sq of mRNA is continuous.

hnRNA following excision of introns and connection of

exons becomes mRNA. This process is called splicing.

Page 38: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The Mechanism of Splicing

There are consensus sequences at the junctions of exon and intron . They are called splice sites.

The shortest splice sites at the 5’ end ( splice donor ) and 3’ end ( splice acceptor ) of the intron are GU and AG respec- tively.

Upstream of AG there is a branch point A .

exon 1 intron exon 2========GU-----------------------A-----AG============= splice donor branch point splice acceptor

Page 39: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The branch point A initiates nucleophilic attack at the 5’end

of the intron. It is the first transesterification reaction.

------------------

=========GU-----------------A-------AG=============

Exon1 is released. Intron forms a lariat.

-----G

==========OH -----A------AG=============

Page 40: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The 3’end of exon 1 initiates nucleophilic attack at the 3’ end of the intron. It is the second transesterification reaction.

===========OH >

G -----A------AG=============

Exon1 and exon2 are connected. Lariat form of intron is re- leased. Splicing is completed.

============ =================

G -----A------AG

Page 41: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The previously described splicing takes place in the spliceosome.

Spliceosome contains snRNPs which are composed of snRNAs and proteins.

snRNAs in snRNPs are U-rich, and called URNAs.

There are 5 URNAs.

.The process of splicing in the spliceosome includes spliceo- some assembly, spliceosome activation and splicing

Page 42: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

An eukaryotic gene may direct transcription of different hnRNAs from different promoters or using different poly- adenylation sites.

There are two promoters in glucokinase gene.

In the liver cell transcription initiates from the second pro- moter which is near the coding sq, while in the pancreatic β cell transcription initiates from the first promoter which is upstream located.

This is an example that one gene can express different hnRNAs ( and mRNAs ).

Page 43: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

In the different developmental stages of lymphocyte B 3’ end processing of the hnRNA of μ chain can use dif- ferent polyadenylation sites and yield different hnRNAS ( and mRNA )

This is another example.

Alternative Splicing Provides for Different mRNAs from the Same hnRNA

The mechanism of alternative splicing includes the selective inclusion or exclusion of exons, the use of alternative 5’do- nor or 3’ acceptor sites.

Page 44: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

exon1 exon2 exon3========-----------=====-------=============hnRNA

splicing1 (mRNA1) splicing2 (mRNA2) exon1 exon2 exon2 exon3======== ===== ===== =============

splicing3 (mRNA3) exson1 exon2 exon3 ======== ===== ==============

Page 45: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

hnRNA===========-------======------------===============2 donor sites in exon1 2 acceptor sites in exon3

3mRNAs

=========== ====== ============== exon 1+2+3

====== ====== ============== part of exon 1+e2+e3

=========== ====== ====== e1+e2+ part of exon 3

Page 46: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

rRNA precursor processing requires Rnases

prokaryotic 30SrRNA precursor----

methylation ---- Rnases cut ----

precursors of 23SrRNA, 16SrRNA 5SrRNA

and tRNA---- Rnases cut ---- 23SrRNA

16SrRNA , 5SrRNA and tRNA

Page 47: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

eukaryotic 45SrRNA precursor----methylation

-----snoRNP mediated processing----precursors

of 18SrRNA , 28SrRNA , 5.8SrRNA ----snoRNP

mediated processing ---- 18SrRNA , 28SrRNA ,

5.8SrRNA

Page 48: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

tRNA precursor processing

tRNA precursor processing in prokaryotes and eukaryotes are similar.

It includes 5’end cutting 3’end cutting and CCA adding (if there isn’t CCA) splicing (if there is intron , splicing takes place via enzymatic cutting and joining) base modification.

Page 49: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Self-splicing Catalyzed by RNA

In 1982 T. Cech discovered that the intronof Tetrahymena

rRNA precursor could catalyzed self-splicing.

The intron that can catalyze self-splicing belongs to the group I intron.

Group I intron catalyzes self-splicing with the help of cofactor guanosine or guanosine phosphate

Page 50: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

The self-splicing includes two transesterfication reactions

5’=============---------------------==============3’ exon 1 exon 2

5’=============----------------------==============3’ G-OH G-OH attacks the first nucleotide at the 5’end of the intron.

Exon 1 is released.

5’=============OH G--------------------============3’

Page 51: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Exon 1’s 3’end attacks the nucleotide at the 3’ end of the intron. G----------------=================3’ 5’==============OH

Two exons are connected. The intron is released.

5’============== ==================3’

G---------------OH

Page 52: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

There are group II introns , which can also catalyze self- splicing.

They catalyze self-splicing just like the previously mentioned lariat-form splicing.

It also includes two transesterification reactions but does not take place in spliceosome and does not require any cofactor.

Group I and group II introns are ribozymes.

Page 53: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Some mRNAs Undergo Editing

Coding information can be changed at the mRNA level by

RNA editing.

In such cases the coding sq of the mRNA differs from that

in the cognat DNA.

RNA editing is discovered first in protozoan and mediated

by g-RNA.

Page 54: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Some nucleotides can be changed in or added into or deleted from the mRNA coding sq by RNA editing.

That results in change of the genetic codon and / or the reading frame of the coding sq.

The expressed protein is changed.

Page 55: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

An example of human RNA editing is the apolipoproteinB mRNA.

In liver the single apoB gene is transcribed into an mRNA that directs the synthesis of a 100 Kda protein .

In the intestine the same gene directs the synthesis of the primary transcript however acytidine deamination converts a CAA codon in the mRNA to UAA at a single specific site.

Rather than encoding glutamine this codon becomes stop codon and a 48 Kda protein is the result.

Page 56: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Section 3 RNA dependent RNA synthesis

RNA as genetic material

All plant viruses, several bacteriophages and many animal viruses have genomes consisting of RNA.

There are three types of RNA genomes : dsRNA, ssRNA and two copies of the same ssRNA.

The dsRNA and ssRNA are replicated by RNA replicase( RNA dependent RNA polymerase, RDRP ).

Page 57: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

In most cases RNA genome is single stranded.

There are two subtypes of ssRNA genomes the +ssRNA and the –ssRNA.

+ssRNA genome functions both as genetic material and mRNA, while –ssRNA genome serves only as genetic material.

Viruses with ssRNA genomes use the ssRNA as a template for the synthesis of a complement strand , which can then serve as template in replicating the original strand.

Page 58: Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis.

Retroviruses have two copies of the same ssRNA as the genome.

They carry the reverse transcriptase.

It has three enzymatic activities : RDDP , DDDP and Rnase H