Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is...
Transcript of Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is...
![Page 1: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/1.jpg)
1
Central Dogma of Molecular Biology
![Page 2: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/2.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
![Page 3: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/3.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
• Shared spatially (eyes, ears, heart etc.)
![Page 4: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/4.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle
to tomb)
![Page 5: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/5.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle
to tomb)
• What changes is what exactly
![Page 6: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/6.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle
to tomb)
• What changes is what exactly, and how much, each cell “produces”
at any given moment
![Page 7: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/7.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle
to tomb)
• What changes is what exactly, and how much, each cell “produces”
at any given moment
• To “first order” the products are proteins
![Page 8: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/8.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle
to tomb)
• What changes is what exactly, and how much, each cell “produces”
at any given moment
• To “first order” the products are proteins and the two-stage process
involves
• transcription: an imprint of the DNA is taken by mRNA
![Page 9: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/9.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle
to tomb)
• What changes is what exactly, and how much, each cell “produces”
at any given moment
• To “first order” the products are proteins and the two-stage process
involves
• transcription: an imprint of the DNA is taken by mRNA
• translation: the mRNA is used to guide the assembly of proteins
![Page 10: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/10.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle
to tomb)
• What changes is what exactly, and how much, each cell “produces”
at any given moment
• To “first order” the products are proteins and the two-stage process
involves
• transcription: an imprint of the DNA is taken by mRNA
• translation: the mRNA is used to guide the assembly of proteins
• Protein production can be regulated by transcription factors which
• bind to specific DNA sites (Transcription Factor Binding Sites)
![Page 11: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/11.jpg)
1
Central Dogma of Molecular Biology
• DNA is merely the blueprint
• Shared spatially (eyes, ears, heart etc.) and temporally (from cradle
to tomb)
• What changes is what exactly, and how much, each cell “produces”
at any given moment
• To “first order” the products are proteins and the two-stage process
involves
• transcription: an imprint of the DNA is taken by mRNA
• translation: the mRNA is used to guide the assembly of proteins
• Protein production can be regulated by transcription factors which
• bind to specific DNA sites (Transcription Factor Binding Sites)
• regulate transcription rate of proximal genes
![Page 12: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/12.jpg)
2
Transcription initiation of the glnA gene in E. coli
![Page 13: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/13.jpg)
3
Motif finding
• Do these sequences share a common TFBS?
• tagcttcatcgttgacttctgcagaaagcaagctcctgagtagctggccaagcgagctgcttgtgcccggctgcggcggttgtatcctgaatacgccatgcgccctgcagctgctagaccctgcagccagctgcgcctgatgaaggcgcaacacgaaggaaagacgggaccagggcgacgtcctattaaaagataatcccccgaacttcatagtgtaatctgcagctgctcccctacaggtgcaggcacttttcggatgctgcagcggccgtccggggtcagttgcagcagtgttacgcgaggttctgcagtgctggctagctcgacccggattttgacggactgcagccgattgatggaccattctattcgtgacacccgacgagaggcgtccccccggcaccaggccgttcctgcaggggccaccctttgagttaggtgacatcattcctatgtacatgcctcaaagagatctagtctaaatactacctgcagaacttatggatctgagggagaggggtactctgaaaagcgggaacctcgtgtttatctgcagtgtccaaatcctat
![Page 14: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/14.jpg)
3
Motif finding
• Do these sequences share a common TFBS?
• tagcttcatcgttgacttctgcagaaagcaagctcctgagtagctggccaagcgagctgcttgtgcccggctgcggcggttgtatcctgaatacgccatgcgccctgcagctgctagaccctgcagccagctgcgcctgatgaaggcgcaacacgaaggaaagacgggaccagggcgacgtcctattaaaagataatcccccgaacttcatagtgtaatctgcagctgctcccctacaggtgcaggcacttttcggatgctgcagcggccgtccggggtcagttgcagcagtgttacgcgaggttctgcagtgctggctagctcgacccggattttgacggactgcagccgattgatggaccattctattcgtgacacccgacgagaggcgtccccccggcaccaggccgttcctgcaggggccaccctttgagttaggtgacatcattcctatgtacatgcctcaaagagatctagtctaaatactacctgcagaacttatggatctgagggagaggggtactctgaaaagcgggaacctcgtgtttatctgcagtgtccaaatcctat
![Page 15: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/15.jpg)
4
If only life could be that simple
• The binding sites are almost never excatly the same
• A more likely sample is:
tagcttcatcgttgactttTGaAGaaagcaagctcctgagtagctggccaagcgagctgcttgtgcccggctgcggcggttgtatcctgaatacgccatgcgccCTGgAGctgctagaccCTGCAGccagctgcgcctgatgaaggcgcaacacgaaggaaagacgggaccagggcgacgtcctattaaaagataatcccccgaacttcatagtgtaatCTGCAGctgctcccctacaggtgcaggcacttttcggatgCTGCttcggccgtccggggtcagttgcagcagtgttacgcgaggttCTaCAGtgctggctagctcgacccggattttgacggaCTGCAGccgattgatggaccattctattcgtgacacccgacgagaggcgtccccccggcaccaggccgttcCTaCAGgggccaccctttgagttaggtgacatcattcctatgtacatgcctcaaagagatctagtctaaatactacCTaCAGaacttatggatctgagggagaggggtactctgaaaagcgggaacctcgtgtttattTGCAttgtccaaatcctat
![Page 16: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/16.jpg)
5
The dual face of motif finding
• Motif finding really consists of two problems:
![Page 17: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/17.jpg)
5
The dual face of motif finding
• Motif finding really consists of two problems:
• finding the most pronounced motifs in the text
![Page 18: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/18.jpg)
5
The dual face of motif finding
• Motif finding really consists of two problems:
• finding the most pronounced motifs in the text
• statistical significance: are they merely artifacts of the size of the
data?
![Page 19: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/19.jpg)
5
The dual face of motif finding
• Motif finding really consists of two problems:
• finding the most pronounced motifs in the text
• statistical significance: are they merely artifacts of the size of the
data?
• In the remaining few minutes I will touch on the second problem
![Page 20: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/20.jpg)
6
Assessing the significance of a putative motif
![Page 21: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/21.jpg)
6
Assessing the significance of a putative motif
• Begin with the aligning the motif occurrences:
tTGaAGCTGgAGCTGCAGCTGCAGCTGCttCTaCAGCTGCAGCTaCAGCTaCAGtTGCAt
![Page 22: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/22.jpg)
6
Assessing the significance of a putative motif
• Begin with the aligning the motif occurrences:
tTGaAGCTGgAGCTGCAGCTGCAGCTGCttCTaCAGCTGCAGCTaCAGCTaCAGtTGCAt
then create the alignment matrix:
A 3 1 9
C 8 8
G 7 1 8
T 2 10 1 2
![Page 23: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/23.jpg)
6
Assessing the significance of a putative motif
• Begin with the aligning the motif occurrences:
tTGaAGCTGgAGCTGCAGCTGCAGCTGCttCTaCAGCTGCAGCTaCAGCTaCAGtTGCAt
then create the alignment matrix:
A 3 1 9
C 8 8
G 7 1 8
T 2 10 1 2
which you then summarize with the
entropy score:
•I :=
∑column i
∑letter j
nij lognij/n
qj(n = 10)
![Page 24: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/24.jpg)
7
What’s in a score?
• By itself, the entropy score s of a particular motif has limited use
![Page 25: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/25.jpg)
7
What’s in a score?
• By itself, the entropy score s of a particular motif has limited use
• we cannot compare scores of alignments with varying depth or
width
![Page 26: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/26.jpg)
7
What’s in a score?
• By itself, the entropy score s of a particular motif has limited use
• we cannot compare scores of alignments with varying depth or
width
• The solution is to assess the statistical significance of s
![Page 27: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/27.jpg)
7
What’s in a score?
• By itself, the entropy score s of a particular motif has limited use
• we cannot compare scores of alignments with varying depth or
width
• The solution is to assess the statistical significance of s
• This is often accomplished by computing the p-value of the
observed score:
![Page 28: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/28.jpg)
7
What’s in a score?
• By itself, the entropy score s of a particular motif has limited use
• we cannot compare scores of alignments with varying depth or
width
• The solution is to assess the statistical significance of s
• This is often accomplished by computing the p-value of the
observed score:
. assuming the observed columns are randomly drawn from
the background frequencies {qa, qc, qg, qt}
![Page 29: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/29.jpg)
7
What’s in a score?
• By itself, the entropy score s of a particular motif has limited use
• we cannot compare scores of alignments with varying depth or
width
• The solution is to assess the statistical significance of s
• This is often accomplished by computing the p-value of the
observed score:
. assuming the observed columns are randomly drawn from
the background frequencies {qa, qc, qg, qt}. what is P0(I ≥ s)?
![Page 30: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/30.jpg)
7
What’s in a score?
• By itself, the entropy score s of a particular motif has limited use
• we cannot compare scores of alignments with varying depth or
width
• The solution is to assess the statistical significance of s
• This is often accomplished by computing the p-value of the
observed score:
. assuming the observed columns are randomly drawn from
the background frequencies {qa, qc, qg, qt}. what is P0(I ≥ s)?
• This is not as simple as it might look at first sight
![Page 31: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/31.jpg)
8
Can I submit two different answers?
MEME E-values compared with Consensus E-values (log10 scale)
![Page 32: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/32.jpg)
8
Can I submit two different answers?
MEME E-values compared with Consensus E-values (log10 scale)
• MEME is consistently pessimistic when compared with Consensus (by
a factor of over 500 at times)
![Page 33: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/33.jpg)
8
Can I submit two different answers?
MEME E-values compared with Consensus E-values (log10 scale)
• MEME is consistently pessimistic when compared with Consensus (by
a factor of over 500 at times)
• Who’s right?
![Page 34: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/34.jpg)
9
Our work
![Page 35: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/35.jpg)
9
Our work
• We developed a method that borrows ideas from large-deviation theory
to compute a reliable answer reasonably fast
![Page 36: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/36.jpg)
9
Our work
• We developed a method that borrows ideas from large-deviation theory
to compute a reliable answer reasonably fast
• The same underlying idea can be used for other fundamental statistical
problems
![Page 37: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/37.jpg)
9
Our work
• We developed a method that borrows ideas from large-deviation theory
to compute a reliable answer reasonably fast
• The same underlying idea can be used for other fundamental statistical
problems
• Joint work with: Neil Jones (Ph.D. student at UCSD)
![Page 38: Central Dogma of Molecular Biology - cs.cornell.edu visit day slides/compbio-uri.pdf · • DNA is merely the blueprint ... Central Dogma of Molecular Biology • DNA is merely the](https://reader031.fdocuments.in/reader031/viewer/2022022510/5ad91b007f8b9a9d5c8e286a/html5/thumbnails/38.jpg)
9
Our work
• We developed a method that borrows ideas from large-deviation theory
to compute a reliable answer reasonably fast
• The same underlying idea can be used for other fundamental statistical
problems
• Joint work with: Neil Jones (Ph.D. student at UCSD), Niranjan
Nagarajan (Ph.D. student here)