Joanna Klein, Ph.D.Northwestern Scholarship Symposium

May 10, 2013

Cellulophaga lyticaMarine bacterium of the

CFB groupIsolated from beach mud

near Limon, Costa Rica in 1969

http://www.infoplease.com/atlas/centralamerica.html

http://travel.yahoo.com/p-travelguide-482616-limon_vacations-i

Cellulophaga lyticaGram negative FilamentousYellow pigmentationExhibits gliding motilityDegrades cellulose

Cellulophaga lyticaTarget organism in the Genomic Encyclopedia of

Bacteria and Archaea (GEBA) Research Program of the Department of Energy/Joint Genome Institute

GEBA organisms 100 representative

organisms from each of the branches

Organisms with potential energy applications

C. lytica: Northwestern’s “microbial mascot”Interpret a genome for education

JGI Genome Annotation Workshop, Walnut Creek, CA, January 2011

Why study C. lytica?Model organism to understand the CFB

group betterContribute to biofuel research and

applicationsUnique method of motility: Gliding

Biofuel productionC. lytica produces a variety of

enzymes that may have applications in biotechnology and biofuel production

Ethanol productionEthanol produced as a byproduct of starch

degradation and subsequent fermentationWell developed technologyEnzymes digest starch into simple sugars

which are readily fermented by known microorganisms to produce ethanol

Issues…

Cellulosic ethanol productionGoal is to use the cellulose biomass found in

plant cell walls of leaves and wood to produce ethanolProblems to overcome:

Lignin, also found in cell wall, hinders digestion of cellulose from wood

Enzymes that digest cellulose into simple sugars are poorly understood

Organisms that ferment these simple sugars to produce ethanol are poorly understood

Can C. lytic help achieve this goal?Predicted to encode 3 cellulase enzymes

3 Cellulase genes of C. lytica

Cellulase 1Cellulase 2Cellulase 3

Plant Cell Wall

Cellulase Enzymes in C. lytica

Purpose: To determine if the predicted cellulase enzymes in C. lytica are capable of degrading cellulose.

Method: Evaluate an assay for cellulose degradation in

C. lytica Transfer a cellulase gene from C. lytica to E.

coli, which does not degrade cellulose, and determine if E. coli can now degrade cellulose.

Grow bacteria on agar plates for 48 hoursCover with top agar containing 1%

carboxymethylcellulose (CMC) and incubate 24 hours

Flood with Congo Red Congo red binds to CMCAreas where CMC has been degraded will not

be stained – zone of clearance

Cellulase Degradation Assay - Congo-Red Plate Assay

Congo Red Assay: E. coli TOP10 and C. lytica were grown on a TSA plate containing 2% Salt + 1% carboxymethylcellulose. After flooding with Congo Red and fixing the stain, a zone of clearing was observed around C. lytica but not around E. coli.

MethodTransfer a cellulase gene from C. lytica to E.

coli, which does not degrade cellulose, and determine if E. coli can now degrade cellulose.

PCR amplify a cellulase gene from C. lytica

Insert the cellulase gene into the TOPO-TA plasmid

Transfer the recombinant plasmid into E. coli TOP10

Expresses cellulase enzyme in E. coli

Determine if E. coli can degrade cellulose using the congo red plate assay

PCR Amplification

PCR amplification of cellulase 1 gene from C. lytica (lane 3)

3 of 5 clones had cellulase activity

Fugure WorkClone 2 remaining cellulase genes and test for

activityCellulase 3 gene was PCR amplified and cloned

into TOPO-TA vectorNone of the 10 clones exhibited cellulase activity

Verify correct plasmid constructionCellulase 2 failed in PCR amplification

Troubleshoot PCR procedure

Perform similar experiments with additional polysaccharide degrading enzymes from C. lytica

Gliding motility in C. lyticaGliding allows bacteria to move across

surfaces

Gliding Motility in C. lytica

Gliding MotilityResearch in Flavobacterium indicates over 20

proteins are involved in gliding cell membrane localization6 are lipoproteinsMany make “motor” that propels the cellsprB is thought to be a surface protein and

adhesin propelled along surface by motor

Genome Annotation of gliding motility genes of Cellulophaga lytica

Genetics students annotated 11 of these predicted gliding motility genesgldA Alyssa/Emily

gldF Not annotated

gldG Not annotated

gldH Kait/Alannah

gldD Isaac/Sam

gldI Brittany/Kristen

gldB Kayla/Josh

gldC David/Andy

gldE Drew/Aaron/Joey

gldK Naomi/Taylor

gldL Mac/Bri

gldM Ella/Nyemo

gldN Anna/Alyssa

What is annotation?One way to understand more about the life

processes of C. lytica is through a study of its genome.

GenomeAll of the genetic material, DNA, of an

organismDNA is made up 4 smaller molecules known as

the bases A,C,G &T

Genome projectsWe can easily determine the entire DNA

sequence of an organism – it’s genome.Currently, there are more than 3000

complete or nearly complete genome sequences of microbes available.

The complete genome of Cellulophaga lytica was sequenced by the DOE and published in 20113,765,936 bases

Genome Projects

TATCAAAGAGATGATTGAGAACTGGTACGGAGGGAGTCGAGCCGGGCTCACTTAAGGGCTACGACTTAAC GGGCCGCGTCACTCAATGGCGCGGACACGCCTCTTTGCCCGGGCAGAGGCATGTACAGCGCATGCCCACA ACGGCGGAGGCCGCCGGGTTCCCTGACGTGCCAGTCAGGCCTTCTCCTTTTCCGCAGACCGTGTGTTTCT TTACCGCTCTCCCCCGAGACCTTTTAAGGGTTGTTTGGAGTGTAAGTGGAGGAATATACGTAGTGTTGTC TTAATGGTACCGTTAACTAAGTAAGGAAGCCACTTAATTTAAAATTATGTATGCAGAACATGCGAAGTTA AAAGATGTATAAAAGCTTAAGATGGGGAGAAAAACCTTTTTTCAGAGGGTACTGTGTTACTGTTTTCTTG CTTTTCATTCATTCCAGAAATCATCTGTTCACATCCAAAGGCACAATTCATTTTGAGTTTCTTTCAAAAC AAATCGTTTGTAGTTTTAGGACAGGCTGATGCACTTTGGGCTTGACTTCTGATTACCCTATTGTTAAATT AGTGACCCCTCTTAGTGTTTTCCTGTCCTTTATTTCGGAGGACGCACTTCGAAGATACCAGATTTTATGG GTCATCCTTGGATTTTGAAGCTTATAACTGTGACAAAAAATGTGAAGGGAAGAGATTTGAAACATGTGGA AGGAAAAGTGAGTGCAGACTATAAACTTCCAAAAAGACAAGCCCAAAATACACCTAAACGTTATGTCAGA TTATTTTGTTAAAATCAGTTGTTAGTGACGTCCGTACGTTAATAGAAAAAAGAATGCTTCAGTTTGGAGT GGTAGGTTTCTAGAGGGATTTATTGTGAAAGTATAAACTATTCAGGGCAATGGGACTGAGAGAACAGTGG GTAGAAAGGACCACTGAAGGAAAGGAAGAGAATTGGAAGGTAGATGAAAGAAGGAGCAAGAACCTGGGGTGTTTTTTCCTTTTCACTTGTAATAGTAGTAACAGAAGCAATGGCAGACTGGCTTTTGTTTCTACTGTGT TAGAATGAATTGACAGGACAACTGGGCCTATTATTGTACTGTGCCAGAATACTGTAAAACAAAACTAAAC ATACTAGCTTGGTGGCTTGTAATTAATTACTTAAGTGGAGATTTTTATTTTTTTTTTATTTTTTTTTTAG ACGGAGTCTCACTTTGTCACCCAGGCTGGAGTGCAGTGGCGCGATCTCAGCTGACTGCAACCTCCTCCTC

Cellulase

Process of annotationAutomatic annotation - done automatically using

computer software

35% of computer generated annotations are wrong or are missing information due to limitations of computer algorithms

Manual Annotation – humans analyze the information generated by computers and make corrections as necessary. Labor intensive and time consumingSolution: Train students to participate in the

process

• IMG-ACT is a toolkit of online gene and genome analysis programs.

• Using IMG-ACT, students annotate genomes• provide human expertise necessary for

accurate, up-to-date, reliable annotation• Students contribute to the scientific

community and learn biological concepts through participating in original research

Annotation of Gliding Motility Genes in C. lytica

The computer based annotation of all 11 genes was confirmed through manual annotation by students

Genome annotation of C. lytica at NWC64 NWC students have participated in this

research projectScience Research Institute, Summer 2011Genetics, Fall 2011Microbiology, Spring 2012Genetics, Fall 2012Research Students

29 genes have been fully annotated10 genes have been partially annotated

Future work3,334 genes left to annotate!Study the function of interesting genes in the

lab

AcknowledgementsNWC students who have participated in this

research.Genetics, Microbiology and SRI coursesResearch students: Steven Erickson, Andy

Jaeger, Silas Baalke, Hannah Bardwell, Rachel Blesi, Trevor Diercks

Funding received from a 2012 Faculty Development Grant to purchase research supplies

Questions?