Ce

NS

ARRAA

KCTT

1

dsTlagrastdecis[

rr

I

l

0h

Cell Calcium 53 (2013) 366– 371

Contents lists available at SciVerse ScienceDirect

Cell Calcium

jo u rn al h om epage: www.elsev ier .com/ locate /ceca

ellular responses to TGF� and TGF� receptor expression in human colonicpithelial cells require CaSR expression and function

avneet Singh1, Guangming Liu, Subhas Chakrabarty ∗

immons Cancer Institute and Department Medical Microbiology, Immunology and Cell Biology, Southern Illinois University School of Medicine, Springfield, IL 62794-9677, USA

a r t i c l e i n f o

rticle history:eceived 7 January 2013eceived in revised form 11 March 2013ccepted 8 April 2013vailable online 29 April 2013

a b s t r a c t

CaSR and TGF� are robust promoters of differentiation in the colonic epithelium. Loss of cellular responsesto TGF� or loss of CaSR expression is tightly linked to malignant progression. Human colonic epithelialCBS cells, originally developed from a differentiated human colon tumor, retain CaSR expression and func-tion, TGF� responsiveness and TGF� receptor expression. Thus, these cells offer a unique opportunity

eywords:aSRGF� receptorsGF� response

in determining the functional linkage (if any) between CaSR and TGF�. Knocking down CaSR expressionabrogated TGF�-mediated cellular responses and attenuated the expression of TGF� receptors. Ca2+ orvitamin D treatment induced CaSR expression with a concurrent up-regulation of TGF� receptor expres-sion. Ca2+ or vitamin D, however, did not induce CaSR in CaSR knocked down cells and without CaSR;there was no up-regulation of TGF� receptor. It is concluded that TGF� receptor expression and TGF�mediated responses requires CaSR expression and function.

. Introduction

Transforming growth factor � (TGF�) is a robust promoter ofifferentiation in colonic epithelial cells and function as a tumoruppressor in the early stages of colon carcinogenesis [1–6]. Overall,GF� function by inhibiting cellular proliferation and induces cellu-ar differentiation. Thus, loss of responsiveness to TGF� is regardeds an important underlying mechanism contributing to the patho-enesis of colon cancer [5,7,8]. TGF� elicits a multitude of cellularesponses from TGF�-responsive human colon carcinoma cells thatre tightly linked to the induction of differentiation [9–13]. TGF�ignals through the cell-surface TGF� type I and II (RI and RII) recep-ors [3,14,15]. Therefore, loss of RI and RII expression or mutationalefects in these receptors are considered prominent mechanisms ofscape from the growth and differentiation control of TGF� duringolon carcinogenesis [5,7]. There is a high level of TGF� expressionn the upper portion of the colonic crypt epithelium by compari-

on to the rapidly proliferating cells at the basal portion of a crypt4]. Thus, the expression of TGF� in the normal colon is linked to

Abbreviations: TGF�, transforming growth factor �; CaSR, calcium sensingeceptor; shRNA–CaSR, shRNA expression vector targeting the CaSR; RIRII, TGF�eceptor RIRII.∗ Corresponding author at: Simmons Cancer Institute, P.O. Box 19672, Springfield,

L 62794, USA. Tel.: +1 217 545 9729.E-mail address: schakrabarty@siumed.edu (S. Chakrabarty).

1 This work was performed in partial fulfillment for the degree of doctor of phi-osophy.

143-4160/$ – see front matter © 2013 Elsevier Ltd. All rights reserved.ttp://dx.doi.org/10.1016/j.ceca.2013.04.003

© 2013 Elsevier Ltd. All rights reserved.

epithelial differentiation which is consistent with its role in growthand differentiation control [1–6].

In the parathyroid, the cell-surface G-protein coupled calcium-sensing receptor (CaSR) function unequivocally as a homoeostaticCa2+ detector and regulator [16–18]. However, CaSR is expressed ina variety of cells and tissues not involved in Ca2+ regulation [19–22].In the human colonic epithelium, the expression pattern of CaSR istightly linked to differentiation. Rapidly proliferating and undif-ferentiated colonic crypt stem cells do not express CaSR [23,24].CaSR expression progressively increases as these cells differenti-ate and migrate toward the apex of a crypt where CaSR expressionis most intense [23,24]. Conversely, undifferentiated tumors andcancer cells at the invasive front of a tumor do not express CaSR[23,24]. Overall, the expression of both CaSR protein and mRNAare significantly down-regulated in human colon tumors [23–25].These studies show that like TGF�, CaSR also play an important rolein growth and differentiation control and loss of CaSR expressionor function is also an important underlying mechanism and a keyevent in colon carcinogenesis [23,24,26–33]. Indeed, recent studiesshow a lot of similarities between CaSR function and that of TGF�[23,24,26–32].

The CBS human colonic epithelial cell line was originally devel-oped from a differentiated human colon tumor and is one of afew cell lines that retain the expression of TGF� receptors andresponsiveness to TGF� [9]. The CBS cells also express CaSR and

respond to the differentiation promoting effect of CaSR activation[23,24,26,27]. Thus, the CBS cells offer an opportunity to determinethe linkage (if any) between CaSR and TGF� function which is thegoal of this study. We knocked down the expression of CaSR by

N. Singh et al. / Cell Calcium 53 (2013) 366– 371 367

Fig. 1. Knocking down CaSR expression negated the ability of TGF� to inhibit cellular proliferation and stimulate TGF�-linked Smad4/DPC4-dependent 3TP-lux reportera ive iml ee indo

sodos3CbtCcodrsf

2

2

btmtSvcst

ctivities. (A) Real time RT-PCR analysis of CaSR mRNA expression; (B) quantitatuciferase activity. Results in A, C and D indicate the mean and standard error of thrf statistical significance.

hRNA in the CBS cells and then determined the consequencesf CaSR knocked down on TGF� mediated responses. Knockingown the expression of CaSR significantly attenuated the abilityf TGF� to inhibit cellular proliferation, suppress the expression ofurvivin and stimulate the TGF�-linked Smad4/DPC4-dependentTP-lux reporter activity. The attenuation of TGF� responses inaSR knocked down cells was mediated at the TGF� receptor levelecause knocking down CaSR expression led to a significant reduc-ion in TGF� RI and RII expression. Conversely, treatment of theBS cells with Ca2+ or vitamin D induced CaSR expression with aoncurrent up-regulation of RI and RII expression. However, Ca2+

r vitamin D could not induce CaSR expression in CaSR knockedown cells and without CaSR; there was no up-regulation of TGF�eceptor expression. It is concluded that TGF� receptor expres-ion and TGF� mediated responses requires CaSR expression andunction.

. Materials and methods

.1. Cell culture and treatment with TGFˇ, Ca2+ and vitamin D

Human colon epithelial CBS cells, shRNA–CaSR plasmid sta-ly transfected cells and shRNA-scrambled control plasmid stableransfectants were maintained in supplemental minimum essential

edium (SMEM). SMEM is essentially Ca2+-free, Minimum Essen-ial Medium Eagle Joklik Modification with l-glutamine (Sigma,t. Louis, MO) supplemented with sodium bicarbonate, peptone,

itamins, amino acids and 5% fetal bovine serum. Because serumontains Ca2+, the complete SMEM medium supplemented witherum contains a low amount of Ca2+ (0.175–0.2 mM). Construc-ion of the plasmids, transfection and selection have been described

munoblot of CaSR protein expression; (C) cellular proliferation and (D) 3TP-Lucependent experiments. * Indicates P ≤ 0.05 (unpaired Student’s t-test), differences

previously [29]. Actively growing cells were treated with TGF�by replenishing the culture medium with fresh medium contain-ing TGF� ((5 ng/ml) PeproTech Inc. Rocky Hill, NJ). The medium ofcontrol cells was replenished with medium without TGF�1. Cellswere incubated at 37 ◦C in a humidified CO2 incubator for the timeperiods as indicated in the assays described below and in the figurelegends. Cells were similarly treated with Ca2+ (1.4 mM CaCl2) orcalcitriol (1.0 �M), the active form of vitamin D. Cells were treatedwith Ca2+ or vitamin D for 48 h to induce an optimal expression ofCaSR.

2.2. Western blots

Western blotting was performed as previously described usingcommercially available primary and fluorescent tagged secondaryantibodies [29,32]. Primary anti-CaSR antibody was purchasedfrom Millipore (Billerica, MA). This antibody was raised againsta 20 amino acid peptide sequence near the C-terminus of humanCaSR and recognizes CaSR with a molecular size of 120–130 kDa onWestern blots under a reduced condition (information provided bymanufacturer and confirmed by us [32] and others [34]. Anti-CaSRantibody in the dilution of 1:1000 was used in all Western analyses.Antibodies binding to proteins of interest was detected and ana-lyzed by using the LI-COR ODYSSEY (LI-COR Biosciences, Lincoln,NE) instrument. Quantitative analysis of protein expression wasperformed using multi gauge-image version 2.0 software installedin the LI-COR ODYSSEY instrument. Densitometric fold increase or

decrease in protein expression, by comparison with control laneswas calculated. The numbers on the blots represent fold differencesin protein expression by comparison with control lanes with anassigned value of 1.

368 N. Singh et al. / Cell Calcium 53 (2013) 366– 371

F he expi ty; * in

2

bFApsgr�rse

FeI

ig. 2. Knocking down CaSR expression attenuated the ability of TGF� to inhibit tmmunoblot of survivin expression; and (B) survivin gene promoter reporter activi

.3. Real time RT-PCR

Real time RT-PCR was performed as described previously [32]. Inrief, Total RNA was extracted from cells using Tri reagent (Sigma).our microgram of total RNA was reverse transcribed using Revertid First strand cDNA synthesis kit according to the manufacturer’srotocol (Fermentas life Sciences, Glen Burnie, MD). Gene expres-ion levels were measured by real time RT-PCR using the SYBERreen PCR amplification kit (Promega, Madison, WI) in an ABI 7500eal-time PCR machine with specific primers for the target genes.-actin was used as internal control for equal loading of RNA and

elative fold expression was determined using the �� method. Datahown represent the mean and standard error of three independentxperiments.

Primer sequences used to amplify target genes were as follows:

CaSR (5′-3′) agctaaagatcaagatctca and (3′-5′) tgggaa-gaagggctgggctg.TGF�-RI (5′-3′) acggcgttacagtgtttctg and (3′-5′) gcacatacaaacggcc-tatct.

ig. 3. Knocking down CaSR expression down-regulated the expression of TGF�-RI and

xpression; and (B) quantitative immunoblot of TGF�-RI and RII protein expression. Rendicates P ≤ 0.05 (unpaired Student’s t-test), differences of statistical significance.

ression of survivin and survivin gene promoter reporter activity. (A) Quantitativedicates P ≤ 0.05 (unpaired Student’s t-test), differences of statistical significance.

TGF�-RII (5′-3′) ttcagaagtcggatgtggaaatg and (3′-5′) gttgtcagtgac-tatcatgtcgt.�-actin (5′-3′) tcctctcccaagtccacacagg and (3′-5′) gggcacgaaggct-catcattc.

Three independent experiments were performed. Statistical sig-nificance was calculated with unpaired Student’s t-test, P ≤ 0.05indicates a significant difference by comparison to control values.

2.4. Cell proliferation assay

Proliferation assays were performed as described previously in24-well culture plates [30]. Briefly, equal number of cells (5 × 104)were seeded into each well and allowed to attach overnight. Theculture medium was then changed to fresh medium with or with-out TGF� every 24 h. After 72 h of treatment, a Beckman Coulter

Vi-cellTM XR cell viability analyzer with automated cell countingfunction (Beckman Coulter, Miami, FL) was used to determine cellnumber. Error bars represent the mean and standard error of threeindependent experiments. Statistical significance was calculated

RII mRNA and protein expression. (A) Real time RT-PCR of TGF�-RI and RII mRNAsults indicate the mean and standard error of three independent experiments. *

alcium

wf

2

v2wlr[uea2bwetmtPv

3

3itT

dtelDirde

3d

[eedm

3cC

asscel[t

N. Singh et al. / Cell C

ith unpaired Student’s t-test, P ≤ 0.05 indicates a significant dif-erence by comparison to control values.

.5. Luciferase reporter assays

Luciferase reporter assays were performed as described pre-iously [24,30]. Briefly, cells were seeded into each well of a4-well culture plate and cultured to 70–80% confluence. Cellsere then transfected with 0.7 �g of either survivin promoter

uciferase reporter plasmid pLuc-2840 [30,35], or the artificial TGF�esponse element promoter luciferase reporter plasmid 3TP-Luc30,35] and 0.1 �g of Renilla luciferase reporter control plasmidsing LipofectamineTM 2000 (Invitrogen Life Technologies, Fred-rick, MD). TGF� was added 24 h after transfection, and luciferasectivities were measured and normalized to transfection efficiency4 h after TGF� treatment. Transfection efficiency was determinedy the Renilla luciferase activities. Values of controls (empty bars)ere normalized with an assigned value of 1. The values on the

xperimental (solid bars) were normalized and plotted as rela-ive values by comparison to controls. Error bars represent the

ean and standard error of three independent experiments. Sta-istical significance was calculated with unpaired Student’s t-test,

≤ 0.05 indicates a significant difference by comparison to controlalues.

. Results

.1. Knocking down CaSR expression attenuated the growthnhibitory effect of TGFˇ, TGFˇ-mediated Smad-dependentranscriptional reporter plasmid 3TP-Luc activity andGFˇ-mediated inhibition of survivin expression

A shRNA construct targeting CaSR was effective in knockingown the expression of CaSR mRNA and protein while the con-rol construct had no effect (Fig. 1A and B). Knocking down CaSRxpression circumvented the ability of TGF� to inhibit cellular pro-iferation and to stimulate 3TP-Luc reporter activity (Fig. 1C and). Likewise, knocking down CaSR expression attenuated the abil-

ty of TGF� to suppress the expression of survivin and the survivineporter promoter activities (Fig. 2A and B). Interestingly, knockingown CaSR expression itself resulted in a significant up-regulatedxpression of survivin (Fig. 2A).

.2. Knocking down CaSR expression resulted in a concurrentown-regulated TGF ̌ receptor RI and RII expression

Because TGF� action is transduced through receptor RI and RII36,37], we next determined if CaSR expression could modulate thexpression of RI and RII. Indeed, in the CaSR knocked down cells, thexpression of both mRNA and protein for RI and RII was significantlyown-regulated (Fig. 3A and B). Thus, CaSR expression itself couldodulate the expression of RI and RII.

.3. Inducing CaSR expression by Ca2+ or vitamin D resulted in aoncurrent up-regulation of RI and RII expression while lack ofaSR induction circumvented the up-regulation of TGF ̌ receptors

If knocking down CaSR expression affected the expression of RInd RII, i.e. if CaSR expression itself could affect RI and RII expres-ion, then as a corollary, inducing CaSR expression in the CBS cellshould up-regulate the expression of RI and RII. Either physiologiconcentration of Ca2+ or vitamin D can induce and up-regulate CaSR

xpression in the CBS cells [24]. Vitamin D (1.0 �M) induces a goodevel of CaSR expression by comparison to lower concentrations24,30]. Therefore, 1.0 �M vitamin D was used simply as an addi-ional agent, other than Ca2+, to induce CaSR expression. Therefore,

53 (2013) 366– 371 369

we treated the CBS cells with Ca2+ or vitamin D and determinedthe effect of such treatment on the expression of CaSR and TGF�receptors. Indeed, treatment with either Ca2+ or vitamin D inducedand up-regulated the expression of CaSR mRNA and protein with aconcurrent up-regulated RI and RII mRNA and protein expression(Fig. 4A and B). However, in the shRNA transfected CaSR knockeddown cells, Ca2+ or vitamin D could not up-regulate CaSR expres-sion and without an increase in the expression of CaSR; there wasno significant increase in the expression of RI and RII (Fig. 4C andD). Knocking down CaSR expression by shRNA itself also resulted inreduced expression of TGF� receptors. Neither vitamin D nor Ca2+

could induce CaSR in the CaSR knocked down cells (Fig. 4D) show-ing that the expression of TGF� receptors is specifically linked tothat of CaSR.

4. Discussion

The CBS cells are uniquely suitable for this study because theyretain the expression and function of both CaSR and TGF� receptors.We report here that CaSR can regulate TGF� receptor expressionand cellular responses to TGF� in colonic epithelial cells and thatthe level of TGF� receptor expression is dependent on the levelof CaSR expression. Down-regulated TGF� receptors expressionin the CaSR knocked down cells is the mechanism underlying theattenuated cellular responses to TGF� because TGF� receptors areobligate requirements for TGF� signaling [14,15,38,39]. The struc-ture and signaling mechanisms of CaSR and TGF� are very differentfrom one another. CaSR is a G protein coupled receptor and signalsthrough trimeric G Proteins [17] while TGF� signals through itsown distinct RI and RII protein kinase cascades [38–40]. Methyla-tion of TGF� receptor gene promoters is a common mechanism ofreceptor suppression [41–43]. However, we found that changes inthe level of CaSR expression had no effect on the methylation statusof TGF� receptor genes. Methylation specific PCR analysis showedthat knocking down CaSR expression did not alter the methyla-tion status of RI and RII receptor gene promoters, which remainedunmethylated (not shown). How CaSR signals to regulate TGF�receptor expression is unknown and will require further investiga-tion. However, previous studies by other investigators have shownthat CaSR can transcriptionally up-regulate the vitamin D recep-tor [17]. We have used the Mathprime (Millipore) computationalmethod to determine and predict vitamin D receptor binding sitesin the TGF� receptor gene. We found that both TGF� RI and RIIreceptor promoters possess 25 and 19 strong vitamin D receptorbinding sites, respectively which are proximal to the transcriptioninitiation start sites. Therefore, mechanistically, CaSR can stimulateTGF� RI and RII expression through the vitamin D receptor path-way. Thus, regulation of TGF� receptor expression by CaSR throughthe vitamin D receptor pathway remains a viable hypothesis. CaSRmediates its biologic action through a multitude of differentia-tion promoting and tumor suppressive pathways and modulatethe transcription and expression of many genes [24,26,27,29,32].Now we show that the transcription and expression of RI and RIIare under CaSR control and changes in RI and RII expression cancircumvent the cellular response to TGF�.

The expression profile of CaSR in the colonic epithelium is tightlylinked to differentiation. CaSR expression progressively increasesas the undifferentiated crypt stem cells migrate and differentiatetoward the apex of a crypt in the direction of the lumen [23,24].Likewise, TGF� and TGF� receptor expression profile follow a sim-ilar pattern to that of CaSR [4,44,45]. Recent studies show that loss

of CaSR expression allows cellular escape from CaSR control andthat the CaSR null is a highly malignant and drug resistant pheno-type of colon cancer [32,33]. Likewise, loss of TGF� responsivenesshas long been considered an underlying mechanism of early colon

370 N. Singh et al. / Cell Calcium 53 (2013) 366– 371

Fig. 4. Stimulation of CaSR expression by Ca2+ or vitamin D up-regulated TGF�-RI and RII expression but not in CaSR knocked down cells. (A) Real time RT-PCR analysis ofCaSR, TGF�-RI and RII mRNA expression following treatment of the parental CBS cells with Ca2+ or vitamin D. (B) Quantitative immunoblots of CaSR, TGF�-RI and RII proteine nd D)

o tandat

cret

mtmrgC[[mDi

xpression following treatment of the parental CBS cells with Ca2+ or vitamin D. (C af CaSR knocked down cells with Ca2+ or vitamin D. Results indicate the mean and s-test), differences of statistical significance.

arcinogenesis [5,7,8]. The data presented here, i.e. control of TGF�eceptor expression and responsiveness to TGF� by CaSR certainlynhances the significance of CaSR as a strong promoter of differen-iation and suppressor of colon carcinogenesis.

Exactly what induces CaSR expression as the crypt stem cellsigrate up a crypt is unknown. As these cells migrate up a crypt,

hey increasingly become exposed to the colonic fluids bathing theucosa. We hypothesize that specific components in such fluids are

esponsible for the induction of CaSR. Both Ca2+ and vitamin D areood candidates because either Ca2+ or vitamin D can up-regulateaSR expression and induce differentiation in colon carcinoma cells23,24,33]. The CaSR gene contains 2 vitamin D response elements

46,47] and one of the physiologic functions of vitamin D is to pro-

ote the absorption of Ca2+ in the gut [48]. Therefore, vitamin in concert with Ca2+, are potent inducers of CaSR expression

n the colonic crypt epithelium. Vitamin D turns on CaSR gene

The same mRNA and protein quantification as described above following treatmentrd error of three independent experiments.* Indicates P ≤ 0.05 (unpaired Student’s

transcription, stimulates receptor protein expression and furtherpromotes Ca2+ interaction with CaSR by promoting the absorp-tion of Ca2+ in the gut. CaSR induction in turn up-regulates TGF�receptor expression and promotes cellular responses to TGF�;establishing a potent cycle of differentiation control in the colonicepithelium. Differentiation of the rapidly turning over colonic cryptepithelial cells is regulated by complex biologic processes. Here,we delineate CaSR as an important and robust player. It is well-accepted that de-regulation in the differentiation process promotescell survival and propel progression in the direction of malignanttransformation. Indeed, highly malignant and drug resistant cellsdo not express CaSR [29,32].

In summary, we show in this study that CaSR, a robust differen-tiation promoter and tumor suppressor in colonic epithelial cells,also mediate its action by modulating TGF� receptor expressionand cellular response to TGF�.

alcium

C

A

e

R

[

[

[

[

[

[[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

N. Singh et al. / Cell C

onflict of interest

None.

cknowledgement

The support of Simmons Cancer Institute is gratefully acknowl-dged.

eferences

[1] M. Kurokowa, K. Lynch, D.K. Podolsky, Effects of growth factors on an intestinalepithelial cell line: transforming growth factor beta inhibits proliferation andstimulates differentiation, Biochemical and Biophysical Research Communica-tions 142 (1987) 775–782.

[2] S. Chakrabarty, A. Tobon, J. Varani, M.G. Brattain, Induction of carcinoembry-onic antigen secretion and modulation of protein secretion/expression andfibronectin/laminin expression in human colon carcinoma cells by transfor-ming growth factor-beta, Cancer Research 48 (1988) 4059–4064.

[3] S. Chakrabarty, Y. Jan, M.G. Brattain, A. Tobon, J. Varani, Diverse cellularresponses elicited from human colon carcinoma cells by transforming growthfactor-beta, Cancer Research 49 (1989) 2112–2117.

[4] A. Avery, C. Paraskeva, P. Hall, K.C. Flanders, M. Sporn, M. Moorghen, TGF-beta expression in the human colon: differential immunostaining along cryptepithelium, British Journal of Cancer 68 (1993) 137–139.

[5] S. Markowitz, J. Wang, L. Myeroff, et al., Inactivation of the type II TGF-betareceptor in colon cancer cells with microsatellite instability, Science 268 (1995)1336–1338.

[6] R.L. Elliott, G.C. Blobe, Role of transforming growth factor beta in human cancer,Journal of Clinical Oncology 23 (2005) 2078–2093.

[7] M.G. Brattain, S.D. Markowitz, J.K. Willson, The type II transforming growthfactor-beta receptor as a tumor-suppressor gene, Current Opinion in Oncology8 (1996) 49–53.

[8] E.B. Brunschwig, K. Wilson, D. Mack, et al., PMEPA1, a transforming growthfactor-beta-induced marker of terminal colonocyte differentiation whoseexpression is maintained in primary and metastatic colon cancer, CancerResearch 63 (2003) 1568–1575.

[9] M.G. Brattain, A.E. Levine, S. Chakrabarty, L.C. Yeoman, J.K. Willson, B. Long,Heterogeneity of human colon carcinoma, Cancer and Metastasis Reviews 3(1984) 177–191.

10] S. Chakrabarty, Regulation of human colon-carcinoma cell adhesion to extra-cellular matrix by transforming growth factor beta 1, International Journal ofCancer 50 (1992) 968–973.

11] S. Chakrabarty, S. Rajagopal, T.L. Moskal, Protein kinase Calpha controls theadhesion but not the antiproliferative response of human colon carcinoma cellsto transforming growth factor beta1: identification of two distinct branches ofpost-protein kinase Calpha adhesion signal pathway, Laboratory Investigation78 (1998) 413–421.

12] J. Gong, S. Ammanamanchi, T.C. Ko, M.G. Brattain, Transforming growth fac-tor beta 1 increases the stability of p21/WAF1/CIP1 protein and inhibits CDK2kinase activity in human colon carcinoma FET cells, Cancer Research 63 (2003)3340–3346.

13] H. Wang, V. Radjendirane, K.K. Wary, S. Chakrabarty, Transforming growth fac-tor beta regulates cell–cell adhesion through extracellular matrix remodelingand activation of focal adhesion kinase in human colon carcinoma Moser cells,Oncogene 23 (2004) 5558–5561.

14] S. Chakrabarty, D. Fan, J. Varani, Modulation of differentiation and proliferationin human colon carcinoma cells by transforming growth factor beta 1 and beta2, International Journal of Cancer 46 (1990) 493–499.

15] J. Massague, Receptors for the TGF-beta family, Cell 69 (1992) 1067–1070.16] E.M. Brown, G. Gamba, D. Riccardi, et al., Cloning and characterization of an

extracellular Ca(2+)-sensing receptor from bovine parathyroid, Nature 366(1993) 575–580.

17] E.M. Brown, R.J. MacLeod, Extracellular calcium sensing and extracellular cal-cium signaling, Physiological Reviews 81 (2001) 239–297.

18] A.M. Hofer, E.M. Brown, Extracellular calcium sensing and signalling, NatureReviews Molecular Cell Biology 4 (2003) 530–538.

19] L. Gama, L.M. Baxendale-Cox, G.E. Breitwieser, Ca2+-sensing receptors in intesti-nal epithelium, American Journal of Physiology 273 (1997) C1168–C1175.

20] I. Cheng, M.E. Klingensmith, N. Chattopadhyay, et al., Identification and local-ization of the extracellular calcium-sensing receptor in human breast, Journalof Clinical Endocrinology & Metabolism 83 (1998) 703–707.

21] L. McNeil, S. Hobson, V. Nipper, K.D. Rodland, Functional calcium-sensing recep-tor expression in ovarian surface epithelial cells, American Journal of Obstetricsand Gynecology 178 (1998) 305–313.

22] M.J. Rutten, K.D. Bacon, K.L. Marlink, et al., Identification of a functional Ca2+-sensing receptor in normal human gastric mucous epithelial cells, American

Journal of Physiology 277 (1999) G662–G670.

23] S. Chakrabarty, V. Radjendirane, H. Appelman, J. Varani, Extracellular calciumand calcium sensing receptor function in human colon carcinomas: promo-tion of E-cadherin expression and suppression of beta-catenin/TCF activation,Cancer Research 63 (2003) 67–71.

[

53 (2013) 366– 371 371

24] S. Chakrabarty, H. Wang, L. Canaff, G.N. Hendy, H. Appelman, J. Varani, Calciumsensing receptor in human colon carcinoma: interaction with Ca(2+) and 1,25-dihydroxyvitamin D(3), Cancer Research 65 (2005) 493–498.

25] K. Hizaki, H. Yamamoto, H. Taniguchi, et al., Epigenetic inactivation of calcium-sensing receptor in colorectal carcinogenesis, Modern Pathology 24 (2011)876–884.

26] N. Bhagavathula, E.A. Kelley, M. Reddy, et al., Upregulation of calcium-sensingreceptor and mitogen-activated protein kinase signalling in the regulation ofgrowth and differentiation in colon carcinoma, British Journal of Cancer 93(2005) 1364–1371.

27] N. Bhagavathula, A.W. Hanosh, K.C. Nerusu, H. Appelman, S. Chakrabarty, J.Varani, Regulation of E-cadherin and beta-catenin by Ca2+ in colon carcinoma isdependent on calcium-sensing receptor expression and function, InternationalJournal of Cancer 121 (2007) 1455–1462.

28] G. Liu, X. Hu, S. Chakrabarty, Calcium sensing receptor down-regulates malig-nant cell behavior and promotes chemosensitivity in human breast cancer cells,Cell Calcium 45 (2009) 216–225.

29] G. Liu, X. Hu, J. Varani, S. Chakrabarty, Calcium and calcium sensing receptormodulates the expression of thymidylate synthase, NAD(P)H:quinone oxidore-ductase 1 and survivin in human colon carcinoma cells: promotion of cytotoxicresponse to mitomycin C and fluorouracil, Molecular Carcinogenesis 48 (2009)202–211.

30] G. Liu, X. Hu, S. Chakrabarty, Vitamin D mediates its action in human colon car-cinoma cells in a calcium-sensing receptor-dependent manner: down regulatesmalignant cell behavior and the expression of thymidylate synthase and sur-vivin and promotes cellular sensitivity to 5-FU, International Journal of Cancer126 (2010) 631–639.

31] G. Liu, X. Hu, L. Premkumar, S. Chakrabarty, Nifedipine synergizes with cal-cium in activating the calcium sensing receptor, suppressing the expression ofthymidylate synthase and survivin and promoting sensitivity to fluorouracil inhuman colon carcinoma cells, Molecular Carcinogenesis 50 (2011) 922–930.

32] N. Singh, G. Liu, S. Chakrabarty, Isolation and characterization of calciumsensing receptor null cells: a highly malignant and drug resistant phenotype ofcolon cancer, International Journal of Cancer 132 (2013) 1996–2005.

33] A.C. Rogers, A.M. Hanly, D. Collins, A.W. Baird, D.C. Winter, Review article: lossof the calcium-sensing receptor in colonic epithelium is a key event in thepathogenesis of colon cancer, Clinical Colorectal Cancer 11 (2012) 24–30.

34] M. Ruat, M.E. Molliver, A.M. Snowman, S.H. Snyder, Calcium sensing receptor:molecular cloning in rat and localization to nerve terminals, Proceedings ofthe National Academy of Sciences of the United States of America 92 (1995)3161–3165.

35] X. Ling, R.J. Bernacki, M.G. Brattain, F. Li, Induction of survivin expression bytaxol (paclitaxel) is an early event, which is independent of taxol-mediatedG2/M arrest, Journal of Biological Chemistry 279 (2004) 15196–15203.

36] L. Attisano, J.L. Wrana, F. Lopez-Casillas, J. Massague, TGF-beta receptors andactions, Biochimica et Biophysica Acta 1222 (1994) 71–80.

37] R. Derynck, TGF-beta-receptor-mediated signaling, Trends in Biochemical Sci-ences 19 (1994) 548–553.

38] F. Lopez-Casillas, J.L. Wrana, J. Massague, Betaglycan presents ligand to the TGFbeta signaling receptor, Cell 73 (1993) 1435–1444.

39] J.L. Wrana, L. Attisano, R. Wieser, F. Ventura, J. Massague, Mechanism of acti-vation of the TGF-beta receptor, Nature 370 (1994) 341–347.

40] A. Nakao, T. Imamura, S. Souchelnytskyi, et al., TGF-beta receptor-mediatedsignalling through Smad2, Smad3 and Smad4, EMBO Journal 16 (1997)5353–5362.

41] M. Pinto, C. Oliveira, L. Cirnes, et al., Promoter methylation of TGF beta receptor Iand mutation of TGF beta receptor II are frequent events in MSI sporadic gastriccarcinomas, Journal of Pathology 200 (2003) 32–38.

42] Q. Zhang, J.N. Rubenstein, T.L. Jang, et al., Insensitivity to transforminggrowth factor-beta results from promoter methylation of cognate receptorsin human prostate cancer cells (LNCaP), Molecular Endocrinology 19 (2005)2390–2399.

43] Z. Dong, W. Guo, Y. Guo, G. Kuang, Z. Yang, Concordant promoter methyla-tion of transforming growth factor-beta receptor types I and II occurs early inesophageal squamous cell carcinoma, American Journal of the Medical Sciences343 (2012) 375–381.

44] M.P. Winesett, G.W. Ramsey, J.A. Barnard, Type II TGF(beta) receptor expres-sion in intestinal cell lines and in the intestinal tract, Carcinogenesis 17 (1996)989–995.

45] N. Rathor, S.R. Wang, E.T. Chang, J.N. Rao, Differentiated intestinal epithelialcells express high levels of TGF-beta receptors and exhibit increased sensi-tivity to growth inhibition, International Journal of Clinical and ExperimentalMedicine 4 (2011) 299–308.

46] N. Chikatsu, S. Fukumoto, Y. Takeuchi, M. Suzawa, T. Obara, T. Matsumoto,T. Fujita, Cloning and characterization of two promoters for the humancalcium-sensing receptor (CaSR) and changes of CaSR expression in parathyroidadenomas, Journal of Biological Chemistry 275 (2000) 7553–7557.

47] L. Canaff, G.N. Hendy, Human calcium-sensing receptor gene, vitamin Dresponse elements in promoters P1 and P2 confer transcriptional responsive-ness to 1,25-dihydroxy vitamin D, Journal of Biological Chemistry 277 (2002)30337–30350.

48] M. Laaksonen, M. Karkkainen, T. Outila, T. Vanninen, C. Ray, C. Lamberg-Allardt,Vitamin D receptor gene BsmI-polymorphism in Finnish premenopausal andpostmenopausal women: its association with bone mineral density, markers ofbone turnover, and intestinal calcium absorption, with adjustment for lifestylefactors, Journal of Bone and Mineral Metabolism 20 (2002) 383–390.