Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case...

28
Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28

Transcript of Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case...

Page 1: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28

Page 2: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 2 of 28

Page 3: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 3 of 28

Page 4: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 4 of 28

Page 5: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 5 of 28

Page 6: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 6 of 28

Page 7: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 7 of 28

Page 8: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 8 of 28

Page 9: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 9 of 28

Page 10: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 10 of 28

Page 11: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 11 of 28

Page 12: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 12 of 28

Page 13: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 13 of 28

Page 14: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 14 of 28

Page 15: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 15 of 28

Page 16: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 16 of 28

Page 17: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 17 of 28

Page 18: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 18 of 28

Page 19: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 19 of 28

Page 20: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 20 of 28

Page 21: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 21 of 28

Page 22: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 22 of 28

Page 23: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 23 of 28

Page 24: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 24 of 28

Page 25: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 25 of 28

Page 26: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 26 of 28

Page 27: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 27 of 28

Page 28: Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 1 of 28 · 14/06/2017  · Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28. Created Date: 6/14/2017 2:11:47 PM

Case 5:17-cv-03375-SVK Document 1 Filed 06/12/17 Page 28 of 28


Pic2Go at Wings for Life World Run SVK 2016

Pic2Go at Wings for Life World Run SVK 2016

Lombardini Marine LDW 1 503 M - marineservice · PDF fileLombardini Marine LDW 1 503 M Marineservice Niederlehme Tel. 03375/ 21 82 00 Alexander Rapp Fax: 03375/ 21 82 01 Dorfanger

Lombardini Marine LDW 1 503 M - marineservice · PDF fileLombardini Marine LDW 1 503 M Marineservice Niederlehme Tel. 03375/ 21 82 00 Alexander Rapp Fax: 03375/ 21 82 01 Dorfanger

SVK Bosloop 2018

SVK Bosloop 2018

SVK FIBRE CEMENT FA ÇADE PANELS PRODUCT RANGE

SVK FIBRE CEMENT FA ÇADE PANELS PRODUCT RANGE

11/06/2016 Pupils 1 Male B -20 Final - TPSS 2018 2016 draws.pdf · QF QF Mamuti, Hamza SKP Ryong Taekwondo Bratislava (SVK) (SVK) B/437 B/153 Kovarcik, Martin Sokol Frydek-Mistek

11/06/2016 Pupils 1 Male B -20 Final - TPSS 2018 2016 draws.pdf · QF QF Mamuti, Hamza SKP Ryong Taekwondo Bratislava (SVK) (SVK) B/437 B/153 Kovarcik, Martin Sokol Frydek-Mistek

SVK Slates Ireland

SVK Slates Ireland

SVK FIBRE CEMENT FACADE PANELS PRODUCT RANGE

SVK FIBRE CEMENT FACADE PANELS PRODUCT RANGE

CERD/C/SVK/9-10 International Convention on the ... · CERD/C/SVK/9-10 I. Introduction 1. The Slovak Republic (hereinafter referred to as the ‘SR’) is a party to the International

CERD/C/SVK/9-10 International Convention on the ... · CERD/C/SVK/9-10 I. Introduction 1. The Slovak Republic (hereinafter referred to as the ‘SR’) is a party to the International

MANTHAN SVK Newsline - djjs.org · SVK Newsline To mark the new ... Jindal- Social Worker, ... the people's mindset and they will be motivated to not only save the environment but

MANTHAN SVK Newsline - djjs.org · SVK Newsline To mark the new ... Jindal- Social Worker, ... the people's mindset and they will be motivated to not only save the environment but

Jagadish SVK CV Feb 2018 - Kansas State University · Title: Microsoft Word - Jagadish SVK CV_Feb 2018 Author: kjagadish Created Date: 2/28/2018 11:36:02 PM

Jagadish SVK CV Feb 2018 - Kansas State University · Title: Microsoft Word - Jagadish SVK CV_Feb 2018 Author: kjagadish Created Date: 2/28/2018 11:36:02 PM

Table S1. Specific primer pairs used in quantitative Real ...aem.asm.org/content/suppl/2014/02/24/AEM.03375-13... · Name Sequences (5’ → 3’) Gene PR1-fw1 CCTCAAGATTATCTTAACGCTC

Table S1. Specific primer pairs used in quantitative Real ...aem.asm.org/content/suppl/2014/02/24/AEM.03375-13... · Name Sequences (5’ → 3’) Gene PR1-fw1 CCTCAAGATTATCTTAACGCTC

The difference between SVK and Austrian Deco

The difference between SVK and Austrian Deco

Svk Ediel- and settlement conference 2015 - Birger Fält, Online service

Svk Ediel- and settlement conference 2015 - Birger Fält, Online service

Svk Br Yapceu2008

Svk Br Yapceu2008

INDEX [] · 1 SHD roadline series 3 SVK audio series 13 - 19 - 25 - 37 - 54 - 85 - 100 - 150 pin 8 SVS audio slim series 72 - 101 pin 9 SVK & SVS locking ring versions

INDEX [] · 1 SHD roadline series 3 SVK audio series 13 - 19 - 25 - 37 - 54 - 85 - 100 - 150 pin 8 SVS audio slim series 72 - 101 pin 9 SVK & SVS locking ring versions

Lombardini Marine LDW · PDF fileLombardini Marine LDW 1404M Marineservice Niederlehme Tel. 03375/ 21 82 00 Alexander Rapp Fax: 03375/ 21 82 01 Dorfanger 19 a/b e.mail: info@

Lombardini Marine LDW · PDF fileLombardini Marine LDW 1404M Marineservice Niederlehme Tel. 03375/ 21 82 00 Alexander Rapp Fax: 03375/ 21 82 01 Dorfanger 19 a/b e.mail: info@

GAME SUMMARY GER - SVK 4 - 8 (1 - 3 , 0 - 4 , 3 - 1)stats.iihf.com/sihf/68/IHM068903_74_3_0.pdf · On Ice GER 30 SVK 1 12 3rd Period Action Time ET/Res Team Type No Name (G) Name

GAME SUMMARY GER - SVK 4 - 8 (1 - 3 , 0 - 4 , 3 - 1)stats.iihf.com/sihf/68/IHM068903_74_3_0.pdf · On Ice GER 30 SVK 1 12 3rd Period Action Time ET/Res Team Type No Name (G) Name

GOING CANDID WITH PROF. SVK BHARATHI LAURELS OF SCIT … · GOING CANDID WITH PROF. SVK BHARATHI LAURELS OF SCIT STUDENTS’ CONTRIBUTIONS EVENTS AND HAPPENINGS IN SEP 2012 BRAIN

GOING CANDID WITH PROF. SVK BHARATHI LAURELS OF SCIT … · GOING CANDID WITH PROF. SVK BHARATHI LAURELS OF SCIT STUDENTS’ CONTRIBUTIONS EVENTS AND HAPPENINGS IN SEP 2012 BRAIN

RESULTS BOOK Gymnastics Rhythmic - Altervistaarmoniachieti.altervista.org/.../documenti/GR_Baku_2015.pdf · 2015-03-09 · 10 SVK SVK 11 RUS RUS 12 HUN HUN 13 AZE AZE 14 KAZ KAZ 15

RESULTS BOOK Gymnastics Rhythmic - Altervistaarmoniachieti.altervista.org/.../documenti/GR_Baku_2015.pdf · 2015-03-09 · 10 SVK SVK 11 RUS RUS 12 HUN HUN 13 AZE AZE 14 KAZ KAZ 15

Frank Laboratory of Neutron Physics Summer school in Dubna 5.7.-25.7.2010 Prepared by: B. Andel (SVK), E. Govor (BLR), K. V. Mareš (CZE), M. Mazánová (SVK),

Frank Laboratory of Neutron Physics Summer school in Dubna 5.7.-25.7.2010 Prepared by: B. Andel (SVK), E. Govor (BLR), K. V. Mareš (CZE), M. Mazánová (SVK),