CASC15-S is a tumor suppressor lncRNA at the...

1

CASC15-S is a tumor suppressor lncRNA at the 6p22 neuroblastoma susceptibility locus

Mike R. Russell1, Annalise Penikis1, Derek A. Oldridge1, Juan R. Alvarez-Dominguez2,3, Lee McDaniel1, Maura Diamond1, Olivia Padovan4, Pichai Raman1,5, Yimei Li1, Jun S. Wei6, Shile Zhang6, Janahan Gnanchandran7, Robert Seeger7, Shahab Asgharzadeh7, Javed Khan6, Sharon J. Diskin1,8,9, John M. Maris1,8,9 and Kristina A. Cole1,8,9,a

1Division of Oncology, The Children's Hospital of Philadelphia, Philadelphia, Pennsylvania 19104; 2Whitehead Institute for Biomedical Research, 3Department of Biology, Massachusetts Institute of Technology, Cambridge, MA, 02142, USA, 4Department of Physics and Astronomy, University of Pennsylvania, Philadelphia, PA 19104; 5Center for Biomedical Informatics, The Children's Hospital of Philadelphia, Philadelphia, Pennsylvania 19104; 6Oncogenomics Section, Genetics Branch, Center for Cancer Research, National Cancer Institute, 37 Covent Drive, Bethesda, Maryland; 7Department of Pediatrics, Division of Hematology-Oncology, Children’s Hospital Los Angeles and Saban Research Institute, University of Southern California, Los Angeles, CA 90027; 8Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, PA 19104-4318; and 9The Abramson Family Cancer Research Institute, University of Pennsylvania School of Medicine, Philadelphia, PA 19104.

Running title: CASC15 is a neuroblastoma suppressor gene

Keywords: neuroblastoma, lncRNA, CASC15, LINC00340, FLJ22536

Grant Support: K08CA136979 (KAC) and Alex’s Lemonade Stand Foundation (KAC and MRR)

a Corresponding author: Dr. Kristina A. Cole Children's Hospital of Philadelphia 3501 Civic Center Blvd. Philadelphia, PA 19104, USA Phone: 267-426-2285 Fax: 267-426-0685 [email protected] There are no conflicts of interest to disclose. Word Count: 5421

Figures: 6 (8 Supplemental)

Tables: 1 (2 Supplemental)

on May 24, 2019. © 2015 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on June 22, 2015; DOI: 10.1158/0008-5472.CAN-14-3613

http://cancerres.aacrjournals.org/

2

ABSTRACT

Chromosome 6p22 was identified recently as a neuroblastoma susceptibility locus, but

its mechanistic contributions to tumorigenesis are as yet undefined. Here we report that the

most highly significant single nucleotide polymorphism (SNP) associations reside within

CASC15, a long non-coding RNA that we define as a tumor suppressor at 6p22. Low-level

expression of a short CASC15 isoform (CASC15-S) associated highly with advanced

neuroblastoma and poor patient survival. In human neuroblastoma cells, attenuating CASC15-S

increased cellular growth and migratory capacity. Gene expression analysis revealed

downregulation of neuroblastoma-specific markers in cells with attenuated CASC15-S, with

concomitant increases in cell adhesion and extracellular matrix transcripts. Altogether, our

results point to CASC15-S as a mediator of neural growth and differentiation, which impacts

neuroblastoma initiation and progression.




3

INTRODUCTION

Neuroblastoma, a cancer of the developing autonomic nervous system, is the most

common malignancy diagnosed in the first year of life and accounts for approximately 10% of all

pediatric cancer mortality1-3. While the majority of low-risk neuroblastoma patients are cured

with surgery alone, 50% of patients have the high-risk form of the disease, and only about half

of these children survive despite highly intensive therapy1. Neuroblastomas are thought to

develop from cells derived from the neural crest committed to the sympathicoadrenal lineage

(peripheral autonomic nervous system) 1-4. Because malignant transformation can occur at any

point during sympathetic development, tumors may arise throughout the developing sympathetic

nervous system (most commonly the adrenal gland), contributing to the hallmark heterogeneity

observed in this disease4. To address the etiology of sporadic neuroblastoma, we conducted the

first pediatric cancer genome-wide association study (GWAS), leading to the identification of

numerous validated susceptibility loci in several populations5-12. Moreover, we showed that

many of these susceptibility alleles are specifically associated with disease phenotype and

patient outcomes. The majority of these SNPs act in cis to influence expression of protein

coding genes at these loci, and several of these transcripts, such as LMO1, BARD1 and

LIN28B, appear to play an oncogenic role in established tumors 5-12.

The first identified neuroblastoma susceptibility locus identified by GWAS, and the one

that remains most significant, mapped to chromosome 6p22.3 and robustly replicated in three

independent cohorts (rs6939340: p = 9.33 x 10-15; Allelic Odds Ratio 1.97, 95% C.I.: 1.58-2.45) 5. Like other subsequently identified loci, we observed a highly significant association with

neuroblastoma susceptibility and clinically aggressive presentation. The minor allele (G) was

over-represented in neuroblastoma cases compared to controls, and presence of the G allele

was further enriched in the high-risk subset of neuroblastoma (p = 0.007), tumors with MYCN

amplification (p = 0.002) and stage 4 disease (p = 0.025), implying the risk alleles were

associated with a more malignant neuroblastoma phenotype. Based on HapMap data available

at the time of this initial discovery, the associated SNPs tagged a 94.2-kb linkage disequilibrium

(LD) block; this LD block overlapped two hypothetical genes (FLJ22536 and FLJ44180) 5.

However, both FLJ22536 and FLJ44180 lacked protein coding potential, impeding further

characterization of this region in neuroblastoma initiation.




4

Recent data obtained from whole genome sequencing studies of neuroblastoma have

illustrated far fewer recurrent mutations in protein-coding genes than previously predicted 13-16;

however it is now clear that as much as 70% of the genome is transcribed into products other

than traditional protein-coding mRNAs 17,18. Although many of these transcriptionally active loci

produce RNA species involved in translation (i.e. ribosomal and transfer RNAs), several other

RNA classes have been functionally validated as bona-fide regulatory molecules. The recently

identified long non-coding RNAs (lncRNAs), defined as RNA species >200nt in length that lack

a functional open reading frame, have been increasingly implicated in a wide variety of cellular

functions 19. LncRNAs share several transcriptional features in common with mRNAs - they are

often spliced, demonstrate RNA polymerase II occupancy, contain a 5’ methylguanosine cap,

and are commonly (though not always) polyadenylated 20,21. Although lncRNA function is highly

context dependent, they commonly play a prominent role in the spatiotemporal regulation of

gene expression during developmental processes 22-24, and therefore exhibit a tendency to be

located throughout the genome, in sites proximal to developmentally critical protein-coding

genes 25. Indeed, several lncRNAs reside near protein-coding genes known to regulate lineage

commitment in neural crest cells 26, serving as an attractive hypothesis to explain the etiology of

embryonal cancers such as neuroblastoma.

As might be expected, lncRNAs have been increasingly implicated in a variety of

oncogenic processes through association with epigenetic complexes and modification of

chromatin accessibility - ultimately influencing gene expression 27-30. To date, there are few

reports concerning the role of lncRNAs in the initiation and progression of solid pediatric

neoplasms, despite the fact that many childhood cancers are fundamentally defects of normal

human development 31. Here we describe the identification and characterization of a novel

lncRNA, CASC15, which contributes to the GWAS association signal on 6p22.3 by functioning

as a tumor suppressor in neuroblastoma.

METHODS

Genome Wide Association Study (GWAS) and Imputation. In an effort to refine the

association signal and search for a causal variant at the 6p22 locus, we performed genotype

imputation in a previously described European ancestry cohort of 2,101 neuroblastoma cases

and 4,202 controls10 using the 1000 Genomes Phase I Release 3 as a reference. Genotyping




5

and quality control methods have been previously published5. GWAS imputation and statistical

tests are detailed in the Supplementary Methods section.

Data Sources. The human February 2009 (GRCh37/hg19) genome assembly was used

throughout the study. Transcript structures and annotations were obtained from GENCODE

version 19. Details on the various data sources used are available in the Supplementary

Methods section.

Neuroblastoma data: The neuroblastoma RNAseq, SNP profiling and HuEx datasets are part of

the Therapeutically Applicable Research to Generate Effective Treatments (TARGET) initiative,

supported by NCI Grant U10 CA98543. The low-level sequence data have been deposited in

the Sequence Read Archive (SRA) at the National Center for Biotechnology Information (NCBI),

and are further accessible through the database of genotypes and phenotypes (dbGAP,

accession number phs000218). The gene expression and copy number data, as well as clinical

information on the NBL cases studied, is available via the TARGET Data Matrix32.

5’/3’ Rapid Amplification of cDNA Ends (RACE). 5’ and 3’ RACE was performed via the First

Choice RLM RACE kit (Ambion) using 10μg of RNA obtained from fetal brain or NB69

neuroblastoma cells following the manufacturers protocol. Specificity for CASC15-S was

achieved by nested PCR using the following gene specific primer (GSP) pairs:

5’ RACE: Outer GSP: 5’-CTAGCCCATCAGTTCCTTCG -3’

5’ RACE: Inner GSP: 5’-TTCACCCTGTCCTCCAAGTC-3’

3’ RACE: Outer GSP: 5’-TGGTTACCTGAGCTGCTCCT-3’

3’ RACE: Inner GSP: 5’-CTCAGCCAGTGCAACACAAC-3’

Gene products were cloned into a pCR4-TOPO vector for sequencing.

RNA Sequencing (RNASeq). Neuroblastoma: PolyA selected RNA libraries obtained from 108

high-risk neuroblastoma patients as part of the NCI TARGET project were prepared using

TruSeq v3 (Illumina) for RNA sequencing on Illumina HiSeq2000 sequencers. The 101bp

paired-end reads generated were aligned to the hg19 build of the human reference genome

using TopHat v2.2.0, yielding a median of 115 million total aligned reads per patient sample

(range of 48 - 250 million total aligned reads). The HTSeq package (v0.6.1) was used to map

aligned reads to the VISTA-annotated enhancer region, hs1335, as well as all transcripts




6

annotated in Ref-Seq (v66) and/or the UCSC Genome Browser. Transcript expression values

were normalized and quantified using the metric of reads per kilobase per million reads (RPKM).

For isoform-specific quantitation of CASC15 and CASC15-S, only exons and exon-exon

junctions that were unique to each isoform were used in computing RPKM. Other: Mapped

RNA-seq reads from 16 primary tissues (Illumina Human Body Map) and 51 cell lines (Human

ENCODE) were used to quantify gene- and transcript-level expression, based on GENCODE

v19 annotations, using Cufflinks v.2.2.0 with default parameters and “--min-frags-per-transfrag 0

--compatible-hits-norm --min-isoform-fraction 0.0”. Expression data heatmaps were generated

using the heatmap.2 function of the gplots R package.

RNA Fluorescent In Situ Hybridization (RNA-FISH). We performed RNA FISH and counted

RNA in single cells as described in Raj et al., 2008. Fluorescently labeled, non-overlapping

oligonucleotide probes (20-mers) were designed to tile RNA transcripts, including CASC14

(LOC729177), hs1335, CASC15 and CASC15-S. Probes were then divided into odd and even

pools and hybridized to neuroblastoma cells. Details of image acquisition are available in the

Supplementary Methods section.

Quantification of CASC15-S in neuroblastoma cells. Quantification of RNA transcripts was

performed on a panel of neuroblastoma cancer lines using Taqman RT-PCR. For quantification

of CASC15-S, we developed a custom primer/probeset spanning exons 1-2 and consisting of

the following primers:

forward: GCTGTCGACGAAGGAACTGAT

reverse: GTCCAAGTCAAAAGTCTCATCCAAGA

reporter: CCTGTGAGCCTAGCCC

Primer/probe sets for CASC15 (Hs01371949_m1) and CASC14 (Hs04275511_s1) are

commercially available (Life Technologies). Quantification was normalized to the geometric

mean of housekeeping genes TBP and GUSB.

Cell growth and siRNA assays. ON-TARGETplus SmartPool siRNAs containing four

constructs per target (Thermo Scientific) were used for GAPDH and PLK-1 knockdown. ON-

TARGETplus Non-targeting Control Pool (containing 4 constructs) was used as a control. Two




7

constructs were used for each lncRNA, and were purchased as Silencer Select siRNA or

custom siRNAs from Life Technologies.

siRNA constructs were transfected into neuroblastoma cells in triplicate, using 50nM of

siRNA in 0.1-0.2% DharmaFECT 1 (Thermo Scientific). Knockdown was assessed by Taqman

RT-PCR, comparing levels 72h post-transfection to non-targeting control transfected cells. For

all siRNA experiments, the minimum knockdown achieved was 71.5% (avg. = 78.6, max =

92.0).

For growth assays, while both tested, the siRNA with the best knockdown efficiency for

each target is shown. Cell growth assays were conducted using the xCELLigence real-time

growth (RT-CES, ACEA Biosciences) and/or Cell-TiterGlo (Promega) assays according to

manufacturer protocols.

CASC15-S add-back experiments. For CASC15-S addback experiments, expression plasmids

containing the cDNA for either CASC15-S or GFP were transfected in triplicate in a 96-well plate

using 250ng of DNA and 3ul of Lipofectamine 2000 per well. These experiments were

conducted using the growth assays described above, and the expression levels of the CASC15-

S transcript were confirmed by Taqman RT-PCR to be highly expressed in the addback

condition. Transfection efficiency was estimated to be ~90% based on the GFP transfected

condition.

shRNA expression and lentiviral constructs. The siRNA construct for CASC15-S (targeting

exon 1) was used to create a double-stranded shRNA construct and was subsequently cloned

into the pLenti-GFP DEST lentiviral vector (Addgene). 5x106 293T cells were transfected with

15μg of the pLenti transfer vector, 15μg of pLP1, 6μg of pLP2 and 3μg of pVSV-G vectors.

Lentiviral particles were collected at 48 and 72 hours post transfection. Lentiviral transduction of

neuroblastoma cells was carried out overnight at 37C using 3μg/ml of polybrene. For each

neuroblastoma line used, serial dilutions of lentiviral particles in basal media were carried out in

a 6-well plate, and cells were assessed at 48h post-transduction for GFP expression. The

minimum lentiviral concentration resulting in >95% GFP expression was chosen for expansion

and knockdown was validated by Taqman PCR. For all shRNA experiments, knockdown of at

least 70.3% (avg. = 82.6, max = 91.8) was achieved. Each neuroblastoma line with confirmed

knockdown was then frozen at low passage (< 5) and thawed as needed for subsequent

experiments.




8

Luciferase Reporter Assay. The respective risk (A_A) and non-risk (T_T) genotypes of Lan-5

and CHP-134 cells at rs9295534 were verified by PCR and Sanger sequencing. Subsequently,

a 1500bp fragment was cloned from each cell line (750bp on either side of the rs9295534) and

was purified using the Qiaquick Gel Extraction kit (Qiagen). The fragment was inserted into the

pGL4.23 vector upstream of a minimal promoter used to drive firefly luciferase expression.

Fragment-containing vectors were then transfected into HEK-293 cells, along with a Renilla

luciferase vector (pGL4.75) to control for transfection efficiency. 72 hours following transfection,

luciferase activity was assayed by Dual-Glo reporter assay (Promega) using the GloMax Multi

Detection System (Promga). Firefly luciferase was normalized to Renilla luciferase and a

minimum of three replicates was used for each condition.

In Vitro Transcription/Translation Assay. CASC15-S was cloned into a T7-promoter

containing plasmid (T7-CFE-Chis) and subsequently verified by Sanger sequencing. Coding

potential of CASC15-S was assayed using the TnT® Quick Coupled Transcription/Translation

System according to the manufacturers protocol. Incorporation of biotinylated lysine residues

was visualized via western blot using a 1:10,000 anti-biotin HRP labeled antibody (Cell

Signaling) and chemiluminescent detection (Thermo Scientific).

Wound Healing Assays. Scratch assays were carried out on SK-N-BE2 and SK-N-SH cells

stably depleted of CASC15-S plated at 85% confluence in 60mm dishes, and were scratched

using a sterile 200μl pipette tip. Cells were photographed at regular intervals using a previously

calibrated 5x light microscope (Nikon). Assessment of cell migration was carried out by

measuring scratch closure as a percentage of initial scratch size in ImageJ, and was compared

to control cells using a linear regression function in GraphPad Prism 6.

Cell Culture. Neuroblastoma cell lines were obtained from the neuroblastoma cell line bank

maintained at the Children’s Hospital of Philadelphia. Cell line identity is routinely confirmed via

AmpFLSTR Identifiler (Applied Biosystems), last done in November 2013. Non-neuroblastoma

cell lines were purchased from ATCC and all cell lines are routinely tested for mycoplasma. All

cell lines are maintained in basal media (either RPMI1640 or DMEM) supplemented with 10%

FBS and 1% gentamycin and cultured at 5% CO2.

Statistics. All group comparisons were conducted using non-parametric testing (Mann-Whitney-

U) in Graphpad Prism.




9

For Kaplan Meier analysis: optimal cutoff was determined by employing a scanning approach to

the Kaplan-Meier method by iteratively splitting the ordered genes expression values across

samples into two groups and calculating the p-value by the Mantel-Haenszel log-rank test. The

lowest p-value corresponds to the optimal breakpoint. A Benjamini-Hochberg correction was

applied to reflect the presence of multiple hypotheses testing.

For multivariate analyses, a Cox Proportional Hazard model was used to evaluate the effect of

each gene expression on overall survival, adjusting for clinical factors such as age (as a

continuous variable), MYCN amplification, and 1p/11q LOH status. Proportional hazard

assumption was evaluated by the log-log plot and there was no evidence of violation of this

assumption.

RESULTS Fine mapping of the 6p22.3 neuroblastoma susceptibility locus

The initial GWAS study illustrating 6p22.3 as a neuroblastoma susceptibility locus

identified three common polymorphisms clustered on chromosome 6p22.3 that were highly

associated with aggressive disease and a significantly increased risk of neuroblastoma

development 5. These SNPs were shown to tag a 94.2-kb LD block overlapping two hypothetical

genes and flanked upstream by SOX4. To map this region with finer detail, and identify putative

causal/functional SNPs, we performed genotype imputation in our recently published discovery

cohort of 2,101 cases and 4,202 controls 10. We first applied SHAPEIT33 to infer haplotypes, and

then utilized IMPUTE234 with default parameters and Ne=20000, along with a multi-population

reference panel from the world-wide 1000 Genomes Project Phase 1 release to impute

genotypes across the region. Genotyped and imputed variants were tested for association with

neuroblastoma using the frequentist association test under the additive model using the “score”

method implemented in SNPTEST35. Variants with minor allele frequency (MAF) < 1% and/or

IMPUTE2-info quality score < 0.8 were excluded for quality control purposes. We identified 32

polymorphisms with p-values less than 1x10-10 (p = 8.26x10-10 – 1.88x10-15), 12 of which were in

high LD (r2 > 0.8) and localized to an intronic region of an annotated gene locus formerly titled

FLJ22536 / LINC00340 and more recently renamed cancer associated susceptibility candidate

15 (CASC15; Fig. 1a, Supplementary Table 1). These 32 SNPs identify a 34.9-kb linkage




10

disequilibrium (LD) block based on the 1000 Genomes Northern and Western European (CEU)

population (Fig. 1b), significantly refining this relatively small locus.

Identification of CASC15 isoform expression

CASC15 is annotated as a long noncoding RNA (lncRNA), prompting us to examine the

difference in lncRNA transcript levels between 220 high-risk and 30 low-risk primary tumors for

which we possess microarray expression data. This analysis revealed that only 3.5% of

annotated lncRNAs (hg19: 8/229) appear significantly differentially regulated between high- and

low-risk tumors (Table 1). Furthermore, high-risk neuroblastomas exhibit a 4.4-fold lower level

of CASC15 expression as compared to low-risk disease - the most highly significant (p =

3.60x10-17) differentially expressed lncRNA we observed. Several computationally predicted

lncRNAs map to the 6p22.3 locus, including multiple CASC15 isoforms and an antisense-strand

lncRNA, CASC14 (formerly LOC729177) (Supplementary Fig. 1a).

We therefore first utilized RNA sequencing (RNASeq) and RNA-paired end tagged

(RNA-PET) data available from the ENCODE project to identify the products transcribed from

this locus in SK-N-SH and SK-N-BE2 neuroblastoma cell lines. These data demonstrated the

existence of two capped and polyadenylated nuclear CASC15 transcripts, a long (hg19, chr6:

21,666,675-22,194,616; Ensembl: CASC15-003) and a short isoform (hg19, chr6: 22,146,883-

22,194,616; Ensembl: CASC15-004) (Fig. 2a, Supplementary Figs. 1b, 2a). These nuclear

noncoding transcripts are highly conserved in vertebrates, and readily detected in several brain

regions and neuroblastoma cell lines (Supplementary Fig. 2), with putative promoter regions

separated by 480kb indicative of independent transcriptional regulation.

We next examined RNA expression data from a panel of 16 primary human tissues as

part of the Illumina Human Body Map project, where we found that the short CASC15 isoform

was expressed in abundance in the brain, but at modest to low levels in most other tissues (Fig 2b). We subsequently generated RNA sequencing data from 108 primary neuroblastoma

tumors using non-overlapping, transcript-specific reads to investigate the expression of lncRNAs

transcribed from this locus. We augmented these findings with our own strand-specific RNA

sequencing data from two primary tumors, confirming nearly complete alignment to the plus

strand (avg. 92.6%, min. 86.9%, max 98.6%). Together, these RNA sequencing data identify the

short CASC15 isoform as the predominant transcript expressed from this locus in

neuroblastoma, with expression values 20- to 40-fold higher than CASC14 and full-length

CASC15, respectively (Fig. 2c). Lastly, RNA sequencing data identified a third unspliced




11

transcript, spanning part of exon 1 of the short CASC15 isoform through a downstream

noncoding element (hs1335) with a validated enhancer function in the developing murine neural

tube, further supporting the role of this locus in neural development 36.

To validate the isoforms identified from RNA sequencing data, we performed 5’ and 3’

RACE for CASC15, subsequently cloning and sequencing these transcripts from two

neuroblastoma cell lines and fetal brain tissue. We verified the sequence of both the 12-exon

1.9kb CASC15 transcript (NR_015410.1, Ensembl: CASC15-003) and the 4-exon short (1.2kb)

variant (Ensembl: CASC15-004), hereafter referred to as CASC15-S. CASC15-S resembles a

known cDNA clone (GenBank: AK094718), containing a unique first exon, yet sharing its

remaining sequence with the last three exons of CASC15 (Fig. 2a, Supplementary Fig. 3a).

Despite several attempts, we were unable to isolate a 5’-capped product for the intron-less

transcript (Ensembl: CASC15-006) predicted to overlap exon 1 of CASC15-S and extend to the

noncoding enhancer element (hs1335). Indeed, although the presence of this isoform is

indicated on the SK-N-SH RNASeq track (Fig. 2a), it is absent in RNA-PET data

(Supplementary Fig. 1b), supporting this result. Finally, RNA fluorescent in situ hybridization

(RNA-FISH) experimentally confirmed the presence, relative abundance and cellular localization

of these transcripts in both NB-69 and NGP neuroblastoma cells; using non-overlapping, strand-

specific probes to label CASC15, CASC15-S, CASC14 and hs1335. These studies revealed

exclusively nuclear CASC15-S and hs1335 transcripts (Fig. 2d) and virtually no CASC14 or

CASC15 expression (Supplementary Fig. 3b,c). Taken together, these experimental results

confirm our predictive bioinformatic data identifying CASC15-S as a bona-fide lncRNA transcript

in neuroblastoma.

Identification of candidate functional SNPs at 6p22.3

Because risk alleles at several other neuroblastoma susceptibility loci have been shown

to function in cis to influence mRNA expression levels of nearby transcripts 6,9,10, we attempted

to associate our previously published, highly significant polymorphism, rs6939340 (p = 1.67x10-

14, odds ratio: 1.80, 95% confidence interval: 1.55 – 2.10)5 with expression of the CASC14,

CASC15, and CASC15-S gene products at this locus. However, we did not observe a significant

correlation between risk alleles and transcript expression levels in either a set of 250 primary

neuroblastomas (Supplementary Fig. 4a) or a representative panel of 20 neuroblastoma cell

lines (Supplementary Fig. 4b). Furthermore, all three of our previously published




12

polymorphisms lie in regions devoid of DNase hypersensitivity or other epigenetic marks

indicative of transcriptional activity. In fact, eQTL analysis of all imputed genotypes with

CASC15-S expression failed to reach significance after multiple comparison testing, leading us

to postulate that polymorphisms contributing marginal effects may aggregately impact function

at this locus.

We therefore took advantage of our genome wide imputation data to identify other highly

significant polymorphisms lying within putative regulatory regions. As demonstrated in other

post-GWAS follow-up studies 37, we employed the following workflow (Fig. 3a) to narrow the

field of potentially functional polymorphisms: (1) we first chose polymorphisms with a GWAS p-

value < 1x10-10, resulting in 32 candidates. (2) We further refined this list by selecting only those

SNPs within regions of DNaseI hypersensitivity (indicating open chromatin) and H3K27

acetylation marks (indicative of enhancer activity) leaving us with four candidates: rs1543310,

rs6905441, rs9295534 and rs9368402. (3) Lastly, we looked for SNPs with evolutionary

conservation, resulting in a single candidate polymorphism, rs9295534 (p=3.51x10-12, odds

ratio: 1.63, 95% confidence interval: 1.4 – 1.89) upstream of CASC15-S, and this variant

localizes to an expanse of regulatory chromatin and dense transcription factor binding sites in

several cell lines (Fig. 3b). Moreover, this region exhibits enhancer activity, evidenced by

H3K27Ac CHIP-Seq data in several fetal tissues available from the NIH Roadmap Epigenomics

Mapping Consortium (Fig. 3c).

We next verified rs9295534 genotypes in Chp134 (homozygous non-risk) and Lan5

(homozygous risk) neuroblastoma cells by Sanger sequencing of a 1.5kb region encompassing

this SNP, and subsequently cloned risk and non-risk fragments from these lines. To assess the

impact of rs9295534 genotype on transcriptional activity, we inserted risk (A/A) and non-risk

(T/T) fragments into luciferase reporter constructs upstream of a minimal promoter. Results from

these experiments demonstrated significantly decreased transcriptional reporter activity

following insertion of the risk genotype fragment (Fig. 3d), suggesting this region possesses an

enhancer-like function that is disrupted following the inclusion of a neuroblastoma risk allele.

CASC15-S is differentially expressed in neuroblastoma and highly associated with disease

outcome.

Because the rs9295534 homozygous risk genotype, by virtue of its linkage with

rs6939340, is associated with aggressive neuroblastoma, poor survival5, and demonstrates

decreased transcriptional activity in a minimal promoter assay, we postulated that patients with




13

high-risk disease would have reduced CASC15-S expression. Indeed, we observed significantly

lower CASC15-S expression in high-risk patient tumors (n=230) compared to low-risk patient

tumors (n=30, Fig. 4a). This finding appeared independent of MYCN amplification - a known

oncogenic driver in neuroblastoma (p = 0.29, Supplementary Fig. 5a). In addition, patients with

tumors enriched in CASC15-S expression exhibited superior survival when compared to

patients harboring neuroblastoma with low CASC15-S expression, both when low- and high-risk

patients were included in the analysis (adj. p = 3.2x10-06, Fig. 4b) but also when comparing

expression from only high-risk patients (adj. p = 0.002, Supplementary Fig. 5b). Furthermore,

this finding remained significant (p = 0.0084) after multivariate analysis adjusting for clinical

factors such as age, MYCN amplification, and 1p/11q deletion status – all known prognostic

variables in this disease (Supplementary Table 2). Although expressed at much lower levels

than CASC15-S, the long isoform of CASC15 demonstrated a similar pattern in patient tumors

(Supplementary Fig. 5c-e). Taken together, these data indicate that low CASC15-S expression

correlates with a more aggressive phenotype in neuroblastoma and decreased overall survival

probability.

In order to understand the contribution of CASC15-S in the initiation and progression of

neuroblastoma, we performed gene set enrichment analysis (GSEA) restricted to high-risk

neuroblastoma samples (n=220), where we utilized the same 1.9-fold difference in median

CASC15-S expression as the Kaplan Meier analysis to define 146 low- and 74 high-expressing

CASC15-S samples (Fig. 4c). The top differential gene expression profile (normalized

enrichment score = -2.69, nominal p-value < 0.0001, FDR q-value < 0.0001) that emerged from

these analyses consists of a 55-gene signature previously shown by Asgharzadeh and

colleagues to be downregulated in neuroblastoma patients with poor outcomes38. This result

indicates that tumors with high CASC15-S expression are enriched in the expression of these

genes, and again support a protective role for CASC15-S, resulting in less aggressive disease

within even this subgroup of high-risk cases (Fig. 4d).

CASC15 depletion in neuroblastoma cell lines enhances proliferation and invasive capabilities

Having demonstrated a clinically relevant association with patient outcome for CASC15-

S in neuroblastoma patients, we next sought functional validation for a role in tumorigenesis.

We first assessed CASC15-S levels by qRT-PCR across a well-characterized panel of

neuroblastoma cell lines (n=21) where we observed differential expression similar to our primary




14

tumor panel (Fig. 5a). To investigate the functional role of CASC15-S in neuroblastoma, we

utilized an siRNA construct targeting exon 4 near the 3’ end of the gene. Depletion of CASC15-

S resulted in a highly reproducible increase in neuroblastoma proliferation as evidenced by real-

time cell growth and viability assays (Fig. 5b), and we were able to recapitulate these results by

subsequently targeting CASC15-S within its unique first exon in several neuroblastoma lines

(Fig. 5c, Supplementary Fig. 6a,b). Depletion of full-length CASC15 or CASC14 had no

observable impact on cell growth or viability, supporting our initial findings of CASC15-S as the

functional isoform in neuroblastoma (Supplementary Figs. 6c-d, 7a-d). We next derived

neuroblastoma cell lines stably depleted of CASC15-S (Supplementary Fig. 7e) and found that

these cells also exhibited a substantial increase in cellular proliferation identical to what we

observed in our transient siRNA-based CASC15-S depletion experiments (Fig. 4d, Supplementary Figs. 6e-f, 8). Furthermore, rescue experiments, conducted by ectopically

expressing CASC15-S in these cells, were able to revert the accelerated growth (Fig. 5e).

Microscopic examination revealed overt morphological changes in shCASC15-S SK-N-BE2

cells; including striking changes in cell shape and size, with a resultant three-fold increase in cell

area (659.5 ± 50.2μm2 in control vs. 2024 ± 211.1 μm2 in shCASC15 cells, p<0.0001) (Fig. 5f, g). Furthermore, both SK-N-BE2 (Fig. 6a, b) and SK-N-SH neuroblastoma cells (Fig. 6c) stably

depleted of CASC15-S exhibited an increased migratory capacity and invasiveness as

evidenced by wound-healing assays (SK-N-SH: p=0.0006, SK-N-BE2: p<0.0001). Taken

together, these data suggest that CASC15-S loss promotes increased cellular growth and a

more migratory phenotype in neuroblastoma.

CASC15-S regulates a subset of genes involved in neural crest development.

To better characterize the phenotypic changes we observed following CASC15-S

depletion, we surveyed gene expression signatures of neuroblastoma cells depleted of

CASC15-S. For initial studies, SK-N-SH neuroblastoma cells were transfected in triplicate with

either a non-targeting construct or siRNA specific for CASC15-S, and microarray gene

expression signatures were examined at 48-hours following transfection. We observed

substantial upregulation of several known cell adhesion genes, most notably entactin (NID1, p =

3.7x10-4) and activated leukocyte cell adhesion molecule (ALCAM, p = 1.05x10-7), after

CASC15-S depletion. These gene expression data were used for gene ontology (GO) analysis

to examine enrichment top-level biological processes. In support of the increased migratory

phenotype we observed in wound-healing assays, both locomotion and cellular adhesion




15

pathways were found amongst the top differentially regulated processes as a result of CASC15-

S depletion (Fig. 6d). We next assayed the result of persistent CASC15-S depletion on gene expression

changes by comparing SK-N-BE2 neuroblastoma cells stably silenced for CASC15-S compared

to control vector-transfected cells. We again examined gene expression signatures via

microarray analysis, where we observed downregulation of several proneural gene family

members with known roles in neurogenesis and differentiation such as neurogenic

differentiation 1 (NEUROD1, p=1.1x10-4), neural precursor cell-expressed, developmentally

down-regulated gene 9 (NEDD9, p=5.8x10-4) and neurogenin 2 (NEUROG2, p=5.3x10-4). In a

manner identical to the SK-N-SH gene expression comparison, we utilized GO analysis of these

differentially regulated genesets, with the top pathway, “cellular process” arising due to

enrichment of the cell differentiation pathway node contained within this subset (Fig. 6e).

Lastly, we submitted the differentially expressed gene lists from siCASC15-S SK-N-SH

and shCASC15-S SK-N-BE2 cells to Ingenuity pathway analyses (IPA). Neuroblastoma cells

depleted of CASC15-S demonstrated highly significant upregulation of pathways involved in cell

migration, proliferation and metastasis (Fig. 6f, top), and substantial decreases in proneural

gene signatures (Fig. 6f, bottom). Taken together, these data suggest that loss of CASC15-S

shifts the neuroblastoma gene expression away from a well-differentiated neural phenotype and

promotes increased expression of cellular adhesion and migratory genes - a finding consistent

with our phenotypic and morphological observations.

DISCUSSION

High-risk neuroblastoma remains a major challenge due to a relative paucity of somatic

mutations hindering the development of targeted therapies1. The identification of mutations in

ALK and PHOX2B has helped explain the origin of familial neuroblastoma; however, an

understanding of the basis of sporadic disease has only recently begun to come into focus 39,40.

Here we identify and demonstrate CASC15-S as a neuroblastoma suppressor gene via a post-

GWAS mechanistic evaluation of a complex region of the human genome. Despite this robust

association, however, eQTL analyses correlating risk genotypes with transcript expression failed

to reach statistical significance - a likely consequence of an underpowered patient data set

and/or additional mechanisms capable of impacting expression (such as additional SNPs

affecting expression, post-translational modification/degradation, etc.). To address this

shortcoming, we fine mapped this locus, using orthogonal methodologies to identify the likely




16

disease causal SNP, rs9295534, which localizes to the closest upstream enhancer of CASC15-

S. Moreover, expression of the rs9295534 risk allele disrupts the enhancer function of this

region, proving that genotype can indeed impact transcriptional ability at this locus. More

importantly, we provide evidence for a potent effect of this lncRNA on neuroblastoma

differentiation and migratory capacities, yielding mechanistic insights into why the GWAS signal

at this locus is associated with metastatic disease and poor survival probability.

A growing body of work supports a defined role of lncRNAs as spatiotemporal-specific

regulators of gene expression critical for ensuring proper differentiation during development.

Thus, predominant expression of CASC15-S in brain (but not other tissues), the derivation of

several cDNA clones from brain regions, and its proximity to a validated enhancer element

(hs1335) strongly suggest that this lncRNA is uniquely involved in neural tube development. The

role of lncRNA-mediated tumorigenesis in embryonal cancers provides a logical hypothesis to

contribute to the understanding of the etiology of neuroblastoma tumors, which are typically

devoid of activating somatic mutations1.

A preliminary working model of how this transcript functions in neuroblastoma biology

can be proposed from the functional and expression data we have demonstrated. CASC15-S

expression strongly correlates with disease stage and overall survival, and patient tumors with

high CASC15-S levels are enriched in genes typically lost in poor outcome neuroblastoma,

demonstrating a protective role for CASC15-S. Furthermore, ablation of CASC15-S in

neuroblastoma cell lines results in increased proliferative and migratory capacities, upregulation

of adhesion and migration gene pathways and a concomitant decrease in neural-specific

transcripts. Therefore, reduced CASC15-S expression as the result an inherited polymorphism

would impact neural crest cellular lineage commitment and predispose these cells to undergo

malignant transformation.

The phenotypic and gene signatures changes we observed signify that CASC15-S is

responsible for maintaining a more differentiated and benign cell state, with CASC15-S loss

leading to a poorly differentiated phenotype and expression of genes associated with

transformed cells. It has been recently shown that CASC14 (renamed NBAT-1), although very

lowly expressed, exerts a similar phenotype41, suggesting that many lncRNAs in this region may

cooperate. The precise mechanism by which CASC15-S (and potentially other transcripts near

this locus) exerts its effect is currently under investigation, although it is likely that the observed




17

transcriptional changes may be the result of modulation of cis elements. One possibility, given

its proximity to a validated enhancer (hs1335) with neural tube expression and its position

downstream of the developmental regulatory gene SOX4, is that CASC15-S functions as an

enhancer RNA42. Future studies to identify direct interaction partners of CASC15-S will

undoubtedly strengthen our understanding of lncRNA function and yield key insights into

neuroblastoma tumorigenesis.

In summary, our findings support a recent and growing body of evidence that

convincingly demonstrates involvement of the noncoding genome in the tumorigenesis of

pediatric cancers in general, and neuroblastoma in particular 41,43-46. While we certify CASC15-S

as neuroblastoma suppressor gene, we still have not elucidated all of the stochastic and/or

epigenetic events that select for CASC15-S repression. Future studies focused on engineering

CASC15-S depletion in vivo will further explore mechanisms for tumor initiation and progression

as well as screen for synthetic lethal interactions to be leveraged therapeutically. Finally, this

work provides the first highly significant GWAS-supported identification of lncRNAs in

neuroblastoma, thus further stimulating exploration of this class of regulatory RNAs in human

cancer etiology and clonal evolution.

ACKNOWLEDGEMENTS The authors would like to acknowledge the Children's Oncology Group (U10-CA98543) for

providing blood and tumor specimens from neuroblastoma patients.

REFERENCES 1. Maris JM. Recent advances in neuroblastoma. N Engl J Med 2010;362:2202–11.

2. Brodeur GM. Neuroblastoma: biological insights into a clinical enigma. Nat Rev Cancer

2003;3:203–16.

3. Cheung N-K V, Dyer M. Neuroblastoma: developmental biology, cancer genomics and

immunotherapy. Nat Rev Cancer 2013;13:397–411.

4. Takahashi Y, Sipp D, Enomoto H. Tissue interactions in neural crest cell development and

disease. Science 2013;341:860–3.

5. Maris JM, Mosse YP, Bradfield JP, Hou C, Monni S, Scott RH, et al. Chromosome 6p22

locus associated with clinically aggressive neuroblastoma. N Engl J Med 2008;358:2585–

93.




18

6. Capasso M, Devoto M, Hou C, Asgharzadeh S, Glessner JT, Attiyeh EF, et al. Common

variations in BARD1 influence susceptibility to high-risk neuroblastoma. Nat Genet

2009;41:718-23.

7. Diskin SJ, Hou C, Glessner JT, Attiyeh EF, Laudenslager M, Bosse K, et al. Copy number

variation at 1q21.1 associated with neuroblastoma. Nature 2009;459:987-91.

8. Nguyen le B, Diskin SJ, Capasso M, Wang K, Diamond MA, Glessner J, et al. Phenotype

restricted genome-wide association study using a gene-centric approach identifies three

low-risk neuroblastoma susceptibility loci. PLoS Genet 2011;7: e1002026.

9. Wang K, Diskin SJ, Zhang H, Attiyeh EF, Winter C, Hou C, et al. Integrative genomics

identifies LMO1 as a neuroblastoma oncogene. Nature 2011;469:216–20.

10. Diskin SJ, Capasso M, Schnepp RW, Cole KA, Attiyeh EF, Hou C, et al. Common variation

at 6q16 within HACE1 and LIN28B influences susceptibility to neuroblastoma. Nat Genet

2012;44:1126–30.

11. Latorre V, Diskin SJ, Diamond MA, Zhang H, Hakonarson H, Maris JM, et al. Replication of

Neuroblastoma SNP Association at the BARD1 Locus in African-Americans. Cancer

Epidemiol Biomarkers Prev 2012;21:658-63.

12. Capasso M, Diskin SJ, Totaro F, Longo L, De Mariano M, Russo R, et al. Replication of

GWAS-identified neuroblastoma risk loci strengthens the role of BARD1 and affirms the

cumulative effect of genetic variations on disease susceptibility. Carcinogenesis

2013;34:605-11.

13. Molenaar JJ, Koster J, Zwijnenburg DA, van Sluis P, Valentijn LJ, van der Ploeg I, et al.

Sequencing of neuroblastoma identifies chromothripsis and defects in neuritogenesis

genes. Nature 2012;483:589–93.

14. Sausen M, Leary RJ, Jones S, Wu J, Reynolds CP, Liu X, et al. Integrated genomic

analyses identify ARID1A and ARID1B alterations in the childhood cancer neuroblastoma.

Nat Genet 2013;45:12–17.

15. Pugh TJ, Morozova O, Attiyeh EF, Asgharzadeh S, Wei JS, Auclair D, et al. The genetic

landscape of high-risk neuroblastoma. Nat Genet 2013;45:279–84.

16. Cheung N, Zhang J, Lu C, Parker M. Association of age at diagnosis and genetic mutations

in patients with neuroblastoma. JAMA 2012;307:1062–71.

17. Manolio TA, Collins FS, Cox NJ, Goldstein DB, Hindorff LA, Hunter DJ, et al. Finding the

missing heritability of complex diseases. Nature 2009;461:747–53.

18. Bertone P, Stolc V, Royce TE, Rozowsky JS, Urban AE, Zhu X, et al. Global identification

of human transcribed sequences with genome tiling arrays. Science 2004;306:2242–46.




19

19. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, et al. The

transcriptional landscape of the mammalian genome. Science 2005;309:1559-63.

20. Mercer T, Dinger M, Mattick J. Long non-coding RNA insights into functions. Nat Rev

Genet 2009;10:155–9.

21. Rinn JL, Chang HY. Genome regulation by long noncoding RNAs. Annu Rev Biochem

2012;81:145–66.

22. Lee JT. Epigenetic Regulation by Long Noncoding RNAs. Science 2012;338:1435–9.

23. Mercer TR, Mattick JS. Structure and function of long noncoding RNAs in epigenetic

regulation. Nat Struct Mol Biol 2013;20:300–7.

24. Chu C, Qu K, Zhong F, Artandi S, Chang H. Genomic maps of lincRNA occupancy reveal

principles of RNA chromatin interactions. Mol Cell 2011;44:667–78.

25. Ponjavic J, Oliver PL, Lunter G, Ponting CP. Genomic and transcriptional co-localization of

protein-coding and long noncoding RNA pairs in the developing brain. PLoS Genet

2009;5:e1000617.

26. Knauss JL, Sun T. Regulatory mechanisms of long noncoding RNAs in vertebrate central

nervous system development and function. Neuroscience 2013;3:200–14.

27. Gibb EA, Brown CJ, Lam WL. The functional role of long non-coding RNA in human

carcinomas. Mol Cancer 2011;10:38.

28. Prensner JR, Chinnaiyan AM. The emergence of lncRNAs in cancer biology. Cancer

Discovery 2011;1:391–407.

29. Prensner JR, Iyer MK, Sahu A, Asangani IA, Cao Q, Patel L, et al. The long noncoding

RNA SChLAP1 promotes aggressive prostate cancer and antagonizes the SWI/SNF

complex. Nat. Genetics 2013;45:1392–8.

30. Gutschner T, Hämmerle M, Eissmann M, Hsu J, Kim Y, Hung G, et al. The noncoding RNA

MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells. Cancer

Res 2013; 73:1180–9.

31. Federico S, Brennan R, Dyer M. Childhood Cancer and Developmental Biology: A Crucial

Partnership. Top Dev Biol 2011;901:1–10.

32. http://target.nci.nih.gov/dataMatrix/TARGET_DataMatrix.html

33. Delaneau O, Marchini J, Zagury JF. A linear complexity phasing method for thousands of

genomes. Nat Methods 2011;9,179-81.

34. Howie BN, Donnelly P, Marchini J. A flexible and accurate genotype imputation method for

the next generation of genome-wide association studies. PLoS Genetics 2009;5:e1000529.




20

35. Marchini J, Howie B, Myers S, McVean G, Donnelly P. A new multipoint method for

genome-wide association studies by imputation of genotypes. Nat Genet 2007;39:906-13.

36. Visel A, Minovitsky S, Dubchak I, Pennacchio LA. VISTA Enhancer Browser-a database of

tissue-specific human enhancers. Nucleic Acids Res 2007;35:D88-92

37. Zhang X, Bailey SD, Lupien M. Laying a solid foundation for Manhattan--’setting the

functional basis for the post-GWAS era'. Trends Genet 2014;30: 140-9.

38. Asgharzadeh S, Pique-Regi R, Sposto R, Wang H, Yang Y, Shimada H, et al. Prognostic

significance of gene expression profiles of metastatic neuroblastomas lacking MYCN

amplification. JNCI 2006;98:1193-203.

39. Mossé YP, Laudenslager M, Longo L, Cole KA, Wood A, Attiyeh EF, et al. Identification of

ALK as a major familial neuroblastoma predisposition gene. Nature 2008;455:930–5.

40. Mosse YP, Laudenslager M, Khazi D, Carlisle AJ, Winter CL, Rappaport E, et al. Germline

PHOX2B mutation in hereditary neuroblastoma. Am J Hum Genet 2004;75:727-30.

41. Pandey GK, Mitra S, Subhash S, Hertwig F, Kanduri M, Mishra K, et al. The Risk-

Associated Long Noncoding RNA NBAT-1 Controls Neuroblastoma Progression by

Regulating Cell Proliferation and Neuronal Differentiation. Cancer Cell 2014;26:722–37.

42. Ørom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, Bussotti G, et al. Long

noncoding RNAs with enhancer-like function in human cells. Cell 2010;143:46– 58.

43. Barnhill LM, Williams RT, Cohen O, Kim Y, Batova A, Mielke JA, et al. High Expression of

CAI2, a 9p21-Embedded Long Noncoding RNA, Contributes to Advanced-Stage

Neuroblastoma. Cancer Res 2014;74:3753–63.

44. Liu PY, Erriquez D, Marshall GM, Tee AE, Polly P, Wong M, et al. Effects of a novel long

noncoding RNA, lncUSMycN, on N-Myc expression and neuroblastoma progression. J Natl

Cancer Inst 2014;106:1-11.

45. Tee A, Ling D, Nelson C, Atmadibrata B, Dinger M, Xu N, et al. The histone demethylase

JMJD1A induces cell migration and invasion by up-regulating the expression of the long

noncoding RNA MALAT1. Oncotarget 2014;5:1793-1804.

46. Atmadibrata B, Liu PY, Sokolowski N, Zhang L, Wong M, Tee AE, et al. The Novel Long

Noncoding RNA linc00467 Promotes Cell Survival but Is Down-Regulated by N-Myc. PLoS

One 2014;9:e88112.

47. Suvà ML, Rheinbay E, Gillespie SM, Patel AP, Wakimoto H, Rabkin SD, et al.

Reconstructing and reprogramming the tumor-propagating potential of glioblastoma stem-

like cells. Cell 2014;157:580-94.




21

48. Rheinbay E, Suvà ML, Gillespie SM, Wakimoto H, Patel AP, Shahid M, et al. An aberrant

transcription factor network essential for Wnt signaling and stem cell maintenance in

glioblastoma. Cell Reports 2013;3:1567–1579.

FIGURE LEGENDS Figure 1. Fine mapping of 6p22 identifies CASC15-S as a candidate cis-acting neuroblastoma

susceptibility gene. (a) Regional association plot of single nucleotide polymorphisms (SNPs)

generated with LocusZoom software using genome wide imputation data from 2,817

neuroblastoma cases and 7,473 controls. The pair-wise linkage disequilibrium (r2) for each SNP

is denoted by color, and the log-transformed p-values for each SNP are shown on the y-axis.

Thirty-two SNPs with highly significant p-values (< 1x10-10) ranging from 4.67x10-10 to 4.81x10-17

were found to cluster as a narrow peak within a genomic region containing the lncRNAs

CASC14 and CASC15. (The exons and transcribed regions of genes are shown as solid vertical

lines.) (b) The haplotype structure of this region in Northern European (CEU) population

demonstrates a signal that overlaps with these SNPs, refining and initial 94.2kb LD block

(boundaries denoted by black vertical dashed lines) down to 34.9kb, demonstrated by the

dashed red vertical line and rightmost black vertical dashed line. (SNP annotations: color =

representative of LD r2 value (purple = reference SNP); ☐ = predicted coding or 3’UTR region; Δ

= nonsynonymous; * = tfbccons, conserved motif at transcription factor binding site, =

mcs44placental, highly conserved region in placental mammals).

Figure 2. CASC15-S is the predominant lncRNA isoform expressed in neuroblastoma. (a) Graphical representation of the lncRNA transcripts observed to originate from the 6p22.3 locus

via RNA sequencing. This locus includes two predominant transcripts on the positive strand: a

1.9kb CASC15 transcript (current RefSeq for this lncRNA) and a novel shorter (1.2kb) transcript,

CASC15-S that shares the last 3 exons with the long isoform of CASC15. These transcripts

were validated using 5’ and 3’ RACE. Epigenetic marks support active transcription (RNA PolII

occupancy) and an enhancer like function (H3K27Ac, H3K4Me3) of this region, including a

proximal VISTA enhancer element (hs1335). RNA sequencing, RNA PolII, DNAse, and P300

ChIP-Seq data were obtained from SK-N-SH neuroblastoma cells (via ENCODE), whereas

enhancer track ChIP-Seq data was taken from MGG8 human glioblastoma stem cells 47. (b) Expression levels of CASC15, CASC15-S, CASC14 and hs1335 were normalized and




22

quantified across a panel of 16 normal primary tissues (Human Body Map 2.0 project),

indicating predominant expression of the CASC15-S isoform in brain. (c) RNA sequencing

performed on 108 primary neuroblastoma tumors, analyzed for unique isoform expression,

exhibited a predominance of the short CASC15 isoform. This short isoform was expressed at

20-fold and 40-fold higher levels than CASC14 and or full-length CASC15, respectively. (d) RNA fluorescent in-situ hybridization (RNA-FISH) was conducted in NGP neuroblastoma cells

for several transcripts known to exist at this locus. To ensure probe specificity, odd and even

pools of fluorescently labeled oligonucleotide probes were used to tile CASC15-S and VISTA

hs1335. The yellow fluorescence observed in the “merge” panel was obtained from overlap of

the hs1335 and CASC15-S fluorescent signals and indicate colocalization of these two

transcripts. Consistent with the majority of described lncRNAs, these transcripts appear to be

predominately nuclear as evidenced in the “merge + DAPI” panel. (40x magnification)

Figure 3. Identification of rs9295534 as a functional polymorphism. (a) Filtration strategy

employed to refine list of imputed SPSs at the 6p22.3 locus for functional variants. We identified

SNPs with robust p-values (< 1x10-10) that fell within regions of regulator chromatin (DNase

hypersensitivity) and putative enhancer activity (H3K27 acetylation) in SK-N-SH neuroblastoma

cells. This resulted in four highly significant polymorphisms: rs1543310, rs6905441, rs9295534

and rs9368402. Further refinement based on evolutionary conservation identified rs9295534 as

the only SNP to fit all criteria. (A full table of SNP attributes is given in Supplementary Table 1)

(b) Evidence from glioblastoma cells revealing that rs9295534 (light blue vertical line) maps to

the most proximal enhancer site to CASC15-S as evidenced by DNaseI sensitivity (DS),

H3K4me1 and H3K27ac marks48. (c) Further characterization of rs9295534 was indicated due

to a robust p-value (p=3.51x10-12), as well as the inclusion of this SNP within a region of

predicted enhancer activity (H3K27Ac peaks) in several fetal tissues, including fetal adrenal

gland. (d) Functional demonstration of rs9295534 was accomplished by insertion of 1500bp risk

(A_A) or non-risk (T_T) fragments (cloned from Lan5 and Chp134 neuroblastoma cell lines,

respectively) into a luciferase reporter vector (pGL4.23) upstream of a minimal promoter.

Luciferase activity was normalized to a contransfected Renilla luciferase vector (pGL4.75).

Expression of the risk fragment resulted in significantly attenuated transcriptional activity than

was observed with the non-risk fragment following quantification of luciferase activity in HEK-

293 cells (p < 0.0001).




23

Figure 4. Low CASC15-S expression correlates with poor clinical prognosis. (a) Microarray

expression data from clinically annotated primary neuroblastoma tumors (n=250) obtained at

diagnosis reveals that high-risk (stage 4) neuroblastomas (n=220) demonstrate significantly

lower expression of CASC15-S than low-risk (stage 1) tumors (n=30). (b) Kaplan-Meier analysis

demonstrates significantly poorer overall survival for children with tumors expressing low levels

of CASC15-S (n=163 for group “low”, n=87 for group “high”, adj. p = 3.2x10-06). (c) Relevant

metrics for selection of high-risk patient tumors used for differential gene expression analyses

between patients with high (n=74) and low (n=146) CASC15-S levels. CASC15-S was

expression was increased 1.9-fold in the “High” group, and these patients exhibited a significant

increase in overall survival. (d) The most highly significantly regulated pathway using GSEA

was identified to be a set of genes downregulated in poor outcome neuroblastoma

(Asgharzadeh neuroblastoma poor survival down). Patients with high CASC15-S expression

demonstrated enrichment of these genes, suggesting that CASC15-S acts in a protective

manner. (*** p < 0.0001).

Figure 5. CASC15-S depletion induces a more aggressive phenotype in neuroblastoma cells.

(a) CASC15-S expression was investigated by qRT-PCR in a panel of neuroblastoma cell lines

(n=21) and normalized relative to the geometric mean of GUSB, HPRT and TBP housekeeping

genes. CASC15-S demonstrated a wide range of expression across neuroblastoma cell lines.

(b) SK-N-BE2 neuroblastoma cells transiently transfected with siRNA targeting an exon

common to both CASC15 and CASC15-S isoforms (exon 12 or exon 4, respectively), or (c)

specifically targeting only the unique exon of CASC15-S (exon 1), show a significant increase in

proliferative rate. (d) Stable depletion of CASC15-S in SK-N-BE2 cells was achieved with

lentiviral transduction of shRNA, and recapitulated the increased growth observed with transient

knockdown. (e) Forced ectopic expression of CASC15-S cDNA was able to rescue the growth

characteristics of SK-N-BE2 shCASC15-S cells, reverting their growth pattern to that of wild-

type cells (f) Morphological observation of SK-N-BE2 cells stably depleted of CASC15-S

showed that cells were substantially larger than control cells (scale bar = 100μm). (g) Cell area

was measured in biological triplicate (n=10 for each replicate) and quantified in ImageJ, where

the area of shCASC15 cells was found to be 3.1-fold increased over controls (*** p < 0.001).

siNTC = non-targeting control (negative control), siPLK1 = polo-like kinase 1 (positive control)

Figure 6. CASC15-S regulates a subset of genes involved in neural differentiation and

neuroblastoma tumorigenesis. (a) SK-N-BE2 cells constitutively depleted of CASC15-S




24

demonstrated an increased migratory capacity in wound healing assays (t=24h). Linear

regression comparison of wound closure at regular intervals demonstrates a clear enhancement

of migration in silenced SK-N-BE2 (b) or SK-N-SH (c) cells (EV = Empty Vector). (d) Gene

ontology (GO) analysis of SK-N-SH cells following CASC15-S depletion via siRNA at 48 hours.

The top-level biological processes are shown by percentage of enrichment signal, with both

locomotion and cellular adhesion gene sets exhibiting over representation. (e) A similar analysis

was carried out for SK-N-BE2 cells stably expressing an shRNA construct targeting CASC15-S.

The top enrichment observed in these cells, “cellular process” was primarily the result of the cell

differentiation gene subset. (f) Most significantly altered pathways in SK-N-SH and SK-N-BE2

neuroblastoma cells following depletion of CASC15-S and subjected to Ingenuity pathway

analysis. Pathways shown were the top gene signatures to arise from differential analysis, and

indicate activation of cellular programs of proliferation, migration and metastasis (shown in red),

as well as downregulation of several pathways known to modulate neural-specific development

(shown in green).

Table 1. Differential expression analysis of long noncoding RNAs between high- and low-risk

neuroblastomas. Differential gene expression analysis (> 2.0-fold, p < 0.05, FDR < 0.05) was

conducting using 220 high- and 30 low-risk primary neuroblastoma tumors, focusing on

differences in lncRNA expression. The top differentially regulated lncRNA was CASC15

(annotated here as LINC00340), which was significantly lower in high-risk disease (4.4-fold

decrease, ANOVA, p = 3.60x10-17).

Gene Ratio Disease State p-value Location

LINC00340 4.4 -fold lower in High Risk 3.60E-17 chr6:21666675-22194616


LINC01296 8.9 -fold higher in High Risk 5.80E-15 chr14:19880209-19925329









a.

b.

Figure 1

CASC15! CASC15-S!

"CASC14

22.05 22.1 22.15 22.2

Position on chr6 (Mb)

0

5

10

15

−lo

g1

0(p−

va

lue)

0

20

40

60

80

100

Reco

mbin

atio

n ra

te (c

M/M

b)

−

−

−

− − −

−

−

−−−−−−−−−−−−−−−−−−−

−−

−−−−−

−

−−−−−−−−

−

−

−−

−−

−

−−

−−

−

−

−

−

−

−

−−−

−

−−−

−

−

−

−

−−−−−−−

−−−

−

−

−

−

−

−

−

−

−

−

−−−

−

−−

−−−−−−−−

−

−−

−−

−

−

−

−

−

−

− −

−−

−

−−

−−−−

−−−

−

−

−

−

−−

−

−−−−−

−

−

−

−

−−

−−−−−−−−−−−−

−

−−

−

−−−−

−−−−−−−−−−−

−

−−−−−−−−−−

−

−−−−−−−−−

−

−−−−−−−−

−−−−−−−−−

−−−−−−−−−−−−−−−−−−−−−−−−−−

−−

−−

−

−−−−−−−−−−−

−−

−

−

−−

−−

−

−−−−−−−−

−−−−−

−

−−

−

−−

−

−

−

−

−−−−

−−−−−

−

−

−−

−

−−−−− − −−

−−−

−

−−−

−−

−−

−

−

− − −

−−−

−−

−

−−−

−

−

−

−

−−−−

−

−

−−−

−

−

−

−

−−

−

−−−

−

−

−0.2

0.4

0.6

0.8

r2

CASC15

CASC14

22.05 22.1 22.15 22.2

Position on chr6 (Mb)




CASC15 (refseq)

CASC15-S CASC140

10

20

30

RN

AS

eq

re

ad

s p

er

kilo

ba

s p

er

millio

n r

ea

ds

(R

PK

M)

hs1335 CASC15-S

Merge Merge + DAPI

b. c.

Figure 2

a.

d.




H3K27ac

Fetal Adrenal

Fetal Lung

HUVEC

Weak Transcription

Enhancer

Strong Enhancer

22112900 22113100 22113300 22113500 22113700

Chromosome 6p22.3

rs9295534

chr6:22113390

p = 3.5139e-12

a.

0.0

1.0×10-3

2.0×10-3

3.0×10-3

No

rma

lize

d L

uc

ife

ras

e

Ac

tiv

ity

Non-Risk Risk

*** p < 0.0001

3T3rs9295534 genotype

Figure 3

c.

b.

d.

3. DNase hypersensitivity H3K27 acetylation

1. Regional imputation

2. GWAS p-value < 1x10-10

4. Evolutionary conservation

Filtering Strategy Candidate SNPs

2,627

32

4

rs9295534




d. c.

Figure 4

CASC15-S

Low

CASC15-S

High

Number of patients 146 74

Median expression 435.7 820.1

MYCN Amplified 30.1% 28.9%

Median Diagnosis (yrs.) 3.01 3.16

Median Survival (yrs.) 3.31 6.38 ***

Downregulated genes associated with poor outcome in neuroblastoma

Enri

chm

ent

sco

re (

ES)

0.0

-0.1

-0.2

-0.3

-0.4

-0.5

-0.6

-0.7

NES = -2.69 Nominal p-value < 0.0001 FDR q-value < 0.0001 FWER p-Value < 0.0001

a.

0 2000 4000 60000

50

100

Overall Survival

Time (days)

Perc

en

t su

rviv

al

Low CASC15-S (n=163)

High CASC15-S (n=87)

Adj. p-value = 3.2e-06

b. Risk Group

Low Risk High Risk0

500

1000

1500

2000

***

(n=30) (n=221)

CA

SC

15

-S E

xp

res

sio

n




b.

f. g.

c.

a.

Figure 5

e.

0 24 48 72 96 1200

1

2

3

time (h)

Empty Vector

*** p < 0.0001

***

Cell

Index

shCASC15-S

Empty Vector shCASC15-S

Empty Vector shCASC15-S0

1000

2000

3000

Ce

ll S

ize

(m

m2)

***

0 24 48 72 96 1200

2

4

6

time (h)

Cell

Index

siNTC

*** p = 0.0007

***siCASC15-S (Exon 4)

siPLK1

0 24 48 72 96 1200

1

2

3

4

time (h)

Cell

Index

siNTCsiCASC15-S (Exon 1)siPLK1

***

*** p < 0.0001

d.




a.

Figure 6

Empty Vector shCASC15-S

b. c.

e.

f.

Diseases or Functions p-Value Activation z-score # Molecules

cell movement 2.65x10-14 5.283 113

migration of cells 2.84x10-14 4.71 105

homing of cells 2.07x10-10 4.36 42

angiogenesis 2.30x10-11 3.718 50

development of blood vessel 3.92x10-13 3.657 59

vasculogenesis 2.66x10-14 3.338 57

cell movement of tumor cell lines 1.63x10-11 2.972 55

proliferation of connective tissue cells 2.39x10-12 2.762 48

metastasis 1.44x10-12 2.081 51

proliferation of tumor cells 1.07x10-12 0.44 59

organization of cytoskeleton 7.55x10-7 -2.187 37

organization of cytoplasm 2.06x10-6 -2.195 38

extension of cellular protrusions 2.42x10-4 -2.202 9

migration of neural stem cells 5.06x10-8 -2.219 5

differentiation of neurons 8.31x10-4 -2.303 13

migration of neurons 5.65x10-8 -2.369 15

flux of Ca2+ 5.35x10-3 -2.395 9

migration of stem cells 1.75x10-6 -2.433 6

ion homeostasis of cells 2.71x10-3 -2.577 15

outgrowth of neurites 1.35x10-4 -2.801 15

d. 15.30% locomotion

15.11% response to stimulus

14.71% single-organism process

11.82% multicellular organismal process

7.95% developmental process

6.79% biological adhesion

5.27% cellular process

5.26% biological regulation

3.70% cellular component morphogenesis

3.44% immune system process

2.90% growth

2.76% reproduction

4.99% other

SK-N-SHsiCASC15-S

16.05% cellular process

14.79% single-organism process

12.26% developmental process

10.31% cellular component organization

10.08% multicellular organismal process

9.53% biological regulation

5.53% response to stimulus

5.16% localization

3.29% signaling

3.22% metabolic process

2.90% locomotion

2.11% multi-organism process

1.84% reproductive process

1.14% growth

1.79% other

SK-N-BE2shCASC15-S

0 6 12 18 24 30 36 420

50

100

Time (hrs)

% w

ou

nd

hea

led

SK-N-BE2 EV

SK-N-BE2 shCASC15

p = 0.0006

0 4 8 12 16 20 240

50

100

Time (hrs)

% w

ou

nd

heale

d

SK-N-SH shCASC15-S

SK-N-SH EV

p < 0.0001




Published OnlineFirst June 22, 2015.Cancer Res Mike R Russell, Annalise Penikis, Derek A Oldridge, et al. neuroblastoma susceptibility locusCASC15-S is a tumor suppressor lncRNA at the 6p22

Updated version

10.1158/0008-5472.CAN-14-3613doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2015/06/23/0008-5472.CAN-14-3613.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/early/2015/06/20/0008-5472.CAN-14-3613To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-14-3613

http://cancerres.aacrjournals.org/content/suppl/2015/06/23/0008-5472.CAN-14-3613.DC1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/early/2015/06/20/0008-5472.CAN-14-3613


CASC15-S is a tumor suppressor lncRNA at the...

Documents

Transcript of CASC15-S is a tumor suppressor lncRNA at the...