Carbon meets Silicon (& the $1000 human genome) Oct 9, 2002 HBS

26
Carbon meets Silicon (& the $1000 human genome) Oct 9, 2002 HBS

description

Carbon meets Silicon (& the $1000 human genome) Oct 9, 2002 HBS. gggatttagc tcagttggg agagcgcca gactgaa ga t ttg gag g tcctgtgtt cgatccac agaattc gcacca. Post- 300 genomes & 3D structures. 6. Commericial Advisory Roles & Technology-transfer. - PowerPoint PPT Presentation

Transcript of Carbon meets Silicon (& the $1000 human genome) Oct 9, 2002 HBS

Page 1: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Carbon meets Silicon (& the $1000 human genome)

Oct 9, 2002 HBS

Page 2: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

gggatttagctcagttgggagagcgccagactgaa gatttg gaggtcctgtgttcgatccacagaattcgcacca

Post- 300 genomes &

3D structures

6

Page 3: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Commericial Advisory Roles & Technology-transfer

Genome Pharmaceuticals  98-02 Caliper Technologies  94-02CodonCode 96-02GenProfileAG 97-02Gendaq 00-1EngeneOS 00-2BeyondGenomics 00-2 Newcogen & Flagship 00-2Longenity 01-2Xeotron 01-02Genomatica 01-2Genome Therapeutics 89-94; Biogen 84-5Tecan/Gamera 98-00FamilyGenetix 00-1;

Biorad-Sadtler 79-81Affymetrix 90-02Millipore 89-90Lynx  00-02Pyrosequencing 01-2Bruker Daltonics 93-7Mosaic Technologies   93-01 Agilent 01-2Aventis ‘98-01MJ Research Inc. 86-02Hamilton Co. 86-90Intelligent Automation 92-6Eli Lilly 98Dupont 82-4

Page 4: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Famous human mutations

PKU (preventable mental retardation)HbS (Malaria resistance)ApoE4 (dementia resistance)CCR532 (HIV resistance)

Page 5: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Pharmacogenomics Gene/Enzyme Drug Quantitative

effect

Cisapride Drug-induced torsade de pointesKvLQT1 Terfenadine, disopyramide, meflaquine Drug-induced long QT syndrome

CYP2C9Tolbutamide, warfarin, phenytoin, nonsteroidal anti-inflammatories

Anticoagulant effect of warfarin

CYP2D6

Beta blockers, antidepressants, antipsychotics, codeine, debrisoquin, dextromethorphan, encainide, flecainide, guanoxan, methoxyamphetamine, N -propylajmaline, perhexiline, phenacetin, phenformin, propafenone, sparteine

Tardive dyskinesia from antipsychotics; narcotic side

effects, efficacy, and dependence; imipramine dose requirement; beta-

blocker effect

Dihydropyrimidine dehydrogenase Fluorouracil Fluorouracil neurotoxicity

ACE Enalapril, lisinopril, captoprilRenoprotective effects, cardiac

indices, blood pressure, immunoglobulin A nephropathy

Thiopurine methyltransferase Mercaptopurine, thioguanine, azathioprineThiopurine toxicity and efficacy; risk

of second cancers

HERG Quinidine Drug-induced long QT syndrome

hKCNE2 Clarithromycin Drug-induced arrhythmia

Potassium channels

Examples of clinically relevant genetic polymorphisms influencing drug metabolism and effects. Additional data

Page 6: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

2-Oct-2002 Boston GSAC Panel Discussion"The Future of Sequencing Technology: Advancing Toward the $1,000 Genome"

Moderators: •J. Craig Venter, Ph.D., The Center for Advancement of Genomics •Gerald Rubin, Ph.D., Howard Hughes Medical Institute  Speakers:•George Church, Ph.D., Harvard University •Eugene Chen, Ph.D., US Genomics •Tony Smith, Ph.D., Solexa •Trevor Hawkins, Ph.D., Amersham Biosciences Corporation •Susan Hardin, Ph.D., VisiGen Biotechnologies, Inc. •Michael P. Weiner, 454 Corporation •Daniel H. Densham, Mobious Genomics, Ltd

Page 7: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

The impact of new technologies

Digital computers & Networks 1968-93WWW 1993-94Recombinant DNA 1976-1986Genome Project 1985-2002Stem cells 1983-2002Nanotechnology 1984-2002

Page 8: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Bionano-machines

Types of biomodels. Discrete, e.g. conversion stoichiometryRates/probabilities of interactions

Modules vs “extensively coupled networks”

Maniatis & Reed Nature 416, 499 - 506 (2002)

Page 9: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Steeper than exponential growth$GDP/person (W.Europe)

100

1000

10000

100000

1000 1200 1400 1600 1800 2000

0.001

0.01

0.1

1

10

100

1000

10000

1970 1980 1990 2000 2010

bp/$

bp/$

R2 = 0.985

R2 = 0.992

-5-3-113579

111315

1830 1850 1870 1890 1910 1930 1950 1970 1990 2010

log(IPS/$K)

log(bits/sectransmit)Quadratic

Quadratic

http://www.faughnan.com/poverty.htmlhttp://www.kurzweilai.net/meme/frame.html?main=/articles/art0184.html

Moore's law of ICs 1965

Page 10: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

How to do single DNA molecule manipulations?

Page 11: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Important alleles occur in “noncoding” non-conserved regions

Lesch KP, et al Science 274:1527-31 Association of anxiety-related traits with a polymorphism in the serotonin transportergene regulatory region

Piedrafita FJ, et al. JBC 271: 14412Alu repeat SNP near the human Myeloperoxidase gene:“severalfold less transcriptional activity”"-463 G creates a stronger SP1 binding site ... overrepresented in acute promyelocytic leukemia"

Page 12: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

The issue is not speed, but hidden costs (e.g. accuracy & integration)

Sub-microliter scale: 1m = femtoliter (10-15)Instruments <$100K per CPU.

Why low-cost, high quality sequencing? & how much?

Human genotypes 1019 bpImmune B&T cell receptor spectra 1010 bp (per year)Environment & pathogen monitoring ?RNA splicing in situ : 1012 bits/mm3

Compact storage 105 now to 1017 bits/ mm3 with DNA

& How?

Page 13: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Projected costs greatly affect our priorities

bp/$ $/genome Method 1977 0.1 30B manual (pBR322)1985 1 3B HGP goal 2002 10 300M de novo high-quality sequencing2002 300 10M dd-polyphred raw-reseq 2002 2K 2M Perlegen, Lynx2002 3M 1K per diploid? de novo? This session!2002 1013 .0003 other data types (e.g. video)

Page 14: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

New sequencing approaches in commercial R&DMethod liter/bp Length Error Test-set $/device bp/hr

Capil fluidics e-6 600 <0.1% 1e11 350k 80k

ABI, Amersham, GenoMEMS, Caliper*, RTS*

SeqByHyb e-12 1 <5% 1e9 200k 1M

Perlegen-Affymetrix*, Xeotron*

Mass Spectrometry Sequenom, Bruker*

Single molecule >e-24 >>40 ? >80 30k-1M 180k

Pore(Agilent*) Fluor(USGenomics, Solexa) FRET(VisiGen,Mobious)

In vitro DNA-Amplification (e.g. Polonies) -- Multiplex cycles:

Lynx* e-15 20 <3% 1e7 ? 1M

Pyroseq.* e-6 >40 <1% 1e6 100k 5k

CisTran* e-13<1% 40 90k >1M?

ParAllele, 454, RTS**GMC has a potential financial interest (or Harvard license)

Page 15: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

$1K per diploid human sequence

Input: buccal cells, blood, or forensic samples. Output: prioritized list of deviant bps (e.g. non-conservative).

Raw data rate: 16 pixels/bp, 1Mpixel per 6sec/CPU = 24 CPU days. Amortization: 5 yr for camera/CPU/transport @ $50K total = $200 per 1011 bp Overhead: $200 /sq ft/yr * 40 sq.ft (400 cu.ft) = $40Reagents: At 20 m per (5 m) polony and 40 bp reads means 10000 cm2 area, 800 ml of fluor dNTP, $100/mg = $40 5 ml PCR reactions = $200Disposables: 500 slides = $50 Electricity: 2 kwatts 24hr*24days* 0.13$/kwatt-hr = $150Labor for repair: 10% of instrument cost = $10 Labor for operation: Slide PCR, slide dips, scans, etc. = $20R&D: Initially NIH grants (i.e. 0% of this unbalanced budget).

Total: per genome $710

Page 16: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Long-range continuity inspired by DNA-Fiber Fluorescent In Situ Hybridization

300 kb = 100 microns

http://allserv.rug.ac.be/~fspelema/neubla/content/images_r.htm

Page 17: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Polony amplification & sequencing

Page 18: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Human DNA:Cystic

Fibrosis CFTR gene

45 kbp

Rob MitraVincent ButtyJay ShendureBen WilliamsDavid HousmanHitomi Hutzell

Page 19: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

A

AA

A

A

A

B

BB

B

BB

A

Single Molecule (library or natural A,B tags)

B

BA

A

Primer is Extendedby Polymerase

B

A

BA

Polymerase colony (polony) In situ amplification (PCR, RCA, etc.)

Primer A has 5 immobilizing Acrydite

Mitra & Church Nucleic Acids Res. 27: e34

Page 20: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

1. Remove 1 strand of DNA.2. Hybridize Universal Primer.3. Add Red (Cy3) dTTP.

B B

3 5

AGT..

T

4. Wash; Scan Red Channel

B B

3 5

GCG..

Sequence polonies by sequential,fluorescent single-base extensions

Page 21: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

5. Add Green (FITC) dCTP

6. Wash; Scan Green Channel

B B

3 5

AGT.

TC

B B

3 5

GCG..

C

Sequence polonies by sequential, fluorescent single-base extensions

Page 22: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Base added: (C) A G T (C)

(A) G (T) C (A)

(G) T C A

3 TCACGAGT AGTGCTCA

Sequencing multiple polonies

Mitra &Shendure

Alignment precision0.4 pixel

Page 23: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Polony exclusion principle &Single pixel sequences

Mitra & Shendure

Page 24: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Inexpensive, off-the-shelf equipment

MJR in situ cycler

Histology slide rack

                                                                                 

Microarrayscanner

Page 25: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Polony in situ Sequencing Summary

•Integrated!: (purify), amplify, sequence, (separate)•Femtoliter (1m) scale•Off-the-shelf equipment•Chromosome haplotyping & RNA splice-typing•In situ tissue compatible

Page 26: Carbon meets Silicon  (& the $1000 human genome)  Oct 9, 2002 HBS

Types of phenotypic effects of mutations

PKUTrisomy 21HbS