Cancer Growth Through NF-κB Signaling , Zeqi Zhou ... · 1/20/2017 · 1 Inflammatory Molecule,...
Transcript of Cancer Growth Through NF-κB Signaling , Zeqi Zhou ... · 1/20/2017 · 1 Inflammatory Molecule,...
1
Inflammatory Molecule, PSGL-1, Deficiency Activates Macrophages to Promote Colorectal
Cancer Growth Through NF-κB Signaling
Jiangchao Li#1, Zeqi Zhou#1, Xiaohan Zhang1, Li Zheng1, Dan He2,Yuxiang Ye1, Qian-Qian Zhang1,
Cui-Ling Qi1, Xiao-Dong He1, Chen Yu4, Chun-kui Shao2,Liang Qiao3,Lijing Wang*1
1.Vascular Biology Research Institute, School of Basic Course, Guangdong Pharmaceutical University,
Guangzhou 510006, China;
2. Department of Pathology, The Third Affiliated Hospital of Sun Yat-Sen University, Guangzhou
510630, China.
3. Storr Liver Centre, the Westmead Institute for Medical Research, the University of Sydney at the
Westmead, NSW 2145, Australia.
4.Department of Gastroenterology, The First Affiliated Hospital of Pharmaceutical University,
Guangzhou, China.
Running title: PSGL-1 Deficiency Promotes Intestinal Tumor Growth
#These authors contributed to this work equally.
*Corresponding authors: Lijing Wang (E-mail: [email protected])
2
Abstract
P-selectin glycoprotein ligand 1 (SELPLG/PSGL-1) is an inflammatory molecule that is functionally
related to immune cell differentiation and leukocyte mobilization. However, the role of PSGL-1 in
tumor development remains unknown. Therefore, this study investigates the mechanistic role of
PSGL-1 in the development of intestinal tumors in colorectal cancer (CRC). ApcMin/+ mice, are
highly susceptible to spontaneous intestinal adenoma formation, and were crossbred with PSGL1-null
mice to generate compound transgenic mice with a ApcMin/+;PSGL-1-/- genotype. The incidence and
pathological features of the intestinal tumors were compared between the ApcMin/+ mice and
ApcMin/+;PSGL-1-/- mice. Importantly, PSGL-1 deficient mice showed increased susceptibility to
develop intestinal tumors and accelerated tumor growth. Mechanistically, increased production of the
mouse chemokine ligand 9 (CCL9/MIP-1γ) was found in the PSGL-1 deficient mice, and the
macrophages are likely the major source of MIP-1γ. Studies in vitro demonstrated that
macrophage-derived MIP-1γ promoted CRC tumor cell growth through activating NF-κB signaling.
Conversely, restoration of the PSGL-1 signaling via bone marrow transplantation reduced MIP-1γ
production and attenuated the ability of ApcMin/+;PSGL-1-/- mice to generate intestinal tumors. In
human CRC clinical specimens, the presence of PSGL-1 positive cells was associated with a favorable
TNM staging and decreased lymph node metastasis.
Implications: PSGL-1 deficiency and inflammation render intestinal tissue more vulnerable to develop
colorectal tumors through a MIP-1γ/NF-κB signaling axis.
KEYWORDS: PSGL-1, MIP-1γ, ApcMin/+ mice, Intestinal tumor
3
Introduction
Colorectal cancer (CRC) is one of the leading causes of cancer-related death in developed countries and
some developing countries(1,2). Genetic alterations of the tumor-suppressor genes such as mutation of
Adenomatous Polyposis Coli (APC) have been shown to drive the transformation of normal epithelium
to adenomatous polyp and finally lead to invasive CRC(3,4). Apart from the altered genetic
susceptibility, chronic inflammation in the gut has also been implicated as a critical risk factor for the
development of CRC(5).
P-selectin glycoprotein ligand 1 (PSGL-1) is a member of the selection family of adhesion molecules.
It is mainly expressed in immune and inflammatory cells, and is involved in the recruitment of immune
and inflammatory cells to the site of inflammation by rolling and tethering(6). PSGL-1 is also essential
for cell differentiation as deficiency of PSGL-1 was found to affect the differentiation of myeloid cells
and maturation of lymphocytes.(7,8) P-selectin deficient mice manifested impaired leukocyte adhesion
which could be restored by administration of soluble P-selectin(9). Previous studies have indicated that
P-selectin is important in regulating leukocyte adhesion. PSGL-1 can form a constitutive complex with
Nef-associated factor 1 (Naf1), which is then phosphorylated by Src family kinase and subsequent
recruitment of phosphoinositide-3-OH kinase p85-p110 delta heterodimer, leading to activation of
leukocyte integrins(9). These studies suggest that PSGL-1 is essential for inflammatory response.
In process of inflammatory response, Macrophages play a key role, PSGL-1 and P-selectin are
expressed in peritoneal macrophages(10). Macrophages secrete many cytokines and chemkines which
can provoke either anti-tumor or pro-tumor immune response. In procaryotic organism, chemokines are
small molecule proteins with crucial roles in mediating inflammatory responses and tumor immune
responses, in that they can direct trafficking of leukocytes into tumor microenvironment and guide cell
movements away from poisons in response to cellular insults(11). In addition, chemokines are critical
to early development (for example, they can facilitate the movement of sperm towards the egg during
4
fertilization and subsequent phases of development)(12). Recent studies have shown that chemokines
can either promote or inhibit tumor growth and metastasis(13-16). Thus, the biological functions of
chemokines are rather complicated and are likely cellular context dependent.
In this study, we investigated if PSGL-1 deficiency facilitates the growth of CRC using ApcMin/+
mice as a model.
Materials and Methods
Mice and animal care
ApcMin/+ mice and P-selectin glycoprotein ligand-1 (PSGL-1) homozygous knockout mice were
purchased from Jackson laboratory (Stock No:002020, https://www.jax.org/strain/002020 and Stock
No:004201, https://www.jax.org/strain/004201) by Prof. Jianhguo Geng. The two kind of mice are
C57BL/6 background (C57). ApcMin/+ mice were crossbred with PSGL-1-/- mice to generate
ApcMin/+;PSGL-1-/- mice(S. Fig. 1). Mice were housed under specific pathogen-free conditions in
Animal Center of Guangdong Pharmaceutical University. All animal experiments were performed in
accordance with institutional guidelines and were approved by the Animal Ethics Committee of
Guangdong Pharmaceutical University.
Analysis of intestinal tumors
After mice being sacrificed, the intestines were removed and sliced longitudinally, rinsed with 0.9%
NaCl, fixed with 4% paraformaldehyde (PFA) for overnight, and spread onto slides which were treated
with 3-Aminopropyl-Triethoxysilane(APES). Each small intestine was divided into three equal sections:
proximal, middle, and distal segments. Then stained with 0.1% methylene blue. The number of tumors
was counted in each section, and a digital caliper was used to measure the tumor length (L) and width
(W) under the dissecting microscope. Tumor diameter is equal to or less than 2 mm were indicated as
microadenomas, while tumor diameter more than 2 mm indicated adenomena (S. Fig. 2) and
reference(17). Tumor volume was calculated by the formula V= 0.5 ×L×W2. In order to assess and
5
compare the tumor incidence in each group, all separate intestinal sections from each animal were
rolled into concentric circles that it mean to “restore” intestines construction. The “restored” intestines
were then embedded in paraffin blocks, cut into sections of 5 μm thickness, and then are used in H&E
or IHC procedures using assess the intestinal tumors foci under the microscope or detect.
H&E staining, Immunohistochemistry and immunofluorescent staining
Intestinal tumors were fixed in 4% formalin overnight, then were rinsed with PBS, subsequently
dehydrated in 35, 50, and 75% ethanol, and then embedded in paraffin. 5μm sections were
deparrafinized in xylene and rehydrated in 100, 95, 70, and 50% ethanol then PBS. The sections was
carried out H&E staining as our previously described. The score of H&E staining was assessed and
rating by tumor Pathologist. Immunohistochemistry (IHC) was performed as described on the website
of Cell Signaling Technology, Inc (MA, USA). Primary antibodies include Ki67 (1:100, Abcam, USA),
CD34 (1:50, Abcam, USA), PSGL-1 antibody(1:50, Cat: sc-18855, Santa Cruze) , CCR1
antibody(1:100, Cat:BA2231-1, Boster, Wuhan, China), pp65 antibody (1:500, Phosho-NF-κB p65
(93H1), CST, MA, USA), TNF-α(1:100, Boster, Wuhan, China), Second Antibody detection
system(LSAB™2 Kits, Universal,HRP anti-Rabbit/Mouse, Glostrup, Denmark). The slides were
pre-treated with EDTA solution (pH=8.5) for antigen retrieval, and then incubated with the primary
antibody at 4℃ overnight. Second antibody detection system was used to visualize IHC staining results.
For immunofluorescent staining, the tumor specimens were fixed in 4% PFA and subsequently
incubated in PBS containing 30% sucrose and frozen at ℃−80 . The frozen sections were incubated with
anti-TNF-α or anti-pp65 antibody and imaged using confocal microscopy (Leica).
Cell culture and transfection
Colorectal carcinoma cell lines HCT-116, SW620, and SW480, were obtained from the cell bank of the
Chinese Academy of Sciences (Shanghai, China) in recent 2 years. They were authenticated by
Guangzhou Cellcook Cell Biotechnology, LTD. using PowerPlex® 16 HS System (Promega). and The
6
murine tumor cell lines CT26 ( derived colorectal carcinoma) and murine macrophage RAW264.7
purchased from the cell bank of the Chinese Academy of Sciences were cultured less than 10 weeks
from frozen stock for this study. Primary culture macrophage was collected from peritoneal wash
obtained with 0.9% NaCl. The cells were incubated at 37°C in a humidified chamber containing 5%
CO2 and cultured with Dulbecco’s Modified Eagle’s Medium (DMEM, GIBCO, USA) with 10% fetal
bovine serum, plus 100 U/mL penicillin, and 100 μg/mL streptomycin. Lipofectamine 2000 (Invitrogen,
USA) was used to transfect siRNAs to Raw 264.7 cells (final concentration 100 nM). Human PSGL-1
siRNA and control siRNA were purchased from Ribobio Inc. (Guangzhou, China), and transfections
were performed using lipofectamine 2000(Invitrogen, USA).
Measurement of serum cytokines
Serum sample from each mouse was obtained by centrifuging the whole blood at 3000g for 5 minutes.
Cytokines in each sample were analyzed using the RayBio® Mouse Cytokine Antibody Array Kit or
Mip-1γ Elisa kit (Raybiotech, Inc., GA, USA) as described in details in the manufacturer instructions.
Western blotting
Detailed procedures for Western blotting were described in our previous publications(?). Briefly, whole
proteins from the intestinal tumors and cultured CRC cells were extracted using the lysis buffer (Cell
Signaling Technology, Inc, MA, USA). Approximately 30μg of protein from each sample was
subjected to 10% SDS-PAGE by electrophoresis under reducing conditions and transferred to
polyvinylidene fluoride (PVDF) membranes (Millipore Corporation, Billerica, MA, USA), and blocked
overnight with 5% skim milk for 1 h. The membranes were then incubated at 4°C for overnight,
washed in TBST, and incubated with the secondary antibody (anti American hamster horseradish
peroxidase-IgG). The blots were then developed with chemiluminescent (ECL) reagents and imaged on
X-ray film by autoradiography. Anti β-actin or anti-Lamin A was used as the loading control. Quantity
One software (Bio-Rad, CA, USA) was used to measure the band intensity. Anti-bodyTNF-α
body(Boster, Wuhan, China), Anti-body pP65(Cat: #3033, CST, USA), antibody Lamin A(Boster,
7
Wuhan, China), antibody β-actin(Cat:#4970, CST, USA).
Flow cytometry analysis
Tumor tissues and spleen were made into single cell suspensions in PBS supplemented with 1% BSA
as previously described. Blood samples were collected and the red blood cells were lyzed with lysis
buffer (Life technologies, NY, USA). Gallios Flow Cytometer (Beckman, CA, USA ) was used to
determine the expression of F4/80 which is regarded as macrophage surface markers. The anti-mouse
F4/80-FITC antibody (clone: REA126) were purchased from Miltenyl Biotec Cologne Germany,
anti-mouse CD3e PE-Cy5 (clone:145-2C11), anti-mouse CD8a PE (clone:53-6.7), anti-mouse CD4
FITC (clone:GK1.5), anti-mouse CD45RO APC, anti-mouse CD19 PE (clone:1D3), anti-mouse CD11b
Alexa Fluor488 (clone:M1/70), anti-mouse CD11c (clone:53-0114) all were purchased from
ebioscience Inc.(MA, USA). An isotope control was included in the quadrant analysis. The percentage
of cells of interest, as indicated by mean fluorescence intensity, was analyzed using FlowJo software
(Tree Star, Inc. OR, USA). At least three independent experiments were conducted for each group.
Detecting DNA Content by Flow Cytometry
Cells were seeded to 6-well plates at 30% confluence. Serum-free medium with L-Mimosine (400 lM)
was added for G1 synchronization. After 24 hours, medium containing 10% fetal bovine serum(FBS)
was added for an additional 12 hours. Cells were fixed in 75% ethanol, stained with 100ng/ml
4',6-diamidino-2-phenylindole (DAPI), and analyzed by flow cytometry. The results of cell cycle were
analyzed with FlowJo software (Tree Star, Inc. OR, USA) according to the manufacturer’s instructions.
RNA isolation and Real time PCR
Total RNA of blood and spleen cells was isolated using Trizol reagent (Invitrogen, USA) according to
the manufacturer's instructions. The first cDNA chain was obtained using oligo dT primers with cDNA
Reverse transcription kit (Takara,Japan). Quatitative PCR(qPCR) was performed with PCR Master
Mix(Takara, Japan) on Applied Biosystems 7500. The PCR amplification was carried out with a 3-min
8
pre-denaturation at 95℃min, and 35 cycles: 95℃ for 35s; 57℃, for 40s and 72℃for 50 s, followed by a
10-min extension at 72℃. GAPDH served as an internal control to normalize the starting cDNA levels.
PCR primers were listed as follows: Mip-1γ: F:5’-3’ CCCTCTCCTTCCTCATTCTTACA, R: 5’-3’
AGTCTTGAAAGCCCATGTGAAA, which amplify fragment located in C-C motif chemokine
9,192-332.
PCR array
To explore which signal pathway accelerated tumor growth after stimulating by MIP-1γ. We analyze
the mRNA expression level of the signal pathways relevant genes with RT2 Profiler PCR Arrays kit
(Qiagen kit,Cat:PAMM-014, CA, USA). According to the experimental workflow, we prepared sample
as 25 ng of RNA and obtained cDNA with the RT² PreAMP cDNA Synthesis Kit, and analysed the
PCR data with analysis software on web site of Qiagen. The RT2 Profiler PCR Array incorporates
laboratory-verified assays for 96 pathway-focused genes, 5 housekeeping genes for normalization, and
controls that check for sample quality and reaction quality .
Enzyme-linked immunosorbent assay
The serum levels of MIP-1γ were analyzed using commercially available enzyme-linked
immunosorbent assay (Mouse MIP-1 gamma ELISA) (Cat No.: P51670, Raybiotech, Inc., USA). The
serum was centrifuged and then stored at −80◦C until analysis. The measurements were conducted
according to the manufacturer’s instructions. All samples were assayed in triplicate, and mean values
were calculated.
Proliferation assay
Cell Counting Kit-8 (Dojindo, Japan) was used to determine the proliferation rates of a series of cancer
and control cell lines. Cells were seeded at a density of 1×103 cells/well on 96-well plates and cultured
for 5 days (n = 4 per cell line).
Bone marrow transplantation
9
Recipient mice were given full-body irradiation at the dose of 8.5Gy within 3 times, 5 min each time..
Donor mice (C57, male, 6-8 weeks old) were sacrificed under anesthesia by diethyl ether. Following a
3-week recovery period, the mice were further subjected to the experimental conditions described
elsewhere in the manuscript and animals were monitored for tumor development.
Statistical analysis
SPSS 16.0 was used to analyze the results expressed as the mean ± SD. The mRNA level in cell lines
and tissue was compared using paired Student t test to examine the differences between groups. The
graph was drawn and performed with Prism5 software (GraphPad). A X2 test or Fisher’s exact test was
used to analyze the significance of PSGL-1 expression in the tumor tissue and notumor tumor. The
clinical pathologic factors, including age, sex, histologic, and pathologic stage, invasion, as well as the
TNM stage, were considered, and a Log-rank test for survival was performed to compare the positive
and negative staining results. Kaplan-Meier curves were plotted according to overall survival. Cox
proportional hazards models were adopted to analyze all clinical factors. P<0.05 was considered
significant.
Results
PSGL-1-/- mice exhibit increased susceptibility to develop intestinal tumors
To investigate if PSGL-1 deficiency would affect the susceptibility of mice to develop intestinal tumors,
we crossbred ApcMin/+ mice with PSGL-1-/- mice to generate ApcMin/+;PSGL-1-/- mice, as detailed in the
Supplemental Figure 1 (S Fig. 1). As shown in Fig. 1A, compared to ApcMin/+ mice, ApcMin/+;PSGL-1-/-
mice were significantly more susceptible to develop intestinal tumors as macroscopically revealed by
methylene blue staining of in different intestinal segments ( ileum section) (Fig.1A), and quantitatively
demonstrated by the markedly increased tumor volume(Fig.1B) and tumor number (Fig.1C) of the
intestinal tumors (including microadenoma, ≤2 mm in ameter; and adenoma, >2 mm in diameter) in the
ApcMin/+;PSGL-1-/- mice at 9, 18 and 24 weeks of treatment (* P<0.05; ** P<0.01; *** P<0.01). And
10
these mice displayed more signifcicantly worse survival compared to the ApcMin/+ mice (Fig. 1D,
P<0.01). In addition, ApcMin/+;PSGL-1-/- mice lose more body weight than the ApcMin/+ mice after 9, 18
and 24 weeks of treatment (S Fig. 3). To further confirm the role of PSGL-1 signaling in intestinal
carcinogenesis, we conducted a study where the PSGL-1 signalling was eliminated by total body
iradiation and then restored by transplanting the normal bone marrow cells from the wild type C57BL/6
mice. As expected, following tumorigenic treatment, there was no significant difference in the tumor
incidence between the C57:ApcMin/+;PSGL-1-/- mice chimeras and the C57:ApcMin/+ mice(S Fig.8,
P<0.01). Clearly, PSGL-1 deficiency promotes intestinal tumorigenesis.
PSGL-1-/- mice displayed an accelerated tumor progression
To further reveal the impact of PSGL-1 deficiency on the development and progression of
intestinal tumors, the pathological features of the intestinal tumor tissues from each group of
mice were microscopically analyzed. An overview of the H&E stained entire intestines revealed
more tumors in the ApcMin/+;PSGL-1-/- mice than in the ApcMin/+ mice (Fig. 2A). Three stages of
tumor development were observed, ranging from the very mild hyperplasia to the adenoma and
finally the adenocarcinoma, as exemplified in the intestines of ApcMin/+ mice (Fig. 2B).
Detailed breakdown analysis revealed that 37.7% of the intestinal tumors in ApcMin/+ mice were
hyperplasia, 52.5% were adenomas, and 9.8% were adenocarcinomas. In contrast, most intestinal
tumors in the ApcMin/+;PSGL-1-/- mice were adenomas and adenocarinomas (Fig. 2C, ** P<0.01).
By immunohistochemistry (IHC), the tumors in the ApcMin/+;PSGL-1-/- mice were more
proliferative than the tumors of the ApcMin/+ mice as demonstrated by the significantly increased
number of Ki67 positive cells in the former group (Figs. 2D and 2E, * P<0.05). Tumors in the
ApcMin/+;PSGL-1-/- mice also showed increased microvascular density as indicated by the
increased expression of CD34 (Figs. 2F and 2G, * P<0.05).
Macrophage inflammatory protein 1-gamma is up-regulated in PSGL-1-/- mice
PSGL-1 is mainly expressed in inflammatory cells including leukocytes, and can be recruited to and
11
accumulate in tumor or adjacent non-tumoral tissues. We have revealed an increase of neutrophils in
blood of PSGL-1-/- mice (S Fig. 4), and this is consistent with the mouse data provided by Yang J(18).
Neutrophil and other type immune cells may explain the tumor fast growth or tumor development in
tumor environment(19). In contrast, there was a marked decrease in the number of leukocytes in tumor
of the ApcMin/+;PSGL-1-/- mice as compared to ApcMin/+ mice, suggesting that PSGL-1 knock out would
not increase but decrease immune cell recruitment in ApcMin/+ and PSGL-1-/- tumor-bearing mice(S Fig.
5). The other potential mechanism is that PSGL-1 may affect the differentiation of hematopoietic stem
cells and disturb the cells of myeloid lineage to develop into granulocytes, monocytes, megakaryocytes
and dendritic cells, thereby affecting the homeostasis of immune system, and impairing the
self-renewal and differentiation of hematopoietic stem cells(20). In order to reveal the mechanisms by
which PSGL-1 deficiency contributes to the tumor development, we used a commercial cytokine array
kit (the RayBio® Mouse Cytokine Antibody Array Kit, USA) to determine the cytokine levels in the
serum samples of tumor-free PSGL-1 deficient mice and wild type mice. As shown in Fig. 3A. higher
serum level of macrophage inflammatory protein 1-gamma (MIP-1γ, also known as MIP-1γ) was found
in PSGL-1-/- mice than in wild type mice (Dots were semi-quantitatively scanned with Image J software
As shown in Fig3A, PSGL-1-/-:C57=3.7, normalized by GAPDH).
Meanwhile, significantly higher level of MIP-1γ mRNA was found in the white cells of PSGL-1-/-
and ApcMin/+;PSGL-1-/- mice, as compared to those of the C57 mice and ApcMin/+ mice, respectively (**,
P<0.01, ***<0.001) (Fig. 3B). Using ELISA, we found the similar patterns of the serum MIP-1γ
protein in these mice (Fig. 3C. a: C57 and PSGL-1-/- mice without tumors; b: C57 and PSGL-1-/- mice
bearing tumors but less than four weeks. * P<0.05).
In order to investigate the source of MIP-1γ, we isolated macrophages from the mouse peripheral blood
and spleen tissues by flow cytometry using F4/80 as a marker. Collected cells were first stained with
anti-CD45 (a marker for bone marrow-derived cell), and CD45+ cells were gated (Fig. 3D, a). The cells
were then stained for F4/80. We observed a significantly increased percentage of F4/80+ cells in blood
12
(Fig. 3D, b) and spleen (Fig. 3D, c) of the PSGL-1-/- and ApcMin/+;PSGL-1-/- mice, as compared to the
C57 and ApcMin/+ mice, respectively (*P<0.05, **P<0.01). Furthermore, the macrophages derived from
the ApcMin/+;PSGL-1-/- mice showed a significantly increased expression of MIP-1γ mRNA (Fig. 3E)
and protein (Fig. 3F), as opposed to the ApcMin/+ mice (** P<0.05). In addition, we co-localized F4/80
expression with PSGL-1 expression in ApcMin/+ mice and human colorectal tissue(S Fig.10).
To confirm these data, we knocked down PSGL-1 in Raw 264.7 cells (a macrophage cell line), and
measured the expression of MIP-1γ in the treated cell lysates. Knockdown of PSGL-1 by si-PSGL1
(Fig. G) led to a significant increase of MIP-1γ (Fig. H, *P<0.01). To reconstruct the PSGL-1
signaling, we performed bone marrow transplantation assay. ApcMin/+ mice or ApcMin/+;PSGL-1-/- were
lethally irradiated to wipe out the bone marrow, followed by reconstitution of bone marrow with that
from C57BL/6 mice. This way, we generated C57/PSGL-1+/+ chimeras. As shown in S Fig. 8, following
an 8-week recovery, there was a significant decrease in the serum level of MIP-1γ in the bone marrow
recipient mice, and no significant compared to ApcMin+ mice.
MIP-1γ promotes tumor cell growth in vitro
The above data indicate that MIP-1γ derived from the macrophages may play a tumorigenic role in the
intestinal tumorigenesis in PSGL-1 deficiency mice. We further confirmed the mRNA expression of
MIP-1γ in the macrophages isolated from mouse peripheral blood and Raw264.7 cells (MIP-1γ primer
amplify: C-C motif chemokine 9,192-332), and MIP-1γ is not found in human tumor cell such as
HCT116, SW620, SW480 (Fig. 4A), which expression were confirmed only in mouse before study(21).
Previous studies have shown that the receptor for MIP-1γ termed CCR1 is generally present on the
lymphocytes and tumor cells(22-28), and this receptor may facilitate tumor metastasis(29,30). We
confirmed the expression of CCR1 in the intestinal tumor tissues of ApcMin/+ mice by IHC analysis and
murine tumor cell line CT26 by Western Blot (Fig. 4B).
To further confirm the tumorigenic role of MIP-1γ, colorectal tumor cells(CT26) were treated with
enxogenous MIP-1γ, and the effect on cell growth and cell cycle progression was studied. As shown in
13
Fig. 4C, MIP-1γ could significantly stimulate the tumor cell growth in a time- and dose-dependent
manner, and these changes were associated with an increased proportion of G2/M cells (Fig. 4D) and
increased ability of cells to migrate (Fig. 4E). These effects were partially reversed by the treatment of
cells with the neutralizing antibody against MIP-1γ (data not shown). Taken together, these results
indicate that MIP-1γ may exert a tumorigenic role.
MIP-1γ activates NF-κB pathway in tumor cells
To investigate the molecular mechanisms of MIP-1γ promoting tumorigenesis, a commercial PCR
array kit (S Table 2) was used to evaluate the possible singling pathway(s) that is (are) activated by
MIP-1γ. We use qPCR to detecting mRNA of the MIP-1γ treatment group and control group using
CT26 cell lines. As shown in Fig. 5A, the mRNA expression of several genes related to the NF-κB
pathway were up-regulated in tumor cells treated by MIP-1γ. Furthermore, significantly increased
expression level of TNF-α protein was found in the intestinal tumor tissues of the ApcMin/+;PSGL-1-/-
mice compared to ApcMin/+ mice, as determined by ELISA (Fig. 5B) and immunohistochemistry (Fig.
5C). These immunohistochemical findings were further confirmed by Western blot analysis(Fig. 5D).
Moreover, a significant activation of NF-κB, as indicated by a significantly up-regulated expression
level of pp65 in the nuclear compartments of the intestinal tumor tissues from ApcMin/+;PSGL-1-/- mice
as compared to the ApcMin/+ mice (Fig. 5C, Down). Additionally, treatment of CT26 cells by MIP-1γ led
to a marked activation of NF-κB, as indicated by increased expression of pp65 in the nuclear
compartment (Fig. 5E) and increased translocation of pp65 (Fig. 5F). Taken together, these data
strongly suggest that MIP-1γ activates NF-κB pathway in tumors.
Infiltration of tumor tissues by the PSGL-1 positive cells is positively associated with TNM stage
and lymph metastasis in CRC patients
Almost 100% of the PSGL-1 positive cells were found in the adjacent non-tumorous intestinal tissues
and tumor tissues in mice (S Fig. 9A).To investigate the correlation between the infiltration of PSGL-1
positive cells in the tumor tissues and the clinicopathological features of the tumors, expression of
14
PSGL-1 was detected in 38 cases of human CRC tissues by immunohistochemistry. The PSGL-1 was
mainly expressed on the membrane of non-tumor cells, and these PSGL-1 positive cells were present
around the cancer tissues in CRC patients (Fig. 6).
We further divided the intestinal tumor tissues into two subgroups according to the number of PSGL-1
positive cells infiltrating the tissues: low infiltrating tissues <50 cells per low magnification (10×)
field](17) and high infiltrating tissues [≥50 cells per field high magnification (100×) field]. Patients
with low level of PSGL-1 cell infiltration showed more advanced TNM stages (Fig. 6 and Table 1,
P=0.00065) and more lymph node metastasis (Table 1, P=0.0008)., as exemplified in S Fig. 9B and 9C
(** P<0.01). No statistically significant association was found between the level of PSGL-1 expression
and the rest of the clinicopathological features including gender and age (Table 1, P=0.7205 and 0.4417,
respectively).
Discussion
The role of PSGL-1 in tumor metastasis was not recognized until recently(31). In the present study, we
observed that PSGL-1 may play an oncogenic role in the development of intestinal tumors, and this is
likely mediated through activation of NF-κB signaling by MIP-1γ. We first observed that PSGL-1
deficient mice (i.e., ApcMin/+;PSGL-1-/- mice and and PSGL-1-/- transgenic mice) showed an accelerated
growth of intestinal tumors and xenograft tumors, respectively. We then demonstrated an up-regulation
of MIP-1γ in the PSGL-1 deficient mice, and the increased MIP-1γ level was likely derived from the
macrophages which may have produced MIP-1γ via activation of NF-κB pathway, promoting the
intestinal tumorigenesis, as schematically shown in Fig. 6H.
PSGL-1 was reported to assist the rolling and migration of macrophages, T cells and B cells(32), which
are believed to be the key effector cells linking the tumor microenvironment and tumor development.
Blockade of PSGL-1 was reported to decrease the recruitment of CD14+ monocytic cells and T cells to
15
the intestinal mucosa and attenuate the established colitis in experimental murine models(33,34). These
data are consistent with our results in PSGL-1 deficient mice (S Fig.5). These published data and our
own results suggest that PSGL-1 deficiency could impair the recruitment of key immune cells such as
leukocytes to the inflammatory sites(35). PSGL-1 positive cells is associated with clinic TNM stage,
suggesting PSGL-1 positive cell play important role in CRC development. The role of PSGL-1 in
gastrointestinal tumorigenesis is further supported by our findings in clinical study, which shows that
the presence of PSGL-1 positive cells in the tumor tissues is positively correlated with a favorable
TNM staging and lymph node metastasis, but the lymph node metastasis in ApcMin+; PSGL-1-/- mice
would need clear in next work.
The mechanisms by which PSGL-1 deficiency promotes tumorigenesis are not clear. We proposed that
key cytokines or chemokines produced in the PSGL-1 deficient mice are likely responsible for
increased tumor growth in these animals. We have shown that PSGL-1 is mainly expressed in immune
cells rather than in cancer cells, and PSGL-1-/- mice exhibit increased serum level of
macrophage-derived MIP-1γ suggesting that up-regulation of MIP-1γ may play a major role in
accelerating the intestinal tumorigenesis. These findings are in accordance with the published data in
that many chemokines were found to promote tumor growth through various mechanisms such as
stimulating angiogenesis, enhancing tumor cell proliferation and dissemination(26,28,36,37). In
support of these data, previous studies have demonstrated that up-regulation of many chemokines (such
as CCL7, CCL20, CCL25, CXCL1 and CCL26) and chemokine receptors (such as CCR8, CCR6, and
CXCR2) in tumor tissues was mechanistically linked to the tumor growth(38). The other potential
mechanism is that PSGL-1 may affect the differentiation of hematopoietic stem cells and disturb the
cells of myeloid lineage to develop into granulocytes, monocytes, megakaryocytes and dendritic cells,
thereby affecting the homeostasis of immune system, and impairing the self-renewal and differentiation
of hematopoietic stem cells(20).
16
The tumor promoting effect of chemokines is believed to be related to their role in facilitating
trafficking of leukocytes into tumor microenvironment. In our study, we demonstrated that tumor cells
express MIP-1γ receptor (CCR1) and MIP-1γ could directly promote tumor cell growth via a
ligand-receptor interaction. Our data are supported by the previous reports that tumor cells express
chemokine receptors and they can acquire the ability of direct responding to chemokines.(39) It should
be mentioned here that MIP-1γ expression was only found in the immune cells of mouse but not human
origin, and tumor cells do not express MIP-1γ. We also identified the presence of the conserved domain
of MIP-1γ in IL-8, CCL5, and other chmokines (data not shown). On the other hand, nearly all
cytokine domains can be found on MIP-1γ, and some domains have been explored as the therapeutic
targets for inflammatory diseases and cancers. These data suggest that MIP-1γ contains a highly
conserved domain that is related to the classical function of chemokines. This is supported by our
finding that MIP-1γ could activate NF-κB, a classical transcription factor involved in innate immunity,
inflammation and cancer development. Previous studies have revealed that MIP-1γ could promote
osteoclast formation and survival through activation of canonical NF-κB signaling pathway(40). In our
study, MIP-1γ was found to potently activate the NF-κB signaling. We therefore propose that the
tumorigenic effect of PSGL-1 deficiency may be mediated through enhancing the secretion of MIP-1γ
via NF-κB signaling. Additionally, up-regulation of MIP-1γ may stimulate the WNT/β-Catenin
signaling which is also a tumorigenic pathway for intestinal cancers (S Fig. 7). activation of
WNT/β-catenin pathway by MIP-1γ may also play a role, but this awaits further studies to confirm.
Previous studies have shown that PSGL-1 deficiency may affect the immune cell differentiation and
neutrophil function, and therefore contribute to tumor growth(41). Our data has confirmed that
macrophages are the major source of MIP-1γ in PSGL-1 deficient mice, and it is not clear whether
MIP-1γ drives the transition of M1 macrophages to M2 macrophages, which have been shown to extert
tumor-promoting effect(42-44). Detailed mechanisms for MIP-1γ up-regulation in the setting of
17
PSGL-1 deficiency and the mechanisms by which MIP-1γ promotes tumorigenesis require further
studies.
In summary, our data convincingly show that PSGL-1 deficiency promotes tumor growth by secreting
MIP-1γ, and the presence of PSGL-1 positive cells in tumor tissues is associated with a favorable
patient survival in CRC patients. Further studies to clarify the molecular mechanisms involved in the
oncogenic effect of MIP-1γ and whether MIP-1γ holds any potential as a therapeutic target for
intestinal cancers are warranted.
Disclosure of Potential Conflicts
No potential conflicts interest were disclosed.
Authors’ Contributions
Study design: Lijing Wang, Jiangchao Li.
Data collection, analysis, and interpretation: Zeqi Zhou, Li Zheng, Xiaohan Zhang, Jiangchao Li,
Samples collection: Chun-kui Shao, Dan He, Yuxiang Ye,Yu Chen.
Statistical analysis: Jiangchao Li, Zeqi Zhou, Li Zheng.
Manuscript writing and Critical revisions of manuscript: Jiangchao Li, Liang Qiao.
Technical support and clinical samples: Dan He, Chunkui Shao, Yu Chen, Qianqian Zhang, Cui-Ling
Qi, Xiao-Dong He.
Acknowledgments
All flow cytometry work was supported by and performed in the School of Life Science, Sun Yat-sen
University and Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene
Regulation, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University. We thank Qiaobing Yuan for her
18
assistance in animal raising and histological staining. The clinical samples were collected from the
Department of Pathology, the Third Affiliated Hospital of Sun Yat-sen University.
Grant support
This work was supported by National Natural Science Foundation of China (Grant ID 81472336 and
31471290), the research and capacity building for public welfare of Guangdong Province (Grant ID
2015A030302086 and 2014A020212313), Pearl River S&T Nova Program of Guangzhou (Grant ID
201610010045), and Technology Planning Project of Guangdong Province(Grant ID
2014B020212012 ).
References:
1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA: a cancer journal for clinicians 2011;61(2):69-90 doi 10.3322/caac.20107.
2. Chen W, Zheng R, Zeng H, Zhang S. The incidence and mortality of major cancers in China, 2012. Chinese journal of cancer 2016;35(1):73 doi 10.1186/s40880-016-0137-8.
3. Su LK, Kinzler KW, Vogelstein B, Preisinger AC, Moser AR, Luongo C, et al. Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene. Science 1992;256(5057):668-70.
4. Dove WF, Clipson L, Gould KA, Luongo C, Marshall DJ, Moser AR, et al. Intestinal neoplasia in the ApcMin mouse: independence from the microbial and natural killer (beige locus) status. Cancer Res 1997;57(5):812-4.
5. Slattery ML, Wolff RK, Herrick J, Caan BJ, Samowitz W. Tumor markers and rectal cancer: support for an inflammation-related pathway. Int J Cancer 2009;125(7):1698-704 doi 10.1002/ijc.24467.
6. Laszik Z, Jansen PJ, Cummings RD, Tedder TF, McEver RP, Moore KL. P-selectin glycoprotein ligand-1 is broadly expressed in cells of myeloid, lymphoid, and dendritic lineage and in some nonhematopoietic cells. Blood 1996;88(8):3010-21.
7. Sultana DA, Zhang SL, Todd SP, Bhandoola A. Expression of functional P-selectin glycoprotein ligand 1 on hematopoietic progenitors is developmentally regulated. J Immunol 2012;188(9):4385-93 doi 10.4049/jimmunol.1101116.
8. Zarbock A, Muller H, Kuwano Y, Ley K. PSGL-1-dependent myeloid leukocyte activation. J Leukoc Biol 2009;86(5):1119-24 doi 10.1189/jlb.0209117.
9. Wang HB, Wang JT, Zhang L, Geng ZH, Xu WL, Xu T, et al. P-selectin primes leukocyte integrin activation during inflammation. Nat Immunol 2007;8(8):882-92 doi 10.1038/ni1491.
10. Tchernychev B, Furie B, Furie BC. Peritoneal macrophages express both P-selectin and PSGL-1. J Cell Biol 2003;163(5):1145-55 doi 10.1083/jcb.200310079.
11. Baggiolini M. Chemokines and leukocyte traffic. Nature 1998;392(6676):565-8 doi 10.1038/33340. 12. Tamba S, Yodoi R, Segi-Nishida E, Ichikawa A, Narumiya S, Sugimoto Y. Timely interaction between prostaglandin
and chemokine signaling is a prerequisite for successful fertilization. Proc Natl Acad Sci U S A 2008;105(38):14539-44 doi 10.1073/pnas.0805699105.
13. Raman D, Baugher PJ, Thu YM, Richmond A. Role of chemokines in tumor growth. Cancer letters 2007;256(2):137-65 doi 10.1016/j.canlet.2007.05.013.
14. Payne AS, Cornelius LA. The role of chemokines in melanoma tumor growth and metastasis. J Invest Dermatol
19
2002;118(6):915-22 doi 10.1046/j.1523-1747.2002.01725.x. 15. Wang JM, Deng X, Gong W, Su S. Chemokines and their role in tumor growth and metastasis. J Immunol Methods
1998;220(1-2):1-17. 16. Sun Y, Peng D, Lecanda J, Schmitz V, Barajas M, Qian C, et al. In vivo gene transfer of CD40 ligand into colon cancer
cells induces local production of cytokines and chemokines, tumor eradication and protective antitumor immunity. Gene therapy 2000;7(17):1467-76 doi 10.1038/sj.gt.3301264.
17. Xiao H, Yin W, Khan MA, Gulen MF, Zhou H, Sham HP, et al. Loss of single immunoglobulin interlukin-1 receptor-related molecule leads to enhanced colonic polyposis in Apc(min) mice. Gastroenterology 2010;139(2):574-85 doi 10.1053/j.gastro.2010.04.043.
18. Yang J, Hirata T, Croce K, Merrill-Skoloff G, Tchernychev B, Williams E, et al. Targeted gene disruption demonstrates that P-selectin glycoprotein ligand 1 (PSGL-1) is required for P-selectin-mediated but not E-selectin-mediated neutrophil rolling and migration. J Exp Med 1999;190(12):1769-82.
19. Noh H, Eomm M, Han A. Usefulness of pretreatment neutrophil to lymphocyte ratio in predicting disease-specific survival in breast cancer patients. Journal of breast cancer 2013;16(1):55-9 doi 10.4048/jbc.2013.16.1.55.
20. Carlow DA, Gossens K, Naus S, Veerman KM, Seo W, Ziltener HJ. PSGL-1 function in immunity and steady state homeostasis. Immunol Rev 2009;230(1):75-96 doi 10.1111/j.1600-065X.2009.00797.x.
21. Poltorak AN, Bazzoni F, Smirnova, II, Alejos E, Thompson P, Luheshi G, et al. MIP-1 gamma: molecular cloning, expression, and biological activities of a novel CC chemokine that is constitutively secreted in vivo. Journal of inflammation 1995;45(3):207-19.
22. Razmkhah M, Arabpour F, Taghipour M, Mehrafshan A, Chenari N, Ghaderi A. Expression of chemokines and chemokine receptors in brain tumor tissue derived cells. Asian Pacific journal of cancer prevention : APJCP 2014;15(17):7201-5.
23. Fusi A, Liu Z, Kummerlen V, Nonnemacher A, Jeske J, Keilholz U. Expression of chemokine receptors on circulating tumor cells in patients with solid tumors. J Transl Med 2012;10:52 doi 10.1186/1479-5876-10-52.
24. Masai K, Iwashita Y, Tominaga M, Hirano S, Shibata K, Matsumoto T, et al. mRNA expression of chemokine receptors in hepatic and pancreatic tumor cell lines. Gan to kagaku ryoho Cancer & chemotherapy 2004;31(8):1261-3.
25. Clemetson KJ, Clemetson JM, Proudfoot AE, Power CA, Baggiolini M, Wells TN. Functional expression of CCR1, CCR3, CCR4, and CXCR4 chemokine receptors on human platelets. Blood 2000;96(13):4046-54.
26. Dairaghi DJ, Oyajobi BO, Gupta A, McCluskey B, Miao S, Powers JP, et al. CCR1 blockade reduces tumor burden and osteolysis in vivo in a mouse model of myeloma bone disease. Blood 2012;120(7):1449-57 doi 10.1182/blood-2011-10-384784.
27. Bignon A, Gaudin F, Hemon P, Tharinger H, Mayol K, Walzer T, et al. CCR1 inhibition ameliorates the progression of lupus nephritis in NZB/W mice. J Immunol 2014;192(3):886-96 doi 10.4049/jimmunol.1300123.
28. Lee MM, Chui RK, Tam IY, Lau AH, Wong YH. CCR1-mediated STAT3 tyrosine phosphorylation and CXCL8 expression in THP-1 macrophage-like cells involve pertussis toxin-insensitive Galpha(14/16) signaling and IL-6 release. J Immunol 2012;189(11):5266-76 doi 10.4049/jimmunol.1103359.
29. Kitamura T, Fujishita T, Loetscher P, Revesz L, Hashida H, Kizaka-Kondoh S, et al. Inactivation of chemokine (C-C motif) receptor 1 (CCR1) suppresses colon cancer liver metastasis by blocking accumulation of immature myeloid cells in a mouse model. Proc Natl Acad Sci U S A 2010;107(29):13063-8 doi 10.1073/pnas.1002372107.
30. Rodero MP, Auvynet C, Poupel L, Combadiere B, Combadiere C. Control of both myeloid cell infiltration and angiogenesis by CCR1 promotes liver cancer metastasis development in mice. Neoplasia 2013;15(6):641-8.
31. Hoos A, Protsyuk D, Borsig L. Metastatic growth progression caused by PSGL-1-mediated recruitment of monocytes to metastatic sites. Cancer Res 2014;74(3):695-704 doi 10.1158/0008-5472.CAN-13-0946.
32. Moore KL, Patel KD, Bruehl RE, Li F, Johnson DA, Lichenstein HS, et al. P-selectin glycoprotein ligand-1 mediates rolling of human neutrophils on P-selectin. J Cell Biol 1995;128(4):661-71.
33. Rijcken EM, Laukoetter MG, Anthoni C, Meier S, Mennigen R, Spiegel HU, et al. Immunoblockade of PSGL-1 attenuates established experimental murine colitis by reduction of leukocyte rolling. Am J Physiol Gastrointest Liver Physiol 2004;287(1):G115-24 doi 10.1152/ajpgi.00207.2003.
34. Inoue T, Tsuzuki Y, Matsuzaki K, Matsunaga H, Miyazaki J, Hokari R, et al. Blockade of PSGL-1 attenuates CD14+ monocytic cell recruitment in intestinal mucosa and ameliorates ileitis in SAMP1/Yit mice. J Leukoc Biol 2005;77(3):287-95 doi jlb.0204104 [pii].
35. Sreeramkumar V, Adrover JM, Ballesteros I, Cuartero MI, Rossaint J, Bilbao I, et al. Neutrophils scan for activated platelets to initiate inflammation. Science 2014;346(6214):1234-8 doi 10.1126/science.1256478.
36. Swamydas M, Ricci K, Rego SL, Dreau D. Mesenchymal stem cell-derived CCL-9 and CCL-5 promote mammary
20
tumor cell invasion and the activation of matrix metalloproteinases. Cell Adh Migr 2013;7(3):315-24 doi 10.4161/cam.25138.
37. Long H, Xie R, Xiang T, Zhao Z, Lin S, Liang Z, et al. Autocrine CCL5 signaling promotes invasion and migration of CD133+ ovarian cancer stem-like cells via NF-kappaB-mediated MMP-9 upregulation. Stem Cells 2012;30(10):2309-19 doi 10.1002/stem.1194.
38. Acharyya S, Oskarsson T, Vanharanta S, Malladi S, Kim J, Morris PG, et al. A CXCL1 paracrine network links cancer chemoresistance and metastasis. Cell 2012;150(1):165-78 doi 10.1016/j.cell.2012.04.042.
39. Schimanski CC, Schwald S, Simiantonaki N, Jayasinghe C, Gonner U, Wilsberg V, et al. Effect of chemokine receptors CXCR4 and CCR7 on the metastatic behavior of human colorectal cancer. Clin Cancer Res 2005;11(5):1743-50 doi 10.1158/1078-0432.CCR-04-1195.
40. Okamatsu Y, Kim D, Battaglino R, Sasaki H, Spate U, Stashenko P. MIP-1 gamma promotes receptor-activator-of-NF-kappa-B-ligand-induced osteoclast formation and survival. J Immunol 2004;173(3):2084-90.
41. Coffelt SB, Kersten K, Doornebal CW, Weiden J, Vrijland K, Hau CS, et al. IL-17-producing gammadelta T cells and neutrophils conspire to promote breast cancer metastasis. Nature 2015 doi 10.1038/nature14282.
42. Wynn TA, Chawla A, Pollard JW. Macrophage biology in development, homeostasis and disease. Nature 2013;496(7446):445-55 doi 10.1038/nature12034.
43. Qian BZ, Pollard JW. Macrophage diversity enhances tumor progression and metastasis. Cell 2010;141(1):39-51 doi 10.1016/j.cell.2010.03.014.
44. Pollard JW. Tumour-educated macrophages promote tumour progression and metastasis. Nature reviews Cancer 2004;4(1):71-8 doi 10.1038/nrc1256.
21
Table 1 Table 1. Clinicopathological data and correlation with PSGL-1 expression in 38 patients with primary colorectal cancers. Clinical Feature Number Number of PSGL-1 cell P value High Low Gender 0.7205 Male 28 8 (28.57%) 20 (71.42%) Female 10 4 (40%) 6 (60%) Age 0.4417 >60 33 10 (56%) 24(47%) ≤60 5 2 (49%) 3 (51%) Lymph node Metastasisa,b 0.0008 N0 18 9 (50%) 9 (50%) N1 7 0 (0%) 5 (71.42%)
N2 7 1 (14.28%) 6 (85.71%) TNM stagea,b 0.00065
I-II 21 16 (76.19%) 5 (23.8%) III-IV 17 1 (5.8%) 16(94.12%)
a Partial data is not available, and the all statistic was based on the informative data. b Lymph node Metastasis was defined by results on final pathological analysis. Note:The low of number of PSGL-1 cell indicate less 20 cells in each 400×field under microscope.
22
Figure legends
Figure 1. Accelerated growth of intestinal tumors in PSGL-1-/- mice.
A. The representative photos of the intestinal tumors stained by methylene blue (ileum segment). More
intestinal tumor nodules are visible in ApcMin/+;PSGL-1-/- mice than in ApcMin/+ mice. B. The
microadenomas and adenomas were of larger size in ApcMin/+;PSGL-1-/- mice than in ApcMin/+ mice. **
P<0.01; *** P<0.001. C. The number of tumor nodules (microadenoma and adenoma) in each
experimental mouse was counted at different time points. Increased tumor incidence was clearly seen in
ApcMin/+;PSGL-1-/- mice than in ApcMin/+ mice, *P<0.05; ** P<0.01; *** P<0.00. D. ApcMin/+;PSGL-1-/-
mice (n=32) with the intestinal tumors showed poorer survival than the tumor-bearing ApcMin/+ mice
(n=42). Survival was analyzed by Kaplan-meier analysis (SPSS software, 17.0).
Figure 2. Pathological features of intestinal tumors in ApcMin/+ and ApcMin/+;PSGL-1-/- mice
A. An overview of the intestinal tumors of ApcMin/+ and ApcMin/+;PSGL-1-/- mice. Intestines were
stained with H&E. B. The representative 3-stage development of intestinal tumors in ApcMin/+ mice:
hyperplasia, adenoma and adenocarcinoma. Tissue sections were stained with H&E. C. A quantitative
analysis of the percentage of the intestinal adenomas and adenocarcinomas in ApcMin/+;PSGL-1-/- mice,
as compared to ApcMin/+ mice. D. IHC staining of ki67 in the intestinal tumor tissues of ApcMin/+ and
ApcMin/+;PSGL-1-/- mice. E. Quantitative analysis of the ki67 positivity in the intestinal tumors of
ApcMin/+ and ApcMin/+;PSGL-1-/- mice. F. IHC staining of the micro-vessel density as indicated by
CD34 in the intestinal tumors of the ApcMin/+ and ApcMin/+;PSGL-1-/- mice. G. Quantitative analysis of
CD34 positivity in the intestinal tumors of ApcMin/+ and ApcMin/+;PSGL-1-/- mice. * P<0.01.
Magnification: 40× for Fig.A, 200× for Fig.B, 400× Fig.D and F.
Figure 3. Down-regulation of PSGL-1 leads to an increased production of MIP-1γ.
A.With cytokine array analysis, significantly increased serum level of MIP-1γ(CCL9) was found in
23
tumor-bearing PSGL-1-/- mice compared to tumor-bearing C57BL/6 mice. B. By qPCR assay, increased
mRNA expression of MIP-1γ in the blood cells was found in the ApcMin/+;PSGL-1-/- and PSGL-1-/- mice,
as compared to the ApcMin/+ (no tumors by 4 weeks) and C57 mice, respectively. ** P<0.01;
***P<0.001: C. The protein expression level of MIP-1γ in the mouse blood cells was detected by
ELISA. Significantly increased MIP-1γ level was found in the ApcMin/+;PSGL-1-/- and PSGL-1-/- mice,
as compared to the ApcMin/+ and C57 mice, respectively. * P<0.05. D. The percentage of `F4/80+
macrophages in the entire CD45+ cell populations isolated from the mouse peripheral blood and spleen
was determined by flow cytometry (a). Increased percentage of F4/80+ macrophages was found in the
ApcMin/+;PSGL-1-/- and PSGL-1-/- mice, as compared to the ApcMin/+ and C57 mice, respectively. (b:
blood; c: spleen. * P<0.05; ** P<0.01). E. Expression of MIP-1γ mRNA by qPCR in the macrophages
collected from the peripheral blood of ApcMin/+ and ApcMin/+;PSGL-1-/- mice. **P<0.01. F. Expression
of MIP-1γ protein by ELISA in the macrophages collected from the peripheral blood of ApcMin/+ and
ApcMin/+;PSGL-1-/- mice. ** P<0.01. G, H. Knockdown of PSGL-1 in Raw264.7 cells (G) led to an
increased production of MIP-1γ (H). * P<0.05.
Figure 4. MIP-1γ promotes tumor cell growth in vitro.
A. Expression of MIP-1γ mRNA was clearly detected by RT-PCR in macrophages isolated from the
peripheral blood of mice and RAW264.7 cells (a mouse macrophage cell line), but not in the intestinal
tumor cell lines HCT116, SW620, SW480 and CT26. B. Expression of the MIP-1γ receptor CCR1 was
detected in the intestinal tumor tissues from the ApcMin/+ mice by IHC analysis, and CT26 cell line was
detected with antibody CCR1 by Western blotting. #1and #2 indicated the repeat assays.. C. CT26 cells
were treated with various concentrations of MIP-1γ for 24, 48, and 72 h, and the effect on cell
proliferation was examined by MTT assay. MIP-1γ induced a time- but not dose-dependent increase in
the proliferation of CT26 cells. D. As demonstrated by flow cytometry, MIP-1γ promotes cell cycle
progression to G2/M phase. E. MIP-1γ also promotes migration of CT26 cells, as demonstrated by the
24
wound healing assay.
Figure 5. MIP-1γ activate NF-κB pathway in tumor cells.
A. A commercial PCR kit specific for NF-κB pathway related gene of mRNA expression was used to
examine the effect of MIP-1γ on NF-κB signaling. B. The level of TNF-α tumor tissues of ApcMin/+ and
ApcMin/+;PSGL-1-/- mice were determined using an ELISA kit. Data are expressed as mean±SD. *
P<0.05. C. The expression levels of TNF-α and pP65 in the tumor tissues were also determined by
immunohistochemistry. A significantly increased expression of TNF-α was found in the
ApcMin/+;PSGL-1-/- mice as compared to ApcMin/+ mice (b and a, respectively). Similarly, there was a
significant increase in the expression of pp65 in the nuclei of the tumor cells derived from the
ApcMin/+;PSGL-1-/- mice as compared to ApcMin/+ mice (d and c, respectively). Magnification: 400. D.
Expression level of TNF-in the intestinal tumor tissues of ApcMin/+;PSGL-1-/- and ApcMin/+ mice was
determined by Western blot. E. CT26 cells with MIP-1γ treatment (20 ng/mL) led to a significant
up-regulation of pP65 in cell unclear and cytoplasmic protein, as determined by Western blotting assay.
F. Immunofluorescent staining of pp65 in CT26 cells treated with or without MIP-1γ. Magnification:
400×.
Figure 6. PSGL-1 positive cells in tumor were associated with clinical chanractital.
A.Immunohistochemistry analysis representative image shows that cell membranous immunoreactivity
for PSGL-1 were present in different clinic stage –Adenoma(Fig. A, PSGL-1 positive cells present in
peritumoral of adenoma), I (Fig. B), II (Fig. C), III(Fig. D), and IV(Fig. E) stage ((brown, DAB,
PSGL-1; blue,haematoxylin stain, Nucleus). B. Statistical diagram show that the PSGL-1 positive cells
appear in different clinic stage of 0/I, II, IV and were negative correlation with clinic stage(Fig. F,
*P<0.05,**P<0.01, and ***P<0.001)in CRC patients. C.The number of PSGL-1 positive cells is
associated with lymphatic metastasis (Fig. G, ***P<0.001, ns= no significance). D.A schematic
25
diagram showing the possible mechanisms of the tumor-promoting role of MIP-1γ in intestinal tumors
in mice(Fig. H).