C-type lectin interactions with SEA › files › 42199030 › proefschrift... · VRIJE...

C-type lectin interactions with Schistosoma mansoni SEA

Molecular basis and function

Ellis van Liempt

The studies in this thesis were performed at the department of Molecular Cell Biology and Immunology, VU University Medical Center, van der Boechorststraat 7, 1081 BT Amsterdam, The Netherlands. ISBN: 978 90 8659 0742 © P.A.G van Liempt, Gouda, the Netherlands, 2007 Printed by PrintPartners Ipskamp B.V., Enschede, The Netherlands, 2007

VRIJE UNIVERSITEIT

C-type lectin interactions with Schistosoma mansoni SEA

Molecular basis and function

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad Doctor aan de Vrije Universiteit Amsterdam, op gezag van de rector magnificus

prof.dr. L.M. Bouter, in het openbaar te verdedigen

ten overstaan van de promotiecommissie van de faculteit der Geneeskunde

op donderdag 15 maart 2007 om 13.45 uur in de aula van de universiteit,

De Boelelaan 1105

door

Petronella Adriana Gerarda van Liempt

geboren te ’s-Hertogenbosch

promotor: prof.dr. Y. van Kooyk copromotor: dr. I.M. van Die

Wetenschap is ronddolen langs de stranden van de grote oceanen der kennis en hier en daar spelen met een paar schelpen en kiezelsteentjes.

Sir. Isaac Newton (1642-1727)

Voor mijn ouders Voor Mark

Manuscriptcommissie: Dr. Appelmelk

Prof. dr. C.D. Dijkstra Prof. dr. M. Kapsenberg

Dr. T. van der Poll Prof. dr. A. Tielens

Prof. dr. M. Yazdanbakshs

Table of Contents List of abbreviations 10 Chapter 1 General Introduction 13 Chapter 2 Specificity of DC-SIGN for mannose and fucose-containing 45

glycans. Chapter 3 Carbohydrate profiling reveals a distinctive role for the 65

C-type lectin MGL in the recognition of helminth parasites and tumor antigens by dendritic cells.

Chapter 4 Molecular basis of the differences in binding properties of 87

the highly related C-type lectins DC-SIGN and L-SIGN to Lewis x trisaccharide and Schistosoma mansoni egg antigens.

Chapter 5 DC-SIGN mediates adhesion and rolling of dendritic cells on 107

primary human umbilical vein endothelial cells through Lewis y antigen expressed on ICAM-2.

Chapter 6 DC-SIGN mediates binding of dendritic cells to authentic pseudo 129

Lewisy glycolipids of Schistosoma mansoni cercariae, the first parasite-specific ligand of DC-SIGN.

Chapter 7 Schistosoma mansoni soluble egg antigens are internalized by 153

human dendritic cells through multiple C-type lectins and suppress TLR-induced dendritic cell activation.

Chapter 8 General Discussion 177

Summary 189 Nederlandse samenvatting 193 Dankwoord 197 Curriculum vitae List of publications 201

199

List of abbreviations Ag Antigen APCs Antigen presenting cells BSA Bovine serum albumin C3FT Core α1-3fucosyltransferase cDNA complementary DNA CAA Circulating anodic antigen CCA Circulating cathodic antigen CHO Chinese Hamster Ovarian cells CLRs C-type lectin receptors Con A Concanacalin A CRDs Carbohydrate Recognition domains DCs Dendritic cells DC-SIGN Dendritic Cell-Specific ICAM-3 Grabbing Non-integrin (CD209) ELISA Enzyme-linke immunosorbent assay Endo H Endoglycosidase H ER Endoplasmic reticulum ES products Excretory/secretory products FACS Fluorescence activated cell sorter FUT Fucosyltransferase GAPDH Glyceraldehyde 3-phosphodehydrogenase GlcCer Glucosylceramide GM-CSF Granulocyte-macrophage colony stimulating factor GSL Glycosphingolipids HUVEC Human umbilical vein endothelial cells HIV-1 Human immunodeficiency virus -1 ICAM Intercellular adhesion molecule IFN Interferon IL Interleukine ITAM Immunoreceptor tyrosine-based activation motifs Kd Dissociation constant LDN LacdiNAc (GalNAcβ1-4GlcNAc) LDN-F LacdiNAcfucose (GalNAcβ1-4(Fucα1-3)GlcNAc) LDN-DF LacdiNAcdifucose (GalNAcβ1-4(Fucα1-2Fucα1-3)GlcNAc) Lea Lewis a (Galβ1-4(Fucα1-4)GlcNAc) Leb Lewis b (Fucα1-2Galβ1-4(Fucα1-4)GlcNAc) Lex Lewis x (Galβ1-4(Fucα1-3)GlcNAc) Ley Lewis y (Fucα1-2Galβ1-4(Fucα1-4)GlcNAc) LFA-1 Lymphocyte-function antigen-1 LN N-acetyllactosamine (LacNAc) LNFPIII Lacto-N-fucopentaose III LPS Lipopolysaccharide L-SIGN Liver/lymph node Specific ICAM-3 Grabbbing Non-integrin (CD209L) LSEC Liver sinusoidal endothelial cells mAb monoclonal antibody MBP Mannose binding protein MGL Macrophage Galactose-type lectin (CD301) MHC Major histocompatibility complex MØ Macrophages

10

11

MR Mannose receptor (CD206) mRNA messenger RNA PAA Polyacrylamide PAMP Pathogen-associated molecular patterns PBL Peripheral blood leukocytes PBS Phosphate-buffered saline PBMCs Peripheral blood mononuclear cells PC Phosphatidylcholine PE Phosphatidylethanolamine Poly I:C Polyinosine deoxycytidylic acid PRR Pathogen-recognition receptors PS Phosphatidyl-serine RT-PCR Real-time polymerase chain reaction SEA Soluble egg antigens S. mansoni Schistosoma mansoni SPR Surface plasmon resonance TCR T cell receptor TH T-helper cell TLRs Toll-like receptors TNF Tumor necrosis factor

General Introduction

Chapter 1


15

Schistosoma mansoni

Schistosomiasis is the major parasitic worm infection in the world, with some 200

million people infected and another 600 million at risk of becoming infected (1;2).

Today, schistosomiasis causes greater morbidity and mortality than all other worm

infestations. The pathology of schistosomiasis is characterized by the formation of

granulomas, causing intense inflammatory and immunologic responses, damaging

the liver, intestine or bladder. Three species of schistosomes are responsible for the

disease namely: Schistosoma mansoni, Schistosoma haematobium and Schistosoma

japonicum. Schistosomiasis is as old as civilization as schistosome eggs have been

identified in mummies of the 20th dynasty (1200-1090 BC). Schistosoma mansoni is

found in tropical Africa, parts of southwest Asia, South America and the Caribbean

Islands.

Life cycle

Schistosomes have complicated life cycles alternating between asexual generations in

the invertebrate host (snail) and sexual generations in the vertebrate host. A

schistosome egg hatches in fresh water, liberating a motile form, the miracidium

(Figure 1). To survive, this miracidium must find a fresh water snail within 8-12 hrs

and infect it. In the snail asexual reproduction of so-called sporocysts occur. In the

snail, the sporocyst develops into the final larval stage, the cercariae. The cercariae

escapes from the snail into the water and penetrates the skin of the human host,

during which process it loses its forked tail and becomes an schistosomule, which is

accompanied by profound changes in their metabolism and antigenic structure

(Figure 1). The schistosomule migrates through tissues, penetrates blood vessels and

is carried to the lung and subsequently to the liver. In the intestinal venules of the

portal drainage schistosomules mature, forming pairs of male and female worms (4-5

weeks after infection). The female worms of Schistosoma mansoni deposit immature

eggs in the intestinal venules (Figure 1). Embryos develop during the passage of eggs

through the tissues and the larvae are mature when eggs pass through the wall of the

intestine or the urinary bladder and are discharged in the feces or urine. The eggs

hatch in fresh water, liberating miracidia and completing the life cycle (Figure 1).

During all life cycle stages the host is sequentially exposed to different sets of specific

antigens, adult worm antigens and egg antigens, that are secreted/excreted.

Chapter 1 _

16

Figure 1. The life-cycle of Schistosoma mansoni.

Pathogenesis

The female worm deposits hundreds to thousands of eggs daily for 5 to 30 years (3).

Fortunately most infected persons harbor fewer than 10 adult females. About two-

thirds of the eggs fail to adhere to the endothelium and become lodged in the hepatic

capillary bed. The exact mechanism by which eggs pass across the endothelium,

intervening tissues and mucosal epithelium remains unknown, but clearly is

dependent upon the host immune response, as egg excretion does not occur in

animals that are immuno-compromised (4). Entrapped eggs die within 20 days and

secrete numerous proteins, glycoproteins, glycolipids and polysaccharides that are


17

highly antigenic and can accelerate the inflammatory response (acute

schistosomiasis), which may lead to severe pathology and ultimately death of the host

(5;6). The immunologic and inflammatory reactions to the schistosomal eggs in

tissues cause the manifestations of schistosomiasis. The basic lesion is a

circumscribed granuloma or a cellular infiltrate of eosinophils and neutrophils

around the egg. Granulomas that form around the eggs also obstruct the micro-

vascular blood supply and produce ischemic damage to adjacent tissue. The result is

progressive scarring and dysfunction in the affected organs (7). When the worm

burden is large, granulomatous response to the enormous number of eggs, poses

significant problems to the distal colon and liver. Egg production also induces a

switch in the immune response towards a TH2 response which is driven by a complex

mixture of glycosylated components, called soluble egg antigens (SEA) (8;9). The

pathology of schistosomiasis is largely chronic in nature, with less than 5% of infected

individuals suffering severe disease (10). Chronic schistosomiasis may occur even

without any recognizable symptoms and can last for decades. Morbidity arises slowly

and is accompanied by pathological changes in affected organs. Mortality mainly

occurs via liver fibrosis and portal hypertension. The disease weakens infected

individuals and therefore has serious consequences on the socio-economic

development of tropical and subtropical areas (11).

Glycoconjugates in schistosomes

Schistosomes can survive many years in the hostile environment of their definitive

host. Thus, the parasite must have developed remarkable mechanisms to escape the

immune response of its host. It is thought that the glycoconjugates that are

abundantly expressed throughout all life stages of the parasite, play an important role

in these escape mechanisms. Glycoconjugates in schistosomes display a broad array

of oligosaccharides linked to proteins or lipids, creating glycoproteins and glycolipids.

In the next paragraph the synthesis of glycoconjugates will be described shortly and

examples in schistosomes will be discussed.

Glycoproteins

Glycoproteins are proteins that have attached to their polypeptide backbone one or

more oligosaccharide chains covalently linked via N- or O-glycosidic linkage. Newly

synthesized proteins are made in the endoplasmic reticulum (ER) and are co- or post-

Chapter 1 _

18

translationally modified with carbohydrate chains. The carbohydrate chain is

synthesized by a series of stepwise-organized glycosyltransferases within the ER and

Golgi apparatus. In addition, glycosidases can remove specific carbohydrates and

thus modify the carbohydrate portion of the glycoconjugate. Other modifications of

monosaccharides like for instance sulphation, methylation or phosphorylation,

increase the diversity of glycans.

N-glycans

An oligosaccharide that is transferred to the side chain amino (NH2) group of an

asparagin (Asn) in the protein is called N-linked. N-glycan synthesis starts with the

formation of a common precursor structure Glc3Man9GlcNAc2 linked to the

membrane bound lipid dolichol (Figure 2). The whole precursor structure is then

transferred to the Asn residue of a newly synthesized peptide at the ribosome. This

precursor oligosaccharide is extensively trimmed into an oligo-mannosidic type

structure and this structure is then further processed. N-glycans contain a common

core structure consisting of two N-acetylglucosamine (GlcNAc) residues and three

mannose residues. According to their main structural features N-glycans can be

divided into three major types: high mannose-type, hybrid-type and complex type

(Figure 2) (12).

Figure 2. The three major types of N-linked glycans. a. Oligomannose-type; b. Complex type; c. Hybrid-type. Explanation of glycan symbols: GlcNAc; Galactose ; Glucose; Mannose.


19

Schistosoma adult worm- and egg-derived glycoproteins contain typical N-linked

oligomannose structures (Man5-9GlcNAc2-Asn) that occur in many eukaryotic and

higher organisms including humans (13). However schistosomes can also synthesize

complex-type N-glycans with di-, tri- and tetra-antennary structures, which

sometimes have unusual core modifications. N-glycan structures of cercariae can be

modified by β2-linked xylose (Figure 3 d) (14). Egg glycoproteins express truncated

N-glycan core structures carrying α3-linked fucose in addition to β2-linked xylose,

similar to typical allergenic plant N-glycans (Figure 3 e) (15). The N-linked bi-

antennary structures frequently contain instead of LacNac, terminal LacdiNAc (LDN,

GalNAcβ1-4GlcNAcβ) with or without a fucose in an α1-3 linkage to the GlcNAc

(LDNF) (16;17). These structures have now also been found in glycoproteins of both

invertebrate and vertebrate origins (18). Recently Wuhrer et al., reported that N-

glycans of the worm stage of Schistosoma mansoni express besides poly Lewis x also

poly LDN and poly LDNF structures (Figure 3 f). Poly LDN and poly LDNF had thus

far not been reported to occur in natural systems (19).The highly branched tri- and

tetra-antennary N-glycans of Schistosoma mansoni can carry Lewis x (Lex, Galβ1-

4(Fucα1-3)GlcNAc) and extended Lex antigens (17). Further highly antigenic

structural elements are Fucα1-3GalNAcβ1-4GlcNAc (F-LDN) and Fucα1-3GalNAcβ1-

4[Fucα1-3]GlcNAc (F-LDN-F), which are both protein- and lipid-linked in cercariae

and egg stages of the parasite (20). Terminal structures found on schistosome

glycoconjugates are summarized in Table 1.

Table 1. Common terminal glycan antigens found on Schistosome glycoconjugates. Explanation of Glycan symbols: GalNAc; GlcNAc; Fucose; Galactose.

Chapter 1 _

20

Figure 3. Typical examples of N-glycans in Schistosoma mansoni. a. Trimannose structure; b. High mannose structure; c. N-glycan containing dicore-fucose bi-Lewis x; d. Truncated N-glycan found in cercariae with a β2-linked xylose; e. Truncated N-glycan found in eggs carrying α3-linked fucose in addition to β2-linked xylose; f. N-glycan containing poly LDN(F). Explanation of Glycan symbols: GalNAc; GlcNAc; Fucose; Mannose; Xylose; Galactose.

O-glycans

O-glycan synthesis is initiated by the transfer of a N-Acetylgalactosamine (GalNAc) to

the hydroxyl (OH) group on the side chain of Serine (Ser) or Threonine (Thr) of the

synthesized peptide. GalNAc can be further modified with GalNAc, GlcNAc or

galactose, giving rise to different core structures. They can be elongated and

terminally modified by galactose, GalNAc, GlcNAc, Fucose or N-acetylneuraminic

acid (NeuAc), leading to a great variety of O-glycans. In normal mammalian cells,

four common core structures of O-glycan can be synthesized. Core 1 is the precursor

structure for the synthesis of core 2 and core 3 is the precursor for core 4 (Figure 4).

All four common core structures may be elongated, sialylated, fucosylated and

sulfated to form functional carbohydrate structures.

Figure 4. Biosynthesis of O-glycan core structures. The initial step of O-glycosylation is the addition of GalNAc to serine or threonine of a glycoprotein. Addition of β1,3-linked galactose and β1,3-linked N-acetylglucosamine results in the formation of core 1 and core 3, respectively. Core 2 and core 4 are formed by addition of N-acetylglucosamine, which is catalyzed by a unique enzyme for each reaction.

Explanation of the glycan symbols: GalNAc; GlcNAc; Galactose.


21

Schistosomes synthesize O-glycans ranging from single O-linked GlcNAc residues or

short mucin-type disaccharides on glycoproteins from S. mansoni schistosomula and

adult worms (13;21), to very large and complex multi-fucosylated O-glycans from the

cercarial glycocalyx (Figure 5c) (22). Cercarial O-glycans have been described to carry

both LN and LDN-based structures that are frequently (multi-) fucosylated (23). In

addition, it has been shown that two major antigens, which are regularly being

released from the gut of adult worms in relatively high amounts, namely circulating

cathodic and anodic antigen (CCA and CAA respectively), contain large unusual O-

glycans. The major fraction of the O-linked glycans of CCA consists of a poly-Lex

backbone of approximately 25 repeating units, having a GalNAc as the reducing

terminal moiety (Figure 5e). CAA is negatively charged, its O-glycan are constructed

of repeats of β1-6-linked GalNAc residues substituted with β1-3 –linked glucuronic

acid (GlcA). Furthermore a small portion of poly-Lex carbohydrate chains were found

to be present on CAA (Figure 5d)(24).

Figure 5. Examples of O-glycans found in Schistosoma mansoni. a) O-glycan containing Lewis x with a ‘novel’ core structure (23); b) O-glycan containing extended Lewis x antigens; c) O-glycan of the cercarial glycocalyx; d) Circulating Anodic Antigen (CAA); e) Circulating Cathodic Antigen (CCA). Explanation of glycan symbols: GlcNAc; GalNAc; Fucose; Galactose; Glucuronic acid.

Glycolipids

Glycolipids are a subgroup of lipids containing sugar moieties and are ubiquitous

components of the plasma membrane of all vertebrate cells. The most common

glycolipids in mammals are a class of sphingolipids, glycosphingolipids (GSLs).

GSLs are considered to be receptors for microorganisms and their toxins, modulators

of cell growth and differentiation, and organizers of cellular attachment to matrices

(25;26) . More than 400 species of GSLs possessing different sugar structures have

been reported in vertebrates. In the pathway of GSL synthesis, the first step is

transfer of glucose or galactose to a ceramide to produce glucosylceramide (GlcCer)

or galactosylceramide (GalCer), respectively. This transfer reaction is catalyzed by

Chapter 1 _

22

UDP glucose:ceramide:glucosyltransferase (GlcT) and UDP-galactose:ceramide:

galactosyltransferase (GalT), respectively. The sugar chains can be extended by the

sequential transfer of monosaccharides to a GlcCer or GalCer by one of a serie of

specific glycosyltransferases, all of which are localized on the lumen side of the Golgi

membrane (27;28). Thus GlcCer produced on the cytosolic side of the Golgi

membrane must be transferred (flip-flopped) to the lumen side by a putative enzyme,

'flippase,' which has not yet been characterized (28). In plasma membrane, GSLs

form clusters, called lipid rafts, with cholesterol and relatively less phospholipids

than other areas of plasma membrane (29). There are receptors for intercellular

signal transducers such as GPI-anchored proteins on the exoplasmic face of the rafts

and Src family kinases on the cytosolic face, indicating that GSLs play a role in

transmembrane signal transduction (29).

Schistosome glycolipids

Schistosomes synthesize glycolipids with a glucocerebroside precursor similar to

vertebrates. The glucocerebroside is not galactosylated as in vertebrates (Galβ1-4Glc-

ceramide) (Figure 6a), but is instead modified by addition of a β1,4-GalNAc residue

to generate the ‘schisto core’ structure GalNAcβ1-4Glcβ1-ceramide (Figure 6b) (30).

Extensions of the schisto-core can be complex, with either common structural

elements found in N- and O-glycans, or with specific modifications found so far only

on glycolipids. The most predominant phospholipids in adults of Schistosoma

mansoni are phosphatidylcholine (PC) and phosphatidylethanolamine (PE), but also

in other stages of the life cycle glycolipids are present. Detailed analyses of the major

egg glycolipids of S. mansoni have demonstrated that these contain extensions with

the repeating unit -4(Fucα1-2Fucα1-3)GlcNAcβ1- terminating with (Fucα1-

2)0/1Fucα1-3GalNAc at the non-reducing end (15). Glycolipids have extended

difucosylated oligosaccharides. S. mansoni cercarial glycolipids are dominated by

terminal Lewis x and Fucα1-3Galβ1-4(Fucα1-3)GlcNAc (pseudo Lewis y) structures

(Figure 6). These glycolipids are not expressed in the adult and egg stages (31).

Recently the Fucα1-3GalNAc terminal element was demonstrated in S. mansoni egg

glycolipids, although compared to cercarial glycolipids the Lewis x glycolipids are

drastically downregulated in the egg (32). F-LDN and F-LDN-F terminal elements

have been demonstrated on worm, cercariae and egg glycolipids (20;32). The neutral

glycolipids fraction of S. mansoni adult worms may be useful serodiagnostic antigens


23

for detection of acute schistosomiasis (33). Lipid extracts of eggs, worms, and

cercariae of S. mansoni have been shown to contain a large number of highly

immunogenic glycolipids, many of which remain to be structurally characterized (34).

Stage specific expression patterns have not only been observed for certain glycan

elements, but also for the ceramide part of schistosome mono- and dihexosides (35).

It should be noted that sialic acids, common terminal sugars of mammalian glycans,

have never been chemically demonstrated as part of schistosome glycoconjugates.

The only charged monosaccharide demonstrated so far in any schistosome N-, O- or

lipid-linked glycan is the GlcA residue in the O-glycans of CAA.

Figure 6. Glycolipids expressed by Schistosoma mansoni. a) glucocerebroside precursor of vertebrates; b) The schisto core; c) egg glycolipid; d) egg glycosphingolipid; e) glycolipid with a Lewis x pentasaccharide structure found in cercariae; f) glycolipid with the pseudo Lewis y structure found in cercariae; g) glycolipid with a Lewis x hexasaccharide found in cercariae. Explanation of glycan symbols: GalNAc; GlcNAc; Fucose; Galactose; Glucose.

The immune response

One of the most fascinating problems in immunology is, understanding how the host

organism detects the presence of infectious agents such as Schistosoma mansoni and

disposes of the invader without destroying self-tissues. Schistosomes have evolved

mechanisms to escape the immune response of the host. It is thought that the

glycoconjugates that are abundantly expressed throughout all life stages of the

parasite, play an important role in these escape mechanisms. The first immune cells

to come in contact with invading pathogens are dendritic cells, the sentinels of the

immune system. Dendritic cells recognize pathogens and through cell-cell

interactions with T cells an immune response is elicited. DCs express receptors that

recognize glycans expressed by pathogens. In the next paragraphs dendritic cells,

pattern recognition receptors and their role in immune responses will be discussed.

Chapter 1 _

24

Dendritic cells, sentinels of the immune system

The primary function of the immune system is to protect the host from infectious

microbes in its environment. Dendritic cells (DCs) are professional antigen-

presenting cells (APCs) which are strategically positioned at the boundaries between

the inner and the outside world (36). The development of DCs is considered to occur

in distinct stages. Haematopoietic pluripotential stem cells, under as yet unknown

influences, constantly generate DC progenitors in the bone marrow, which give rise to

circulating precursors in the blood (37). These DC precursors are scattered

throughout the body in virtually all non-lymphoid tissues via the blood circulation

and function as a continuous surveillance patrol for incoming foreign antigens. DC

precursors migrate to the peripheral tissues and are then called immature DCs. In the

peripheral tissues the immature DCs capture antigens. To become licensed to activate

naïve T helper cells, DCs must undergo a maturation process during the migration

from the peripheral tissues to the lymph nodes. In the lymph node the captured

antigen is presented to naïve T cells. Maturation of DCs is characterized by a

decreased Ag-uptake capacity and an increased cell surface expression of major

histocompatibility complex (MHC) and co-stimulatory molecules (38-40). In

addition, rearrangement of cytoskeleton, adhesion molecules and cytokine receptors

upon maturation, allow DCs to migrate from peripheral tissues to secondary

lymphoid organs (41-43).

DCs play a pivotal role in the immune response by providing signals that direct naïve

T helper (TH) cells to proliferate and differentiate into TH1, TH2 or T regulatory cells.

Three signals are delivered by an APC that are thought to determine the fate of naïve

T cells (Figure 7) (44). Signal 1 is delivered through the T cell receptor (TCR) when it

engages an appropriate peptide-MHC complex. Signal 1 alone is thought to promote

naïve T cell inactivation by anergy, deletion or direction into a regulatory cell fate,

thereby leading to ‘tolerance’. Accessory signals also referred to as co-stimulation

(signal 2), together with signal 1 induce ‘immunity’. This is often measured as T cell

clonal expansion, differentiation into effector cells and a long-term memory (45).

Signal 2 is often equated with signalling through CD28 when it engages CD80 and/or

CD86 (46) (Figure 7). However, the actual ‘signal 2’ that favours immunity, is likely

to be a fine balance of positive and negative co-stimulatory signals emanating from

many receptors (44). Recently is has been shown that the signals delivered by the


25

APC to the T cell determine its polarization into an specific type of effector cell, are

referred to as signal 3 (Figure 7). T helper 1 cells activate cytotoxic T cells and

stimulate the microbicidal properties of macrophages (cell-mediated immune

response). T helper 2 cells initiate the humoral immune response by activating naïve

antigen-specific B cells to produce antibodies. The polarizing signals are mediated by

various soluble and membrane-bound factors, such as interleukine-12 (IL-12) or CC-

chemokine ligand 2 (CCL2) (47).

Figure 7. T cell polarization requires three dendritic cell-derived signals. Signal 1 is an antigen-specific signal that is mediated through T cell receptor (TCR) and MHC class II-associated peptides. Signal 2 is the co-stimulatory signal, mediated by triggering of CD28 by CD80 and CD86. Signal 3 is the polarizing signal mediated by soluble or membrane bound factors like IL-12 (TH1) or CCL2 (TH2). Pattern recognition receptors on DCs

DCs are professional APCs bridging the innate and adaptive immunity. Invading

pathogens are recognized by pattern recognition receptors (PRRs) expressed on the

cell surface of DCs. Two main classes of PRRs expressed by DCs are Toll-like

receptors and C-type lectins. Depending on their tissue localization and

differentiation state, DCs could be specialized to respond to specific microbes by

expressing distinct sets of Toll-like receptors and C-type lectin receptors.

Toll-like receptors

Human Toll-like receptors (TLRs) are type 1 transmembrane glycoproteins

characterized by an extracellular domain that contains leucine-rich repeat units and

Chapter 1 _

26

cytoplasmic domain of IL-1 receptor, designated as the Toll/IL-1 Receptor (TIR)

domain. The TIR domain is a conserved protein-protein interacting module, found in

diverse organisms including humans, plants, insects and nematodes (48). At least ten

human TLRs have been identified (Figure 8) (49), which are expressed as

homodimers or heterodimers (TLR-2 with TLR-1 and TLR-6 with TLR2,

respectively). TLRs are broadly expressed on cells of the immune system (50;51) and

are arguably the best-studied immune sensors of invading pathogens.

Figure 8. Cellular localization of Toll-like receptors (TLRs). TLR1, TLR2, TLR4, TLR5 and TLR 6 reside mainly in the plasma membrane, whereas those TLRs recognizing nucleic acid derivatives are localized to intracellular compartments such as endosomes (TLR3, TLR7, TLR8 and TLR9). The primary function of the TLRs is to signal that microbes have reached the body’s

barrier defenses. They appear to do this largely by recognizing common structural

features of microbes known as pathogen-associated molecular patterns (PAMPs),

which include modified lipids, proteins and nucleic acids (Figure 8) (52). TLRs are

particularly found on DC and macrophages, but are also expressed on neutrophils,

eosinophils, endothelium, epithelial cells and keratinocytes. Most TLRs are expressed

on the cell surface, others are found almost exclusively in intracellular compartments

such as endosomes (Figure 8). Their ligands, mainly nucleic acids, require

internalization to the endosome before signaling is possible (53). Activation of most

TLRs induces cellular responses associated with acute and chronic inflammation.

When TLR ligands interact with their specific TLRs, intracellular adaptor proteins

transduce signals that lead to enhanced expression of genes encoding cytokines and

other inflammatory mediators.


27

All members of the TLR super family signal in a similar manner owing to the

presence of the TIR domain, which activates common signaling pathways, most

notably those leading to activation of the transcription factor nuclear factor κB (NF-

κB) and stress-activated protein kinases. These pathways are defined as the MyD-88

dependent and independent pathway (54;55). TLRs relay information about the

interacting pathogens to DCs through intracellular signaling cascades. TLR triggering

has versatile effects on DCs such as promoting survival, chemokine secretion,

expression of chemokine receptors, migration, cytoskeletal and shape changes or

endocytic remodeling (56). Recently Napolitani and co-workers, showed that TLRs

can act in synergy to trigger an immune response by activating DCs. TLR ligands

form a combinatorial code by which DCs discriminate pathogens and this implicates

a new strategy for priming an immune response (57).

Recent reports indicate that Schistosoma mansoni-derived glycan products can

interact with TLRs. The Schistosoma mansoni-related glycan lacto-N-fucopentaose

III (LNFP III) contains the trisaccharide Lewis x, which is expressed by several life-

cycle stages of schistosomes. Thomas et al., showed that LNFP III can directly

activate murine bone marrow-derived DCs through a TLR4 dependent mechanism.

DCs mature into a DC2 phenotype, capable of driving naïve T cells to differentiate

into TH2 cells (58). Aksoy and coworkers investigated whether Schistosoma mansoni

living eggs activate murine bone marrow-derived DCs through TLR2 and TLR3

engagement (59). Egg-derived RNA possessed RN-ase A-resistent and RN-ase III-

sensitive structures that are capable of triggering TLR3 activation, suggesting the

involvement of double-stranded (ds) structures. Thus ds-RNA structures present in

the eggs of Schistosoma mansoni are able to activate TLR3 (59). Helminth glycolipids

also interact with TLRs. The schistosome-specific lysophosphatidyl-serine was shown

to active human monocyte-derived DCs through TLR2, which results in the ability of

DCs to induce the development of IL-10 producing regulatory T cells as well as the

induction of a TH2 response (60).

C-type lectins

The term C-type lectin receptor designates carbohydrate-binding molecules that bind

their ligands in a Ca2+-dependent manner through a carbohydrate recognition

domain (CRD). The CRD contains a well-preserved consensus sequence of

Chapter 1 _

28

approximately 115-130 amino acids, which are involved in calcium binding and sugar

specificity. One calcium ion is essential for proper positioning of the binding site. The

second calcium ion is situated in the primary binding site and co-ordinates ligand

binding (61). In addition, the sugar binding to a lectin depends on subtle differences

in the arrangements of carbohydrate residues and their branching. Furthermore, the

secondary binding site within the CRD was shown to play an important role in sugar

binding by mutation studies (62;63)

C-type lectins (CLRs) have diverse functions (64). They recognize endogenous ligands

and thereby mediate cell-cell interactions during immune responses. CLRs bind to

soluble self-antigens, leading to immune tolerance and maintenance of endogenous

glycoprotein homeostasis. CLRs function also as pathogen recognition receptors

through the recognition of PAMPs. Furthermore, co-operation between TLRs and

CLRs has been demonstrated and it seems that appropriate immune responses rely

on the interaction of many different antigen sensing and sampling mechanisms (65).

APCs express CLRs that are predominantly type II transmembrane receptors with a

single carbohydrate recognition domain, such as DC-SIGN, MGL, dectin-1, Blood DC

antigen 2 (BDCA2) and Langerin (Figure 9). In addition, there are also type I

transmembrane receptors, such as the mannose receptor and DEC-205, which have

multiple CRDs, although not all of these act as functional CRDs (Figure 9) (64). True

Ca2+-dependent CLRs fall into two broad categories, those recognizing mannose-/

fucose-/N-acetylglucosamine-type ligands and those recognizing galactose-/N-

acetylgalactosamine-type ligands, which can be defined by the presence of a

distinctive triplet of amino acids within the CRD: EPN for mannose-type receptors

and QPD for galactose-type receptors (61).

The capacity of CLRs to detect microorganisms depends on the degree of

oligomerization of the lectin receptor, as well as on the PAMP present on the

microbial surface. By creating multimers, in which several CRDs point towards a

common direction, the binding valency increases and allows interactions with the

dense carbohydrate expression on microbial surfaces. To increase their binding

strength to PAMPs, transmembrane CLRs have developed several strategies. CLRs

exists as tetramers or trimers on the surface of immature monocyte-derived DCs and


29

this assembly is required for high binding of target proteins (66). The neck portion of

each CLR molecule adjacent to the CRD is sufficient to mediate the formation of

dimers, whereas the neck regions near the amino-terminal are required to stabilize

tetramers (67). The CRDs are flexibly linked to the neck regions, which project CRDs

from the cell surface and enable CLRs to bind to various glycans on microbial

surfaces (67). Higher levels of organization can be obtained, due to clustering on the

cell surface of DCs (68). The organization of CLRs in so-called ‘microdomains’ on the

plasma membrane is important for the binding and internalization of virus particles,

suggesting that these multi-molecular assemblies of CLRs act as a docking site for

pathogens to invade the host (68). In the next paragraph the CLRs used throughout

this thesis will be described.

Figure 9. Two types of C-type lectins that are present on dendritic cells. Type I transmembrane receptors like DEC-205 and MR contain 8-10 carbohydrate recognition domains (CRDs) at their extracellular amino-terminus. Type II transmembrane receptors contain only one CRD at their carboxy-terminal extracellular domain.

DC-SIGN

Dendritic cell-specific intracellular adhesion molecule 3 (ICAM-3)-grabbing non-

integrin (DC-SIGN, CD209) is a type II membrane C-type lectin with a short amino

terminal cytoplasmic tail and a single carboxyl terminal carbohydrate recognition

domain (CRD) (69). The primary structure of the CRD contains conserved residues

consistent with classical mannose-specific CRDs. The CRD of DC-SIGN recognizes

both internal branched mannose residues as well as terminal di-mannoses (70;71).

Chapter 1 _

30

The CRD of DC-SIGN also recognizes fucosylated glycan structures preferentially the

α1-3 and α1-4 fucosylated tri- and tetrasaccharides such as Lewis antigens and LDNF

(72;73). DC-SIGN is a well known pathogen receptor. DC-SIGN binds HIV-1 gp120

and facilitates the transport of HIV from mucosal sites to draining lymph nodes

where infection of T-lymphocytes occurs (74). Since the identification of DC-SIGN as

HIV-1 receptor on DCs, interactions with other pathogens have been reported

including Mycobacterium tuberculosis (72;73), Candida albicans (75), Helicobacter

pylori (76) and Schistosoma mansoni (77) but also viruses like hepatitis C virus (78-

80), Ebola (81;82), Cytomegalovirus (CMV) (83) and Dengue (84;85). These

interactions are due to the mannose- or fucose-type glycans that these pathogens

express on their surface or that are present in their secretion products.

The main function of CLRs expressed by DCs is to interact with conserved molecular

patterns that are shared by a large group of microorganisms, and internalize these

pathogens for processing and antigen presentation, thereby initiating an immune

response(86). To internalize pathogens most of these CLRs contain internalization

motifs. The cytoplasmic tail of DC-SIGN contains three internalization motives,

namely a tyrosine-based motif of the sequence YKSL, a dileucine motif and a tri-

acidic cluster EEE. Engering and coworkers showed that the tyrosine motif and the

dileucine motif are involved in the ligand-induced internalization of DC-SIGN (87).

DC-SIGN delivers antigens to intracellular compartments resembling late

endosomes/lysosomes for degradation and these antigens are subsequently

presented to T-cells in vitro (87;88). Whilst data suggest a role for DC-SIGN in host

defense, evidence is now accumulating that some pathogens may preferentially

interact with DC-SIGN as part of a pathogenic strategy and exploit the CLR mediated

uptake to their own benefit, namely to evade the host immune defenses (86).

DC-SIGN recognizes the self glycoproteins ICAM-2 and ICMA-3, and functions as a

cell-adhesion receptor. As a cell adhesion receptor DC-SIGN mediates interactions

between dendritic cells (DCs) and resting T cells through binding to ICAM-3 (69).

Enzymatic removal of the N-linked carbohydrates abrogates binding to DC-SIGN

(62). Recently it was reported that besides interactions with T cells, DC-SIGN also

mediates cell-cell interactions between DCs and neutrophils and interactions between

DCs and Natural Killer (NK) cells (89;90). DC-SIGN also functions as a rolling


31

receptor, that supports trans-endothelial migration of DC precursors from the blood

to tissues through interaction with endothelial ICAM-2 (91), however the endogenous

carbohydrate ligand still remained inconclusive. In chapter 5 we addressed this

question and found that Lewis y expressed on ICAM-2 on endothelial cells is the

endogenous ligand for DC-SIGN (Garcia-Vallejo et al., submitted, chapter 5).

DC-SIGN interacts with Schistosoma mansoni SEA. Blocking with anti-glycan

antibodies showed that Lewis x and LDNF moieties play a role in this interaction

(77). Reports on the carbohydrate specificity and function within the immune system

of lectins are emerging the last few years. By using glycan microarray technology the

carbohydrate specificity of lectins can be identified. Glycan microarray studies

confirmed that DC-SIGN recognizes two classes of glycans, mannose containing

glycans terminated with manα1-2 residues and various fucosylated glycans with the

Fucα1-3GlcNAc and Fucα1-4GlcNAc containing glycans found as terminal sequences

of N- and O-linked glycans (92).

L-SIGN

Liver/lymph node specific ICAM-3-grabbing non-integrin (L-SIGN/CD209L/DC-

SIGN-R) is a human homologue of DC-SIGN (93;94). L-SIGN shares 77% amino acid

sequence identity with DC-SIGN. L-SIGN is not expressed by DCs, but is expressed

by endothelial cells present in lymph node sinuses and liver sinusoidal endothelial

cells (LSECs). LSECs function as a liver-resident antigen presenting cell population

on which L-SIGN could play a role in antigen clearance as well as LSEC-leukocyte

adhesion (95). Within the cytoplasmic tail the most differences between DC-SIGN

and L-SIGN are found. Like DC-SIGN, L-SIGN contains a dileucine motif and a tri-

acidic cluster EED. L-SIGN lacks the tyrosine-based motif (93). In addition,

elucidation of the crystal structures of the CRDs of both DC-SIGN and L-SIGN, in

combination with binding studies, revealed that both receptors recognize high-

mannose oligosaccharides (70;71), and showed that L-SIGN has a higher affinity for

mannose than DC-SIGN (92). Whereas for DC-SIGN increasing evidence indicates,

that its major ligands are α3/α4-fucosylated glycans, no data so far indicated a role

for L-SIGN in the binding of fucosylated oligosaccharides. In chapter 4 we showed

that L-SIGN, like DC-SIGN, can bind to several Lewis antigens, with the exception of

Lewis x. DC-SIGN and L-SIGN share functional similarities by recognizing ICAM-2,

Chapter 1 _

32

ICAM-3, HIV-1 gp120 and Ebola. Recent reports indicate that L-SIGN represents a

liver specific receptor for Hepatitis C virus (HCV) and L-SIGN might play an

important role in HCV infection and immunity (78;88). L-SIGN also binds to

Schistosoma mansoni soluble egg antigens (SEA), however the exact ligands have not

been identified (63; Chapter 4).

MGL

The macrophage galactose binding lectin MGL (CD301), also called DC-asialoglyco-

protein receptor (DC-ASGP-R) or human macrophage lectin (HML) is the only

reported galactose-type C-type lectin on human DCs. MGL consists of one CRD

domain and contains an YENF internalization motif for endocytosis via clathrin

coated pits. MGL is expressed as a trimer on human DCs and macrophages at an

intermediate stage of differentiation from monocytes (96). MGL positive immature

DCs and macrophages are most abundantly expressed in the dermis and skin. MGL

expression is also found on DC-like cells in the T cell areas of human lymph node and

tonsil (96; 97). By using glycan microarray profiling the carbohydrate specificity of

MGL was characterized (98; Chapter 3). MGL has an exclusive specificity for terminal

α- and β-linked GalNAc residues that naturally occur as parts of glycoproteins and

glycosphingolipids. Up till now terminal GalNAc moieties expressed by tumor

antigens as well as the human parasite Schistosoma mansoni and a subset of

gangliosides (98; Chapter 3 and 7), are identified as ligands for MGL. Recently the

interaction of MGL and CD45 on effector T cells has been described (99).

Mannose receptor

The mannose receptor (MR, CD206) is a type I transmembrane domain that consists

of eight CRDs, a fibronectin type II domain and a cysteine rich N-terminal domain.

The mannose receptor is expressed on macrophage subsets, in vitro cultured DCs and

certain DC populations from inflamed skin as well as lymphatic and hepatic

sinusoidal endothelium (100-102). The MR has been shown to recycle constitutively

while releasing its cargo (103). It has been implicated in homeostatic processes, such

as clearance of endogenous products, cell adhesion, as well as pathogen recognition

and antigen presentation (104).


33

Recombinant domain deletion studies have demonstrated that CRD 4 and to a lesser

extent CRD 5 are the only domains showing true affinity for N-acetylglucosamine,

mannose and fucose-terminating oligosaccharides (105). Although all eight CRDs

contain conserved residues responsible for formation of the hydrophobic fold, only

CRD 4 and 5 retain residues needed for Ca2+ coordination and consequent

carbohydrate binding. The role of the MR as a pattern recognition receptor has been

well studied and it has been reported to bind to a wide variety of pathogens like HIV-1

(106), Mycobacterium tuberculosis (107), Candida albicans (108), Trypanosoma

cruzi (109), Pneumocystis carinii (110) and Streptococcus pneumoniae (111). It

preferentially targets mannose-containing structures and differs from DC-SIGN, as it

does not interact with Lewis x, despite having affinity for fucose (112). This can be

explained by the differences in arrangement of CRDs, as DC-SIGN has one CRD and

needs tetramerization for multivalent binding of its ligands, whereas the MR has

eight CRDs. The cysteine rich N-terminal was recently shown to be involved in the

binding of sulphated oligosaccharides (111), while the fibronectin type II domain

mediates the activity of the MR to bind collagen (113).

Cross talk between C-type lectins and Toll-like receptors

Pathogens have evolved strategies to evade the hosts’ immune response by subverting

the function of pattern recognition receptors. Certain PAMPs are recognized by TLRs

and CLRs simultaneously, and although the signal transduction route upon TLR

activation are well documented, CLR may also signal and thus influence DC

functions. C-type lectin stimulation can either enhance or inhibit TLR signaling.

Although C-type lectins do not seem to directly stimulate the immune system, they

affect the balance between immunity and tolerance by influencing TLR signaling

(114).

Mycobacterium tuberculosis is a potent inducer of T helper 1 (TH1)-polarized

immune response, and mycobacterial components have often been shown to

stimulate expression of co-stimulatory molecules and IL-12 production in DCs

through TLR2 and TLR4 triggering (115). M. tuberculosis strongly binds to DC-SIGN

through their mannose-capped cell-wall component lipoarabinomannan (ManLAM).

ManLAM targets CLRs to alter the immune response though cross talk between TLRs

and CLRs. In particular, binding of the mycobacterial component ManLAM to

Chapter 1 _

34

immature DCs inhibited LPS-induced maturation and subsequent LPS-mediated IL-

12 induction. Inhibitory anti-DC-SIGN antibodies could restore maturation of DCs in

the presence of ManLAM. The inhibition of DC maturation and the induction of IL-10

may contribute to the virulence of mycobacteria (115). Thus pathogen recognition by

DC-SIGN may modulate DC-induced immune responses, shifting the balance from

immune activation toward impairment of the immune response, which would be

beneficial to pathogen survival. How DC-SIGN signals are propagated within DCs is

not clear. Recently, Caparros and coworkers, revealed the first clues on signaling

transduction pathways upon DC-SIGN-ligation. They showed that DC-SIGN induces

the phosphorylation of ERK and Akt, without the concomitant p38MAPK activation

(116).

Dectin-1, a β-glucan receptor that is expressed on DCs and macrophages, and TLR-2

synergize in yeast recognition. The collaborative signaling of these two receptors

induces enhanced production of IL-12 and TNF-α in DCs and subsequently facilitates

a TH1 response (117). Studies showed that the cytoplasmic tail in particular the ITAM

motif, is involved in generating enhanced stimulatory capacity (118). Interestingly, a

similar motif that mediates signaling in dectin-1 is present in the cytoplasmic tail of

DC-SIGN, however there is no evidence yet for DC-SIGN that it can signal through

this motif in a similar manner.

The studies described above demonstrate that the collaborative recognition of

distinct microbial components or a pathogen by different classes of innate immune

receptors (TLRs and CLRs) is crucial for orchestrating inflammatory or inhibitory

responses. The balance between CLR binding and TLR stimulation may fine-tune

regulatory mechanisms to allow appropriate immune responses. To maintain

homeostatic control and silence immune activation pathogens have evolved a survival

strategy within the host environment. CLRs can induce unique intracellular signals

that modulate DC function, although the precise signaling pathways need further

investigation. Signals derived from CLRs and TLRs will determine whether pathogens

escape immunity or are eliminated (119).


35

Immune response to Schistosomes

Schistosome infection presents a complex challenge to the immune system. Many

helminth parasites are long-lived and cause chronic infections. The immune response

that develops during this time often proceeds to cause pathologic changes that in

many helminth infections are the primary cause of the disease.

Schistosomes use a wide array of strategies to evade the host immune system. They

use molecular mimicry to evade the immune defense of the snail host (120). In

humans schistosomes have an impressive array of immune evasion and repair

mechanisms, which include the ability to mask their surface by the acquisition of host

molecules, to enzymatically cleave antibodies, and to rapidly replace their surface

with unique double membranes using pre-formed membrane vesicles (121-124).

The infective stage, cercariae stimulate the onset of a TH1 response during the first 5

weeks of infection, which is maintained during the schistosomula and worm stage of

the life cycle. As infection progresses and eggs are released by the adult worms, the

response switches towards a TH2 response, driven by schistosome-egg antigens and

the TH1 responses declines (8;9). Increased numbers of eosinophils, basophils and

mast cells, and high circulating levels of IgE accompany the TH2 response. The

antigens released by the eggs orchestrate the development of granulomatous lesions

in the liver (125). By surrounding the egg, the granuloma segregates the egg from

hepatic tissue and allows continuing liver function. In the long term as the egg dies

and the granuloma resolves, fibrosis can develop (125). This can result in increased

portal blood pressure and bleedings, which are the most common death-cause during

schistosomiasis. In mouse models it has been shown that granulomas are not formed

in CD4 T cell deficient mice. These mice die of the toxic effect that certain egg

proteins have on the hepatocytes (126;127).

Glycosylated components of schistosome eggs have been shown to affect the

production of cytokines by DCs (128) and DCs stimulated by egg-derived antigens in

vitro can promote TH2-cell responses both in vitro and in vivo (129). Several

helminth-derived structures, including glycans have been identified to interact with

TLRs and induce innate immune responses. Lacto-N-fucopentaose III (LNFPIII), a

milk sugar terminating in Lewis x conjugated to human serum albumin, has been

Chapter 1 _

36

shown to activate murine dendritic cells via TLR4, whereas the non-fucosylated

analogue lacks this activity. The activation of TLR4 by LPS leads to the activation of

three MAP-Kinase intracellular pathways: via ERK, P38 and JNK, whereas activation

of TLR4 via LNFPIII leads to the activation of the ERK pathway only (58). When

lipids from schistosome eggs were fractionated into different classes and their effect

on DCs were analyzed, it became clear that the fraction containing

phosphatidylserines could interact with DCs and affect their T cell polarizing

capacity. Lysophosphatidylserine from helminth eggs activates TLR-2 at the cell

surface of DCs and influence their functional maturation such that they induce IL-10-

secreting regulatory T cells (60;130). Glycoconjugates within the soluble egg antigen

preparation containing β2-xylose and core α3-fucose, but possibly also other glycan

antigens, seem to play an important role in TH2 polarization in vivo (131).

While the role of DCs as the initiators of egg-antigen specific responses during

infection has not been established, it is clear that DCs pulsed with SEA in vitro are

capable of inducing TH2 responses. The interaction between host lectins and

schistosome antigens seem to play an important role. Several lectins that bind to

schistosome glycans have been described. Galectin-3 has been shown to bind to both

LN and LDN and to be capable of stimulating the uptake of LN and LDN containing

particles by macrophages (132). DC-SIGN binds to schistosome soluble egg antigens

via the Lewis x and LDNF epitope (77). DC-SIGN also interacts with cercarial

glycolipids of Schistosoma mansoni expressing Lewis x and pseudo-Lewis y (133).

The C-type lectin MGL binds to terminal α- and β-linked GalNAc and interacts with

SEA through the β-linked GalNAc in LDN and its derivates (98). The murine

mannose receptor was shown to interact with SEA by using a chimera consisting of

CRDs 4-7. In Chapter 7 we show that the interaction of SEA with DCs is dependent of

multiple C-type lectins, DC-SIGN, MGL and mannose receptor respectively (134).

However, at this moment it remains unclear whether these interactions have

implications for the immunomodulatory and/or stimulatory effects of schistosome

glycans in the immune response to Schistosoma mansoni, nor is it clear whether

these CLRs stimulate or inhibit each others functions.


37

Outline of this thesis

The studies described in this thesis have been performed to gain more insight in the

recognition of Schistosoma mansoni glycans by C-type lectins and the consequences

for dendritic cell mediated immune responses. As a first approach to understand the

molecular interactions of schistosome glycans and dendritic cells that lead to TH2 cell

polarization, the recognition of schistosome glycan antigens by DCs were

investigated. In chapter 2 and 3 we describe the carbohydrate specificity of DC-

SIGN and MGL respectively, by performing a glycan array using an Fc-chimera. Next,

the molecular basis of differences in carbohydrate binding properties of DC-SIGN

and its homologue L-SIGN were investigated in chapter 4. The interaction of DC-

SIGN with self- glycoproteins was analyzed in chapter 5, by determining the DC-

SIGN ligands that are crucial for the adhesion and rolling of dendritic cells on

endothelial cells, a prerequisite for migration of DCs to the lymph node. The

interactions of DC-SIGN with glycolipids of different life stages of the human parasite

Schistosoma mansoni were investigated in chapter 6. In chapter 7 we demonstrate

that Schistosoma mansoni soluble egg antigens are recognized by several C-type

lectins on dendritic cells and suppress TLR- induced DC maturation. Finally, the

results presented in this thesis are integrated in a general discussion and main

perspectives for future studies are discussed in chapter 8.

References

1 Chitsulo, L., Engels, D., Montresor, A., and Savioli, L. 2000. The global status of

schistosomiasis and its control. Acta Trop. 77:41-51. 2 Chitsulo, L., Loverde, P., and Engels, D. 2004. Schistosomiasis. Nat.Rev.Microbiol. 2:12-13. 3 Fulford, A. J., Butterworth, A. E., Ouma, J. H., and Sturrock, R. F. 1995. A statistical

approach to schistosome population dynamics and estimation of the life-span of Schistosoma mansoni in man. Parasitology 110 ( Pt 3):307-316.

4 Doenhoff, M. J. 1997. A role for granulomatous inflammation in the transmission of infectious disease: schistosomiasis and tuberculosis. Parasitology 115 Suppl:S113-S125.

5 Hamburger, J., Lustigman, S., Siongok, T. K., Ouma, J. H., and Mahmoud, A. A. 1982. Characterization of a purified glycoprotein from Schistosoma mansoni eggs: specificity, stability, and the involvement of carbohydrate and peptide moieties in its serologic activity. J Immunol 128:1864-1869.

6 Warren, K. S., Domingo, E. O., and Cowan, R. B. 1967. Granuloma formation around schistosome eggs as a manifestation of delayed hypersensitivity. Am.J Pathol. 51:735-756.

7 Muller R. 2002. Worms and human disease. In Wallingford, Oxon, UK. 8 Grzych, J. M., Pearce, E., Cheever, A., Caulada, Z. A., Caspar, P., Heiny, S., Lewis, F., and

Sher, A. 1991. Egg deposition is the major stimulus for the production of Th2 cytokines in murine schistosomiasis mansoni. J Immunol 146:1322-1327.

9 Pearce, E. J. and MacDonald, A. S. 2002. The immunobiology of schistosomiasis. Nat.Rev.Immunol 2:499-511.

10 King, C. L. 2001. Initiation and regulation of disease in Schistosomiasis. In in Mahmoud AAF, pp. 213-264. Imperial college press, London.

Chapter 1 _

38

11 Gryseels, B. 1989. The relevance of schistosomiasis for public health. Trop.Med.Parasitol. 40:134-142.

12 Kornfeld, R. and Kornfeld, S. 1985. Assembly of asparagine-linked oligosaccharides. Annu.Rev.Biochem. 54:631-664.

13 Nyame, K., Cummings, R. D., and Damian, R. T. 1988. Characterization of the high mannose asparagine-linked oligosaccharides synthesized by Schistosoma mansoni adult male worms. Mol.Biochem.Parasitol. 28:265-274.

14 Khoo, K. H., Huang, H. H., and Lee, K. M. 2001. Characteristic structural features of schistosome cercarial N-glycans: expression of Lewis X and core xylosylation. Glycobiology 11:149-163.

15 Khoo, K. H., Chatterjee, D., Caulfield, J. P., Morris, H. R., and Dell, A. 1997. Structural mapping of the glycans from the egg glycoproteins of Schistosoma mansoni and Schistosoma japonicum: identification of novel core structures and terminal sequences. Glycobiology 7:663-677.

16 Nyame, K., Smith, D. F., Damian, R. T., and Cummings, R. D. 1989. Complex-type asparagine-linked oligosaccharides in glycoproteins synthesized by Schistosoma mansoni adult males contain terminal beta- linked N-acetylgalactosamine. J.Biol.Chem. 264:3235-3243.

17 Srivatsan, J., Smith, D. F., and Cummings, R. D. 1992. The human blood fluke Schistosoma mansoni synthesizes glycoproteins containing the Lewis X antigen. J.Biol.Chem. 267:20196-20203.

18 van den Eijnden, D. H., Neeleman, A. P., Bakker, H., and van, D., I 1998. Novel pathways in complex-type oligosaccharide synthesis. New vistas opened by studies in invertebrates. Adv.Exp.Med.Biol. 435:3-7.

19 Wuhrer, M., Koeleman, C. A., Deelder, A. M., and Hokke, C. H. 2006. Repeats of LacdiNAc and fucosylated LacdiNAc on N-glycans of the human parasite Schistosoma mansoni. FEBS J. 273:347-361.

20 Robijn, M. L., Wuhrer, M., Kornelis, D., Deelder, A. M., Geyer, R., and Hokke, C. H. 2005. Mapping fucosylated epitopes on glycoproteins and glycolipids of Schistosoma mansoni cercariae, adult worms and eggs. Parasitology 130:67-77.

21 Nyame, K., Cummings, R. D., and Damian, R. T. 1987. Schistosoma mansoni synthesizes glycoproteins containing terminal O-linked N-acetylglucosamine residues. J Biol.Chem. 262:7990-7995.

22 Khoo, K. H., Sarda, S., Xu, X., Caulfield, J. P., McNeil, M. R., Homans, S. W., Morris, H. R., and Dell, A. 1995. A unique multifucosylated -3GalNAc beta 1-->4GlcNAc beta 1-->3Gal alpha 1- motif constitutes the repeating unit of the complex O-glycans derived from the cercarial glycocalyx of Schistosoma mansoni. J Biol.Chem. 270:17114-17123.

23 Huang, H. H., Tsai, P. L., and Khoo, K. H. 2001. Selective expression of different fucosylated epitopes on two distinct sets of Schistosoma mansoni cercarial O-glycans: identification of a novel core type and Lewis X structure. Glycobiology 11:395-406.

24 Bergwerff, A. A., van Dam, G. J., Rotmans, J. P., Deelder, A. M., Kamerling, J. P., and Vliegenthart, J. F. 1994. The immunologically reactive part of immunopurified circulating anodic antigen from Schistosoma mansoni is a threonine-linked polysaccharide consisting of --> 6)-(beta-D-GlcpA-(1 --> 3))-beta-D-GalpNAc-(1 --> repeating units. J Biol.Chem. 269:31510-31517.

25 Hakomori, S. 1993. Structure and function of sphingoglycolipids in transmembrane signalling and cell-cell interactions. Biochem.Soc.Trans. 21 ( Pt 3):583-595.

26 Hirabayashi Y, I. S. 1999. Roles of glycolipids and sphingolipids in biological membrane IRL Press at Oxford Press.

27 Basu et al. 2000. Carbohydrates in chemistry and biology. In Ernst B., H. G. W. S. P., ed., Glycosyltransferases in glycosphingolipid biosynthesis, pp. 329-343. Wiley-VHC, Weinheim.

28 Gillard, B. K., Thurmon, L. T., and Marcus, D. M. 1993. Variable subcellular localization of glycosphingolipids. Glycobiology 3:57-67.

29 Simons, K. and Ikonen, E. 1997. Functional rafts in cell membranes. Nature 387:569-572. 30 Makaaru, C. K., Damian, R. T., Smith, D. F., and Cummings, R. D. 1992. The human blood

fluke Schistosoma mansoni synthesizes a novel type of glycosphingolipid. J Biol.Chem. 267:2251-2257.

31 Wuhrer, M., Dennis, R. D., Doenhoff, M. J., Lochnit, G., and Geyer, R. 2000. Schistosoma mansoni cercarial glycolipids are dominated by Lewis X and pseudo-Lewis Y structures. Glycobiology 10:89-101.


39

32 Wuhrer, M., Kantelhardt, S. R., Dennis, R. D., Doenhoff, M. J., Lochnit, G., and Geyer, R. 2002. Characterization of glycosphingolipids from Schistosoma mansoni eggs carrying Fuc(alpha1-3)GalNAc-, GalNAc(beta1-4)[Fuc(alpha1-3)]GlcNAc- and Gal(beta1-4)[Fuc(alpha1-3)]GlcNAc- (Lewis X) terminal structures. Eur.J Biochem. 269:481-493.

33 Dennis, R. D., Baumeister, S., Lauer, G., Richter, R., and Geyer, E. 1996. Neutral glycolipids of Schistosoma mansoni as feasible antigens in the detection of schistosomiasis. Parasitology 112 ( Pt 3):295-307.

34 Weiss, J. B., Magnani, J. L., and Strand, M. 1986. Identification of Schistosoma mansoni glycolipids that share immunogenic carbohydrate epitopes with glycoproteins. J.Immunol. 136:4275-4282.

35 Wuhrer, M., Dennis, R. D., Doenhoff, M. J., and Geyer, R. 2000. Stage-associated expression of ceramide structures in glycosphingolipids from the human trematode parasite Schistosoma mansoni. Biochim.Biophys.Acta 1524:155-161.

36 Reid, S. D., Penna, G., and Adorini, L. 2000. The control of T cell responses by dendritic cell subsets. Curr.Opin.Immunol 12:114-121.

37 Flores-Romo, L. 2001. In vivo maturation and migration of dendritic cells. Immunology 102:255-262.

38 Banchereau, J. and Steinman, R. M. 1998. Dendritic cells and the control of immunity. Nature 392:245-252.

39 Cella, M., Engering, A., Pinet, V., Pieters, J., and Lanzavecchia, A. 1997. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388:782-787.

40 Pierre, P., Turley, S. J., Gatti, E., Hull, M., Meltzer, J., Mirza, A., Inaba, K., Steinman, R. M., and Mellman, I. 1997. Developmental regulation of MHC class II transport in mouse dendritic cells. Nature 388:787-792.

41 Roake, J. A., Rao, A. S., Morris, P. J., Larsen, C. P., Hankins, D. F., and Austyn, J. M. 1995. Dendritic cell loss from nonlymphoid tissues after systemic administration of lipopolysaccharide, tumor necrosis factor, and interleukin 1. J Exp.Med. 181:2237-2247.

42 Sallusto, F., Schaerli, P., Loetscher, P., Schaniel, C., Lenig, D., Mackay, C. R., Qin, S., and Lanzavecchia, A. 1998. Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur.J Immunol 28:2760-2769.

43 Winzler, C., Rovere, P., Rescigno, M., Granucci, F., Penna, G., Adorini, L., Zimmermann, V. S., Davoust, J., and Ricciardi-Castagnoli, P. 1997. Maturation stages of mouse dendritic cells in growth factor-dependent long-term cultures. J Exp.Med. 185:317-328.

44 Schwarz, R. H. a. M. D. L. 2003. Fundamental Immunology Lippincott Williams and WiIlkins, Philadelphia.

45 Kearney, E. R., Pape, K. A., Loh, D. Y., and Jenkins, M. K. 1994. Visualization of peptide-specific T cell immunity and peripheral tolerance induction in vivo. Immunity. 1:327-339.

46 Keir, M. E. and Sharpe, A. H. 2005. The B7/CD28 costimulatory family in autoimmunity. Immunol Rev. 204:128-143.

47 Kalinski, P., Hilkens, C. M., Wierenga, E. A., and Kapsenberg, M. L. 1999. T-cell priming by type-1 and type-2 polarized dendritic cells: the concept of a third signal. Immunol Today 20:561-567.

48 Mushegian, A. and Medzhitov, R. 2001. Evolutionary perspective on innate immune recognition. J Cell Biol. 155:705-710.

49 Bowie, A. and O'Neill, L. A. 2000. The interleukin-1 receptor/Toll-like receptor superfamily: signal generators for pro-inflammatory interleukins and microbial products. J Leukoc.Biol. 67:508-514.

50 Hornung, V., Rothenfusser, S., Britsch, S., Krug, A., Jahrsdorfer, B., Giese, T., Endres, S., and Hartmann, G. 2002. Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J Immunol 168:4531-4537.

51 Muzio, M., Bosisio, D., Polentarutti, N., D'amico, G., Stoppacciaro, A., Mancinelli, R., van't Veer, C., Penton-Rol, G., Ruco, L. P., Allavena, P., and Mantovani, A. 2000. Differential expression and regulation of toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells. J Immunol 164:5998-6004.

52 Medzhitov, R. 2001. Toll-like receptors and innate immunity. Nat.Rev.Immunol 1:135-145. 53 Takeda, K. and Akira, S. 2005. Toll-like receptors in innate immunity. Int.Immunol 17:1-14. 54 Beutler, B. 2004. Inferences, questions and possibilities in Toll-like receptor signalling.

Nature 430:257-263.

Chapter 1 _

40

55 Slack, J. L., Schooley, K., Bonnert, T. P., Mitcham, J. L., Qwarnstrom, E. E., Sims, J. E., and Dower, S. K. 2000. Identification of two major sites in the type I interleukin-1 receptor cytoplasmic region responsible for coupling to pro-inflammatory signaling pathways. J Biol.Chem. 275:4670-4678.

56 Akira, S. 2003. Mammalian Toll-like receptors. Curr.Opin.Immunol 15:5-11. 57 Napolitani, G., Rinaldi, A., Bertoni, F., Sallusto, F., and Lanzavecchia, A. 2005. Selected

Toll-like receptor agonist combinations synergistically trigger a T helper type 1-polarizing program in dendritic cells. Nat.Immunol 6:769-776.

58 Thomas, P. G., Carter, M. R., Atochina, O., Da'Dara, A. A., Piskorska, D., McGuire, E., and Harn, D. A. 2003. Maturation of dendritic cell 2 phenotype by a helminth glycan uses a Toll-like receptor 4-dependent mechanism. J Immunol 171:5837-5841.

59 Aksoy, E., Zouain, C. S., Vanhoutte, F., Fontaine, J., Pavelka, N., Thieblemont, N., Willems, F., Ricciardi-Castagnoli, P., Goldman, M., Capron, M., Ryffel, B., and Trottein, F. 2005. Double-stranded RNAs from the helminth parasite Schistosoma activate TLR3 in dendritic cells. J Biol.Chem. 280:277-283.

60 van der Kleij, D., Latz, E., Brouwers, J. F., Kruize, Y. C., Schmitz, M., Kurt-Jones, E. A., Espevik, T., de Jong, E. C., Kapsenberg, M. L., Golenbock, D. T., Tielens, A. G., and Yazdanbakhsh, M. 2002. A novel host-parasite lipid cross-talk. Schistosomal lyso-phosphatidylserine activates toll-like receptor 2 and affects immune polarization. J Biol.Chem. 277:48122-48129.

61 Drickamer, K. 1999. C-type lectin-like domains. Curr.Opin.Struct.Biol. 9:585-590. 62 Geijtenbeek, T. B., van Duijnhoven, G. C., van Vliet, S. J., Krieger, E., Vriend, G., Figdor, C.

G., and Van Kooyk, Y. 2002. Identification of different binding sites in the dendritic cell-specific receptor DC-SIGN for intercellular adhesion molecule 3 and HIV-1. J.Biol.Chem. 277:11314-11320.

63 van Liempt, E., Imberty, A., Bank, C. M., van Vliet, S. J., Van Kooyk, Y., Geijtenbeek, T. B., and van, D., I 2004. Molecular basis of the differences in binding properties of the highly related C-type lectins DC-SIGN and L-SIGN to Lewis X trisaccharide and Schistosoma mansoni egg antigens. J.Biol.Chem. 279:33161-33167.

64 Figdor, C. G., Van Kooyk, Y., and Adema, G. J. 2002. C-type lectin receptors on dendritic cells and Langerhans cells. Nat.Rev.Immunol. 2:77-84.

65 Mukhopadhyay, S., Herre, J., Brown, G. D., and Gordon, S. 2004. The potential for Toll-like receptors to collaborate with other innate immune receptors. Immunology 112:521-530.

66 Bernhard, O. K., Lai, J., Wilkinson, J., Sheil, M. M., and Cunningham, A. L. 2004. Proteomic analysis of DC-SIGN on dendritic cells detects tetramers required for ligand binding but no association with CD4. J.Biol.Chem. 279:51828-51835.

67 Feinberg, H., Guo, Y., Mitchell, D. A., Drickamer, K., and Weis, W. I. 2005. Extended neck regions stabilize tetramers of the receptors DC-SIGN and DC-SIGNR. J Biol.Chem. 280:1327-1335.

68 Cambi, A., de Lange, F., van Maarseveen, N. M., Nijhuis, M., Joosten, B., van Dijk, E. M., de Bakker, B. I., Fransen, J. A., Bovee-Geurts, P. H., van Leeuwen, F. N., van Hulst, N. F., and Figdor, C. G. 2004. Microdomains of the C-type lectin DC-SIGN are portals for virus entry into dendritic cells. J Cell Biol. 164:145-155.

69 Geijtenbeek, T. B., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Adema, G. J., Van Kooyk, Y., and Figdor, C. G. 2000. Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell 100:575-585.

70 Feinberg, H., Mitchell, D. A., Drickamer, K., and Weis, W. I. 2001. Structural basis for selective recognition of oligosaccharides by DC-SIGN and DC-SIGNR. Science 294:2163-2166.

71 Mitchell, D. A., Fadden, A. J., and Drickamer, K. 2001. A novel mechanism of carbohydrate recognition by the C-type lectins DC-SIGN and DC-SIGNR. Subunit organization and binding to multivalent ligands. J.Biol.Chem. 276:28939-28945.

72 Appelmelk, B. J., van, D., I, van Vliet, S. J., Vandenbroucke-Grauls, C. M., Geijtenbeek, T. B., and Van Kooyk, Y. 2003. Cutting edge: carbohydrate profiling identifies new pathogens that interact with dendritic cell-specific ICAM-3-grabbing nonintegrin on dendritic cells. J.Immunol. 170:1635-1639.

73 Maeda, N., Nigou, J., Herrmann, J. L., Jackson, M., Amara, A., Lagrange, P. H., Puzo, G., Gicquel, B., and Neyrolles, O. 2003. The cell surface receptor DC-SIGN discriminates between Mycobacterium species through selective recognition of the mannose caps on lipoarabinomannan. J Biol.Chem. 278:5513-5516.


41

74 Geijtenbeek, T. B., Kwon, D. S., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Middel, J., Cornelissen, I. L., Nottet, H. S., KewalRamani, V. N., Littman, D. R., Figdor, C. G., and Van Kooyk, Y. 2000. DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells. Cell 100:587-597.

75 Cambi, A., Gijzen, K., de Vries, J. M., Torensma, R., Joosten, B., Adema, G. J., Netea, M. G., Kullberg, B. J., Romani, L., and Figdor, C. G. 2003. The C-type lectin DC-SIGN (CD209) is an antigen-uptake receptor for Candida albicans on dendritic cells. Eur.J.Immunol. 33:532-538.

76 Bergman, M. P., Engering, A., Smits, H. H., van Vliet, S. J., van Bodegraven, A. A., Wirth, H. P., Kapsenberg, M. L., Vandenbroucke-Grauls, C. M., Van Kooyk, Y., and Appelmelk, B. J. 2004. Helicobacter pylori modulates the T helper cell 1/T helper cell 2 balance through phase-variable interaction between lipopolysaccharide and DC-SIGN. J.Exp.Med. 200:979-990.

77 van Die, I., van Vliet, S. J., Nyame, A. K., Cummings, R. D., Bank, C. M., Appelmelk, B., Geijtenbeek, T. B., and Van Kooyk, Y. 2003. The dendritic cell-specific C-type lectin DC-SIGN is a receptor for Schistosoma mansoni egg antigens and recognizes the glycan antigen Lewis x. Glycobiology 13:471-478.

78 Gardner, J. P., Durso, R. J., Arrigale, R. R., Donovan, G. P., Maddon, P. J., Dragic, T., and Olson, W. C. 2003. L-SIGN (CD 209L) is a liver-specific capture receptor for hepatitis C virus. Proc.Natl.Acad.Sci.U.S.A 100:4498-4503.

79 Lozach, P. Y., Lortat-Jacob, H., de Lacroix, d. L., Staropoli, I., Foung, S., Amara, A., Houles, C., Fieschi, F., Schwartz, O., Virelizier, J. L., Arenzana-Seisdedos, F., and Altmeyer, R. 2003. DC-SIGN and L-SIGN are high affinity binding receptors for hepatitis C virus glycoprotein E2. J.Biol.Chem. 278:20358-20366.

80 Pohlmann, S., Zhang, J., Baribaud, F., Chen, Z., Leslie, G. J., Lin, G., Granelli-Piperno, A., Doms, R. W., Rice, C. M., and McKeating, J. A. 2003. Hepatitis C virus glycoproteins interact with DC-SIGN and DC-SIGNR. J.Virol. 77:4070-4080.

81 Alvarez, C. P., Lasala, F., Carrillo, J., Muniz, O., Corbi, A. L., and Delgado, R. 2002. C-type lectins DC-SIGN and L-SIGN mediate cellular entry by Ebola virus in cis and in trans. J.Virol. 76:6841-6844.

82 Simmons, G., Reeves, J. D., Grogan, C. C., Vandenberghe, L. H., Baribaud, F., Whitbeck, J. C., Burke, E., Buchmeier, M. J., Soilleux, E. J., Riley, J. L., Doms, R. W., Bates, P., and Pohlmann, S. 2003. DC-SIGN and DC-SIGNR bind ebola glycoproteins and enhance infection of macrophages and endothelial cells. Virology 305:115-123.

83 Halary, F., Amara, A., Lortat-Jacob, H., Messerle, M., Delaunay, T., Houles, C., Fieschi, F., Arenzana-Seisdedos, F., Moreau, J. F., and Dechanet-Merville, J. 2002. Human cytomegalovirus binding to DC-SIGN is required for dendritic cell infection and target cell trans-infection. Immunity. 17:653-664.

84 Navarro-Sanchez, E., Altmeyer, R., Amara, A., Schwartz, O., Fieschi, F., Virelizier, J. L., Arenzana-Seisdedos, F., and Despres, P. 2003. Dendritic-cell-specific ICAM3-grabbing non-integrin is essential for the productive infection of human dendritic cells by mosquito-cell-derived dengue viruses. EMBO Rep. 4:723-728.

85 Tassaneetrithep, B., Burgess, T. H., Granelli-Piperno, A., Trumpfheller, C., Finke, J., Sun, W., Eller, M. A., Pattanapanyasat, K., Sarasombath, S., Birx, D. L., Steinman, R. M., Schlesinger, S., and Marovich, M. A. 2003. DC-SIGN (CD209) mediates dengue virus infection of human dendritic cells. J Exp.Med. 197:823-829.

86 Van Kooyk, Y. and Geijtenbeek, T. B. 2003. DC-SIGN: escape mechanism for pathogens. Nat.Rev.Immunol. 3:697-709.

87 Engering, A., Geijtenbeek, T. B., van Vliet, S. J., Wijers, M., van Liempt, E., Demaurex, N., Lanzavecchia, A., Fransen, J., Figdor, C. G., Piguet, V., and Van Kooyk, Y. 2002. The dendritic cell-specific adhesion receptor DC-SIGN internalizes antigen for presentation to T cells. J.Immunol. 168:2118-2126.

88 Ludwig, I. S., Lekkerkerker, A. N., Depla, E., Bosman, F., Musters, R. J., Depraetere, S., Van Kooyk, Y., and Geijtenbeek, T. B. 2004. Hepatitis C virus targets DC-SIGN and L-SIGN to escape lysosomal degradation. J.Virol. 78:8322-8332.

89 van Gisbergen, K. P., Sanchez-Hernandez, M., Geijtenbeek, T. B., and Van Kooyk, Y. 2005. Neutophils mediate immune modulation of dendritic cells through glycosylation-dependent interactions between Mac-1 and DC-SIGN. J Exp.Med. 201:1281-1292.

90 van Gisbergen, K. P., Arce I, van Vliet, S. J., Geijtenbeek, T. B., and Van Kooyk, Y. 2006. Cross-talk between dendritic cells and NK cells is regulated by LFA-1 and DC-SIGN. in prep.

Chapter 1 _

42

91 Geijtenbeek, T. B., Krooshoop, D. J., Bleijs, D. A., van Vliet, S. J., van Duijnhoven, G. C., Grabovsky, V., Alon, R., Figdor, C. G., and Van Kooyk, Y. 2000. DC-SIGN-ICAM-2 interaction mediates dendritic cell trafficking. Nat.Immunol. 1:353-357.

92 Guo, Y., Feinberg, H., Conroy, E., Mitchell, D. A., Alvarez, R., Blixt, O., Taylor, M. E., Weis, W. I., and Drickamer, K. 2004. Structural basis for distinct ligand-binding and targeting properties of the receptors DC-SIGN and DC-SIGNR. Nat.Struct.Mol.Biol. 11:591-598.

93 Bashirova, A. A., Geijtenbeek, T. B., van Duijnhoven, G. C., van Vliet, S. J., Eilering, J. B., Martin, M. P., Wu, L., Martin, T. D., Viebig, N., Knolle, P. A., KewalRamani, V. N., Van Kooyk, Y., and Carrington, M. 2001. A dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN)-related protein is highly expressed on human liver sinusoidal endothelial cells and promotes HIV-1 infection. J.Exp.Med. 193:671-678.

94 Soilleux, E. J., Barten, R., and Trowsdale, J. 2000. DC-SIGN; a related gene, DC-SIGNR; and CD23 form a cluster on 19p13. J.Immunol. 165:2937-2942.

95 Knolle, P. A. and Gerken, G. 2000. Local control of the immune response in the liver. Immunol.Rev. 174:21-34.

96 van Vliet, S. J., van Liempt, E., Geijtenbeek, T. B., and Van Kooyk, Y. 2006. Differential regulation of C-type lectin expression on tolerogenic DC subsets. Immunobiology. 211; 577-585

97 Higashi, N., Fujioka, K., Denda-Nagai, K., Hashimoto, S., Nagai, S., Sato, T., Fujita, Y., Morikawa, A., Tsuiji, M., Miyata-Takeuchi, M., Sano, Y., Suzuki, N., Yamamoto, K., Matsushima, K., and Irimura, T. 2002. The macrophage C-type lectin specific for galactose/N-acetylgalactosamine is an endocytic receptor expressed on monocyte-derived immature dendritic cells. J Biol.Chem. 277:20686-20693.

98 van Vliet, S. J., van Liempt, E., Saeland, E., Aarnoudse, C. A., Appelmelk, B., Irimura, T., Geijtenbeek, T. B., Blixt, O., Alvarez, R., van, D., I, and Van Kooyk, Y. 2005. Carbohydrate profiling reveals a distinctive role for the C-type lectin MGL in the recognition of helminth parasites and tumor antigens by dendritic cells. Int.Immunol. 17:661-669.

99 van Vliet, S. J., Gringhuis SI, Geijtenbeek, T. B., and Van Kooyk, Y. 2006. Nat.Immunol. 11:1200-1208.

100 Engering, A. J., Cella, M., Fluitsma, D. M., Hoefsmit, E. C., Lanzavecchia, A., and Pieters, J. 1997. Mannose receptor mediated antigen uptake and presentation in human dendritic cells. Adv.Exp.Med.Biol. 417:183-187.

101 Linehan, S. A., Martinez-Pomares, L., Stahl, P. D., and Gordon, S. 1999. Mannose receptor and its putative ligands in normal murine lymphoid and nonlymphoid organs: In situ expression of mannose receptor by selected macrophages, endothelial cells, perivascular microglia, and mesangial cells, but not dendritic cells. J Exp.Med. 189:1961-1972.

102 Wileman, T. E., Lennartz, M. R., and Stahl, P. D. 1986. Identification of the macrophage mannose receptor as a 175-kDa membrane protein. Proc.Natl.Acad.Sci.U.S.A 83:2501-2505.

103 Stahl, P., Schlesinger, P. H., Sigardson, E., Rodman, J. S., and Lee, Y. C. 1980. Receptor-mediated pinocytosis of mannose glycoconjugates by macrophages: characterization and evidence for receptor recycling. Cell 19:207-215.

104 Taylor, P. R., Gordon, S., and Martinez-Pomares, L. 2005. The mannose receptor: linking homeostasis and immunity through sugar recognition. Trends Immunol 26:104-110.

105 Taylor, M. E., Bezouska, K., and Drickamer, K. 1992. Contribution to ligand binding by multiple carbohydrate-recognition domains in the macrophage mannose receptor. J Biol.Chem. 267:1719-1726.

106 Nguyen, D. G. and Hildreth, J. E. 2003. Involvement of macrophage mannose receptor in the binding and transmission of HIV by macrophages. Eur.J Immunol 33:483-493.

107 Schlesinger, L. S. 1993. Macrophage phagocytosis of virulent but not attenuated strains of Mycobacterium tuberculosis is mediated by mannose receptors in addition to complement receptors. J Immunol 150:2920-2930.

108 Ezekowitz, R. A., Sastry, K., Bailly, P., and Warner, A. 1990. Molecular characterization of the human macrophage mannose receptor: demonstration of multiple carbohydrate recognition-like domains and phagocytosis of yeasts in Cos-1 cells. J Exp.Med. 172:1785-1794.

109 Kahn, S., Wleklinski, M., Aruffo, A., Farr, A., Coder, D., and Kahn, M. 1995. Trypanosoma cruzi amastigote adhesion to macrophages is facilitated by the mannose receptor. J Exp.Med. 182:1243-1258.

110 Ezekowitz, R. A., Williams, D. J., Koziel, H., Armstrong, M. Y., Warner, A., Richards, F. F., and Rose, R. M. 1991. Uptake of Pneumocystis carinii mediated by the macrophage mannose receptor. Nature 351:155-158.


43

111 Zamze, S., Martinez-Pomares, L., Jones, H., Taylor, P. R., Stillion, R. J., Gordon, S., and Wong, S. Y. 2002. Recognition of bacterial capsular polysaccharides and lipopolysaccharides by the macrophage mannose receptor. J Biol.Chem. 277:41613-41623.

112 Frison, N., Taylor, M. E., Soilleux, E., Bousser, M. T., Mayer, R., Monsigny, M., Drickamer, K., and Roche, A. C. 2003. Oligolysine-based oligosaccharide clusters: selective recognition and endocytosis by the mannose receptor and dendritic cell-specific intercellular adhesion molecule 3 (ICAM-3)-grabbing nonintegrin. J.Biol.Chem. 278:23922-23929.

113 Napper, C. E., Drickamer, K., and Taylor, M. E. 2006. Collagen binding by the mannose receptor mediated through the fibronectin type II domain. Biochem.J. 395:579-586.

114 Underhill, D. M. and Ozinsky, A. 2002. Toll-like receptors: key mediators of microbe detection. Curr.Opin.Immunol 14:103-110.

115 Geijtenbeek, T. B., van Vliet, S. J., Koppel, E. A., Sanchez-Hernandez, M., Vandenbroucke-Grauls, C. M., Appelmelk, B., and Van Kooyk, Y. 2003. Mycobacteria target DC-SIGN to suppress dendritic cell function. J.Exp.Med. 197:7-17.

116 Caparros, E., Munoz, P., Sierra-Filardi, E., Serrano-Gomez, D., Puig-Kroger, A., Rodriguez-Fernandez, J. L., Mellado, M., Sancho, J., Zubiaur, M., and Corbi, A. L. 2006. DC-SIGN ligation on dendritic cells results in ERK and PI3K activation and modulates cytokine production. Blood 107:3950-3958.

117 Brown, G. D., Herre, J., Williams, D. L., Willment, J. A., Marshall, A. S., and Gordon, S. 2003. Dectin-1 mediates the biological effects of beta-glucans. J.Exp.Med. 197:1119-1124.

118 Gantner, B. N., Simmons, R. M., Canavera, S. J., Akira, S., and Underhill, D. M. 2003. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J Exp.Med. 197:1107-1117.

119 Engering, A., Geijtenbeek, T. B., and Van Kooyk, Y. 2002. Immune escape through C-type lectins on dendritic cells. Trends Immunol. 23:480-485.

120 Dissous, C., Torpier, G., Duvaux-Miret, O., and Capron, A. 1990. Structural homology of tropomyosins from the human trematode Schistosoma mansoni and its intermediate host Biomphalaria glabrata. Mol.Biochem.Parasitol. 43:245-255.

121 Carvalho-Queiroz, C., Cook, R., Wang, C. C., Correa-Oliveira, R., Bailey, N. A., Egilmez, N. K., Mathiowitz, E., and LoVerde, P. T. 2004. Cross-reactivity of Schistosoma mansoni cytosolic superoxide dismutase, a protective vaccine candidate, with host superoxide dismutase and identification of parasite-specific B epitopes. Infect.Immun. 72:2635-2647.

122 Damian, R. T. 1989. Molecular mimicry: parasite evasion and host defense. Curr.Top.Microbiol.Immunol 145:101-115.

123 Maizels, R. M., Bundy, D. A., Selkirk, M. E., Smith, D. F., and Anderson, R. M. 1993. Immunological modulation and evasion by helminth parasites in human populations. Nature 365:797-805.

124 Pearce, E. J. and Sher, A. 1987. Mechanisms of immune evasion in schistosomiasis. Contrib.Microbiol.Immunol 8:219-232.

125 Cheever, A. W., Hoffmann, K. F., and Wynn, T. A. 2000. Immunopathology of schistosomiasis mansoni in mice and men. Immunol Today 21:465-466.

126 Amiri, P., Locksley, R. M., Parslow, T. G., Sadick, M., Rector, E., Ritter, D., and McKerrow, J. H. 1992. Tumour necrosis factor alpha restores granulomas and induces parasite egg-laying in schistosome-infected SCID mice. Nature 356:604-607.

127 Dunne, D. W. and Doenhoff, M. J. 1983. Schistosoma mansoni egg antigens and hepatocyte damage in infected T cell-deprived mice. Contrib.Microbiol.Immunol 7:22-29.

128 Zaccone, P., Fehervari, Z., Jones, F. M., Sidobre, S., Kronenberg, M., Dunne, D. W., and Cooke, A. 2003. Schistosoma mansoni antigens modulate the activity of the innate immune response and prevent onset of type 1 diabetes. Eur.J Immunol 33:1439-1449.

129 MacDonald, A. S., Straw, A. D., Bauman, B., and Pearce, E. J. 2001. CD8- dendritic cell activation status plays an integral role in influencing Th2 response development. J Immunol 167:1982-1988.

130 Kane, C. M., Cervi, L., Sun, J., McKee, A. S., Masek, K. S., Shapira, S., Hunter, C. A., and Pearce, E. J. 2004. Helminth antigens modulate TLR-initiated dendritic cell activation. J Immunol 173:7454-7461.

131 Faveeuw, C., Mallevaey, T., Paschinger, K., Wilson, I. B., Fontaine, J., Mollicone, R., Oriol, R., Altmann, F., Lerouge, P., Capron, M., and Trottein, F. 2003. Schistosome N-glycans containing core alpha 3-fucose and core beta 2-xylose epitopes are strong inducers of Th2 responses in mice. Eur.J Immunol 33:1271-1281.

132 van den Berg, T. K., Honing, H., Franke, N., van Remoortere, A., Schiphorst, W. E., Liu, F. T., Deelder, A. M., Cummings, R. D., Hokke, C. H., and van, D., I 2004. LacdiNAc-glycans

Chapter 1 _

44

constitute a parasite pattern for galectin-3-mediated immune recognition. J Immunol 173:1902-1907.

133 Meyer, S., van Liempt, E., Imberty, A., Van Kooyk, Y., Geyer, H., Geyer, R., and van, D., I 2005. DC-SIGN mediates binding of dendritic cells to authentic pseudo-LewisY glycolipids of Schistosoma mansoni cercariae, the first parasite-specific ligand of DC-SIGN. J Biol.Chem. 280:37349-37359.

134 van Liempt, E., Bank, C. M., Metha P, Garcia Vallejo, J. J., Kawar ZS, Geyer, R., Alvarez, R., Cummings, R. D., Van Kooyk, Y., and van Die, I. 2006. Specificity of DC-SIGN for mannose- and fucose-containing glycans. FEBS Lett. 580:6123-6131.

Specificity of DC-SIGN for mannose- and fucose-containing glycans

Ellis van Liempt, Christine M.C. Bank, Padmaja Mehta, Juan Jesús

García-Vallejo, Ziad S. Kawar, Rudolf Geyer, Richard A. Alvarez, Richard

D. Cummings, Yvette van Kooyk and Irma van Die

FEBS Letters 2006; 580; 6123-6131

Chapter 2


47

Abstract

The dendritic cell specific C-type lectin dendritic cell specific ICAM_ grabbing non-

integrin (DC-SIGN) binds to “self” glycan ligands found on human cells and to

“foreign” glycans of bacterial or parasitic pathogens. Here, we investigated the

binding properties of DC-SIGN to a large array of potential ligands in a glycan array

format. Our data indicate that DC-SIGN binds with Kd < 2 μM to a neoglycoconjugate

in which Galβ1-4(Fucα1-3)GlcNAc (Lex) trisaccharides are expressed multivalently. A

lower selective binding was observed to oligomannose-type N-glycans, diantennary

N-glycans expressing Lex and GalNAcβ1-4(Fucα1-3)GlcNAc (Lac-di-Nac-fucose),

whereas no binding was observed to N-glycans expressing core-fucose linked either

α1-6 or α1-3 to the Asn-linked GlcNAc of N-glycans. These results demonstrate that

DC-SIGN is selective in its recognition of specific types of fucosylated glycans and

subsets of oligomannose- and complex-type N-glycans.

Chapter 2 _

48

Introduction

The innate immune system provides the first line of defense by detecting the

immediate presence of pathogens and determining the nature of subsequent immune

events. Recognition of invading pathogens by macrophages and dendritic cells (DCs)

is mediated by pattern-recognition receptors (PRR), including Toll-like Receptors (1)

and C-type lectins (2). C-type lectins bind carbohydrates in a Ca2+-dependent

manner, using conserved carbohydrate recognition domains (CRDs). The binding of a

glycan to the CRD may depend on more than one monosaccharide and on subtle

differences in the spatial arrangements of these monosaccharides. C-type lectins

containing CRDs with similar monosaccharide selectivity can also bind their ligands

in distinct ways. In addition, oligomerization of CRD domains may alter the affinity

and specificity of binding. The differential expression of many different (C-type)

lectins in combination with their binding properties, thus create unique sets of

carbohydrate recognition profiles on DCs (3;4).

DC-SIGN (Dendritic Cell-Specific ICAM-3-Grabbing Non-integrin; CD209), is a type

II transmembrane C-type lectin with a single C-terminal CRD (5). The CRD is

separated from the transmembrane region by a neck domain that is thought to affect

the formation of oligomers (6). DC-SIGN binds to “self” glycan ligands found on

human cells (7;8) as well as to “foreign” glycans derived from bacterial or parasitic

pathogens (9-11). The results from several studies using recombinant or cell surface

expressed DC-SIGN, indicate that DC-SIGN typically recognizes at least two classes

of glycans, mannose rich, and fucosylated glycans (9, 12-14). To increase our

understanding of the function of DC-SIGN, we report here a detailed and (semi-)

quantitative characterization of the glycan binding specificity and properties of DC-

SIGN-Fc to more than 100 glycans, including several complex-type N-linked glycans

not tested previously.

Materials and methods

Antibodies and cells. Anti-core fucose polyclonal antibodies were obtained as

described previously (15). The monoclonal antibody (mAb) G8G12 recognizes Lex

(16), mAb SMLDN1.1 recognizes GalNAcβ1-4GlcNAc (Lac-di-Nac, LDN) (17) and

mAb SMFG4.1 binds GalNAcβ1-4(Fucα1-3)GlcNAc (Lac-di-Nac-fucose, LDNF)


49

glycan antigens (11). DC-SIGN-Fc has been described previously (18). Chinese

hamster ovary (CHO) cells were cultured in RPMI-1640 (Gibco, BRL, USA) with 10%

FCS (BioWithaker, Verviers, Belgium) 100 units/ml penicillin and 100 μg/ml

streptomycin (Pen/Strep). CHO cells stably expressing the Polyoma virus large T

antigen (CHOP2) were kindly provided by Dr. James Dennis (Toronto, Canada) (19).

CHOP2 cells are deficient in sialic acid transport, resulting in >90% reduction in

sialic acid content (20). CHOP8 cells derived from CHO glycosylation mutant Lec8

are defective in UDP-galactose transport, resulting in truncated glycans without

galactose (21). CHO PIR-P3 cells, were kindly provided by Dr. Mark Lehrman (Dallas,

Texas) (22). Lec8 cells stably transfected with Caenorhabditis elegans β1-4-N-

acetylgalactosaminyltransferase (β1-4GalNAcT) expressing poly-LDN glycans, and

Lec8 cells stable transfected with β1-4GalNAcT and fucosyltransferase IX (FUT 9),

expressing poly-LDNF glycans, have been described previously (23). Where

indicated, cells were cultured during 5 days in the presence of the α-mannosidase-I

inhibitor kifunensine (2 μg/ml; Calbiochem, USA). Efficiency of treatment was

assessed by flow cytometry analysis using Concanavalin A AlexaFluor-488 (Molecular

probes, Inc., Eugene, OR).

Transient transfection and flow cytometry. Cells were incubated until 50-80%

confluency. Transfection was performed according to the manufacturer’s protocol. In

short, both DNA and LipofectAMINE (Invitrogen, Carlsbad, CA) were diluted in

serum-free medium and combined to allow DNA-liposome complexes to form and

subsequently added to the cells. After 24 h the medium was replaced with fresh,

complete medium. Forty-eight hours after transfection cells were used for flow

cytometry (FACSscan, BD Pharmingen, San Diego, CA) to detect binding of anti-

glycan antibodies and DC-SIGN-Fc in TSM (20 mM Tris HCl pH 7.4, containing 150

mM NaCl, 2mM CaCl2 and 2mM MgCl2) with 0.5% BSA (TSA), using FITC or

AlexaFluor-conjugated anti-human or anti-mouse secondary antibodies.

Glycosidase treatment of cell-lysates, SDS-PAGE and Western Blotting. Cells were

lysed in 50mM Tris-HCl pH 7.4, containing 0.1% sodium dodecyl sulfate (SDS) and

protease inhibitors. Where indicated lyophilised lysates were treated by

endoglycosidase H (EndoH, recombinant Escherichia coli, Boehringer, Mannheim

GmbH, Germany) or α-mannosidase (from Jack Beans, Sigma-Aldrich, St Louis, MO)

Chapter 2 _

50

according to the manufacturer’s protocol. The proteins within the lysates were

separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on 12.5 % gels,

using the Mini-Protean III system (Biorad, Hercules, CA) and blotted onto a

nitrocellulose membrane (Schleicher and Schuell, Bioscience Inc, Dassel, Germany).

After blocking the membrane with 5 % BSA (Fluka Biochemica) in TSM, the blots

were incubated with DC-SIGN-Fc (5 μg/ml) in TSA, washed in TSM containing 0.1 %

Tween-20 (ICN Biomedicals Inc., Aurora, Ohio) and incubated with peroxidase-

labeled goat-anti-human IgG-Fc (Jackson, West Grove, PA). Bound DC-SIGN-Fc was

detected by measuring chemiluminescence, using Supersignal WestPico

Chemiluminescence substrate (Pierce, Rockford, IL), in an Epi Chemi II Darkroom

(UVP bioimaging systems, Upland, CA) and Labworks Software (UVP, USA).

Fluorescence solid phase glycan array. Streptavidin-coated high binding capacity

black plates (Pierce, Rockford, IL) were washed three times with 200 μl TSM and

coated at saturating densities with biotinylated oligosaccharides, glycopeptides or

polyacrylamide (PAA) coupled glycoconjugates (~20% substitution, Lectinity,

Lappeenranta, Finland) in TSA. After washing with TSM, purified DC-SIGN-Fc (5

μg/ml in TSA) or an antiglycan antibody (to determine coating efficiency) was added.

Bound DC-SIGN-Fc was detected after incubation with AlexaFluor-488 goat anti-

human- or mouse-IgG (5 μg/ml; Molecular Probes) by measuring fluorescence

(FluoStar, BMG Labtech GmbH, Offenburg, Germany). The assays were performed in

triplicate and background fluorescence was subtracted from each sample. The glycan

array screening (ELISA-based) was performed by Core H of the Consortium of

Functional Glycomics. The array used was Version 1.1.a. containing glycan structures

with the CFG numbers (#) 1-89, as described in supplemental data of Bochner et al.,

(24). In addition, a secondary screening was performed with in addition glycans with

the CFG # 112, 114, 129-132, 185 and 186, which are described in supplemental data

by Coombs et al., (25) . The structure Bi-Lex was synthesized starting with

desialylated human transferrin, which was fucosylated using recombinant

fucosyltransferase VI (Calbiochem, Germany) and GDP-fucose. All used glycan

structures and their CFG numbers, as well as standard procedures for glycan array

testing by the Consortium for Functional Glycomics are available at

http://web.mit.edu/glycomics/consortium.


51

Surface plasmon resonance. All surface plasmon resonance (SPR) experiments were

performed at 25ºC on a Biacore 3000 instrument (Biacore Inc., Piscataway, NJ). The

running buffer used was TSM containing 0.005 % Tween20. Biotinylated glycans

were captured on research grade streptavidin-coated sensor chips (Sensor Chip SA,

Biacore Inc.) that were pretreated with three 1 min infusions of 1M NaCl in 50 mM

NaOH. A 10 fmol/μl solution of each biotinylated glycan was injected at 2 μl/min for

7.5 min to capture each glycan on an independent surface. In total, 3 different glycans

and a control (non-binding) glycan, were studied using one SA sensor chip. Specific

binding of DC-SIGN-Fc to the test glycans was measured using the in-line reference

subtraction feature of the Biacore 3000 instrument. Increasing concentrations of DC-

SIGN-Fc were injected at a flow-rate of 35 μl/min over all four surfaces of the sensor

chip. The equilibrium binding data of DC-SIGN-Fc were analysed by non-linear curve

fitting of the Langmuir binding isotherm using the BIAevaluation software (Biacore

Inc., Piscataway, NJ).

Results

Analysis of the glycan-binding specificity of DC-SIGN-Fc by glycan array screening.

Binding of the chimeric DC-SIGN-Fc to a total of 100 different glycan structures was

analyzed using glycan-array technology. In these arrays, similar amounts of

individual biotinylated glycans or glycopeptides were immobilized on streptavidin-

coated plates, allowing semi-quantitative binding analysis (Consortium for

Functional Glycomics). The consolidated data of the glycan array are shown in Figure

1. DC-SIGN-Fc binds to N-linked oligomannose with the highest apparent affinity for

the structure Man9GlcNAc2, and decreasing binding apparent affinity as the number

of mannoses decreases, as shown in Figure 1A. DC-SIGN-Fc shows binding to several

fucosylated glycans. Of the glycans tested, Lewis b (Fucα1-2Galβ1-3(Fucα1-

4)GlcNAcβ; Leb) shows the highest relative binding, followed by Lewis y (Fucα1-

2Galβ1-4(Fucα1-3)GlcNAcβ; Ley) and Lewis a (Galβ1-3(Fucα1-4)GlcNAcβ; Lea). The

trisaccharides Lewis x (Galβ1-4(Fucα1-3)GlcNAcβ;Lex) and LDNF (GalNAcβ1-

4(Fucα1,3)GlcNAc) are bound slightly less efficiently, however diantennary N-glycans

containing these epitopes (bi-Lex and bi-LDNF) show a 4-fold increase in binding of

DC-SIGN-Fc over the terminal trisaccharides alone (Figure 1B). The α1-6 core-

fucosylated Man3GlcNAc2 is not bound by DC-SIGN. From these results it can be

Chapter 2 _

52

concluded that presentation of DC-SIGN glycan ligands, such as Lex or LDNF, within

a diantennary N-glycan clearly enhances binding as compared to the individual

glycan determinants.

Figure 1. Consolidated data of glycan array. A glycan array was probed with DC-SIGN-Fc (5 μg/ml). After subtraction of the background signal, the level of fluorescence for each sample was determined by taking the average ± standard deviation of three wells tested. NC, negative control (biotinylated spacer). A) Binding of DC-SIGN-Fc to oligomannose-type N-glycans. B) Consolidated data of the glycan array. A Schematic representation is given of the carbohydrate structure, the common name, the signal/noise ratio (S/N) and the relative binding affinity, calculated as relative to the glycan with highest binding (bi-LDNF). A relative binding of 10% or lower was considered as background based on the values of the negative controls.


53

Binding of DC-SIGN-Fc to multivalent neoglycoconjugates

The binding of DC-SIGN to multivalent glycans was tested in a similar solid phase

assay by using biotinylated polyacrylamide (PAA) that is modified to contain

monosaccharides or fucose- or mannose-containing glycans. By titrating DC-SIGN-Fc

in the binding assays, the IC50 was established, with the IC50 being the

concentration that shows 50 % of the maximal binding to the different PAA-

neoglycoconjugates. Figure 2A shows the titration curves for some of the glycans

tested. Based on their binding properties, the PAA-linked glycans tested in this assay

can be divided into four groups (Figure 2B). The first group contains

neoglycoconjugates carrying Lea or Leb, which show binding even when low

concentrations DC-SIGN-Fc are used (IC50 between 2 and 4 μg/ml).

Neoglycoconjugates containing Lex, Ley, 6-sulfo-Lea and mannotriose

(Manα1,3(Manα1,6)Man) showed binding at intermediate DC-SIGN concentrations

(IC50 between 5 -6 μg/ml), whereas H-type-2 antigen (Fucα1-2Galβ1-4GlcNAc) and

α-L-fucose, showed only a low binding when high DC-SIGN-Fc concentrations were

used (IC 50 between 8 and 15 μg/ml). The last group consists of neoglycoconjugates

carrying sialyl-Lex, 6-sulfo-Lex and α-D-mannose, which were not bound by DC-

SIGN-Fc (Figure 2B).

DC-SIGN binds to glycan epitopes on the surface of cells

To study the binding of DC-SIGN to cell-surface expressed glycoconjugates, which

more likely represents the natural presentation, the binding capacity of recombinant

DC-SIGN-Fc to CHO cells and CHO-glycosylation mutants was determined by FACS

analysis. The results show that DC-SIGN-Fc does not bind to wild-type CHO cells or

to CHOP2 cells (CHO cells that carry glycans lacking sialic acid) (Figure 3). By

contrast, low binding was observed to CHOP8 cells, CHO cells that are deficient in

UDP-galactose transport due to a lec8 mutation (Figure 3) (21). These cells express

N-glycans with terminal GlcNAc, and truncated O-glycans with terminal GalNAc (Tn

antigen). The glycan-array studies described above, as well as previous studies of

others, have shown that oligomannose-type N-glycans are recognized by DC-SIGN in

vitro (6, 26-28). To analyze the binding of DC-SIGN to whole cells carrying

oligomannose-type N-glycans on glycoproteins, we cultured CHOP2 cells in the

presence of kifunensine, an inhibitor of α-mannosidase I, which causes expression of

mainly Man9GlcNAc2. DC-SIGN-Fc binds very well to CHOP2 cells cultured with

Chapter 2 _

54

kifunensine, suggesting that oligomannose-type N-glycans on cell-surface expressed

proteins are recognized ligands within the context of cellular expression (Figure 3).

Figure 2. Binding of DC-SIGN-Fc to multivalent neoglycoconjugates. A) A quantitative fluorescent solid phase assay was performed with different PAA-biotinylated glycoconjugates (1 μg/ml) coated on a streptavidin coated high binding capacity black plate. DC-SIGN-Fc was titrated on to the plate (ranging from 0 to 15 μg/ml) and detected with goat anti-human Alexa Fluor-488-labeled. Samples were tested in triplicate and the average is shown as relative fluorescence units (RFU). One representative experiment out of three is shown. B) The concentration of DC-SIGN-Fc that shows 50% of the maximal binding (IC50) was determined. ND means that the IC50 could not be determined.


55

Figure 3. Binding capacity of DC-SIGN-Fc to CHO glycosylation mutants. In the left panel, the black histogram shows the binding of DC-SIGN-Fc (goat anti-human Alexa Fluor) to these cells and the middle panel shows whether the binding is Ca2+-dependent (binding in the presence of EDTA). In grey non-stained cells are shown. In the last panel a typical N-glycan structure for each cell-line is shown. One representative experiment out of three is shown.

To investigate whether the binding of DC-SIGN-Fc to CHOP2 cells cultured in the

presence of kifunensine was indeed dependent on binding to the oligomannose-type

glycans, the cells were lysed and proteins were separated by SDS-page followed by

Western blotting and binding of DC-SIGN-Fc was detected. No binding of DC-SIGN-

Fc to CHOP2 cells was observed on Western blots. Analysis of the binding of DC-

SIGN-Fc to kifunensine-treated CHOP2 cells revealed binding to a wide array of

glycoproteins with apparent Mr between 70 –120 kD (Figure 4). Treatment of the

cell-lysate with endoglycosidase H, an enzyme that removes oligomannose-type

glycans, or alternatively with α-mannosidase, that cleaves terminal α-linked mannose

residues, abolished binding of DC-SIGN-Fc completely (Figure 4, data not shown).

This indicates that the oligomannose-type glycans in the cell-lysate are the ligands of

DC-SIGN. CHO-cells PIR-P3, which are resistant to the plant lectin Phaseolus

vulgaris erythroagglutinin primarily express N-glycans of the Man3GlcNAc2 type (70-

75%) (22). DC-SIGN-Fc bound well to these CHO PIR-P3 cells, which can be blocked

by EDTA, indicating that the binding is Ca2+-dependent as would be expected (Figure

3). In conclusion, whereas DC-SIGN-Fc does not bind to wild-type CHO cells or

CHOP2 cells, it binds to both oligomannose-type N-linked glycans or N-glycans with

the structure Man3GlcNAc2 on the cell surface.

Chapter 2 _

56

Figure 4. Binding of DC-SIGN-Fc to CHOP2 cells cultured with kifunensine on Western blot. Cell-lysates were made of CHOP2 cells cultured with or without kifunensine. Cell-lysates were treated with endoglycosidases as indicated. The proteins of the lysate were separated by SDS-PAGE and transferred to a membrane for Western blotting. The binding of DC-SIGN-Fc to CHOP2 cells cultured with kifunensine was abolished after treatment with Endo H, indicating that DC-SIGN-Fc binds to oligomannose-type glycans expressed by CHOP2 cells.

Transfection of specific glycosyltransferases can induce the expression of DC-SIGN

ligands on CHOP2 cells

To modify the cellular glycans expressed by CHOP2 cells, the cells were transiently

transfected with different glycosyltransferase cDNAs and the binding of DC-SIGN-Fc

to these cells was analyzed. CHOP2 cells were transfected with the cDNA of human

fucosyltransferase IV (FUT IV) (29) and Arabidopsis thaliana core α1-3fucosyltrans-

ferase (C3FT) (30), respectively. The expression of the induced glycan antigens and

the binding of DC-SIGN-Fc were determined by FACS analysis. FUT-IV adds a fucose

in an α1-3 linkage to Galβ1-4GlcNAc, generating the Lex epitope (Figure 5). Using an

anti-Lex antibody it was demonstrated that 35% of the cell population following

transfection carried the Lex epitope. DC-SIGN-Fc binds to the CHOP2 cell fraction

expressing FUT-IV (Figure 5). CFT3 adds a fucose in α1−3 linkage to the Asn-linked

GlcNAc of N-glycans, thus forming a highly immunogenic glycan epitope such as

found in plant- and insect allergens, as well as in parasitic helminthes (15). FACS-

analysis clearly showed that the core α1-3fucose is present in 30% of the cells,

reflecting the transfected population, however no binding of DC-SIGN-Fc could be

detected (Figure 5). To analyze the binding of DC-SIGN to LDNF-containing

glycoproteins expressed on the surface of cells, stably transfected CHO cells

expressing either poly-LDN or poly-LDNF glycans (23) were tested for their ability to

bind DC-SIGN-Fc. CHO cells expressing poly-LDNF glycans showed strong binding

of DC-SIGN-Fc (Figure 5) in a Ca2+-dependent manner, whereas no binding of DC-

SIGN-Fc was detected to CHO cells expressing poly-LDN. These results demonstrate


57

that DC-SIGN binds to Lex-expressing and LDNF-expressing glycans on cell surfaces

but not to surface glycans lacking these epitopes in CHO cells.

Figure 5. The binding capacity of DC-SIGN-Fc to CHOP2 cells transfected with glycosyltransferases. The binding of DC-SIGN-Fc to CHOP2 cells transfected with cDNAs of glycosyltransferases was analyzed by flow cytometry. In the left panel, the binding to DC-SIGN-Fc (secondary antibody goat-anti human Alexa Fluor 488) is shown in black and non-stained cells are shown as grey lines. In the second panel, the expression was determined by staining the cells with a specific anti-glycan-antibody (goat-anti mouse Alexa Fluor 488). The parental CHO cells are all negative in staining with the anti-glycan antibodies (results not shown). The second and third rows indicate CHOP2 cells that are transiently transfected with cDNAs encoding for, respectively, FUT VI and core α1-3-fucosyltransferase (CFT3), resulting in approx. 35% of the cells being transfected. The fourth (poly-LDN) and fifth row (poly-LDNF) show stably transfected cells (100 % of the cells expressing the glycosyltransferases). In the right panel a typical N-glycan structure for each cell is depicted. The arrows indicate the monosaccharides added by the different glycosyltransferases. Cells were gated on forward and side scatter and the mean fluorescence of one representative experiment out of three is shown.

Affinity of DC-SIGN-Fc binding

The binding affinities of DC-SIGN-Fc for Man8GlcNAc2, bi-LDNF and Lex-PAA

biotinylated neoglycoconjugates were determined by Surface Plasmon Resonance

(SPR) using a streptavidin-coated sensor chip. Bi-LDN was captured on one surface

of the sensor chip and used as negative control. DC-SIGN-Fc showed specific binding

to all three glycans tested (Figure 6A). The sensorgram shows that upon injection, the

binding of DC-SIGN-Fc to Lex-PAA neoglycoconjugate slowly reached equilibrium

and the bound DC-SIGN-Fc slowly dissociated after injection was stopped. By

Chapter 2 _

58

contrast, DC-SIGN-Fc binding to Man8GlcNAc2 and bi-LDNF rapidly reached

equilibrium in the first few seconds after injection, and fast dissociation of the bound

DC-SIGN-Fc was observed. The apparent dissociation constant (Kd) for DC-SIGN-Fc

to the three test glycans was determined in triplicate by varying the concentration of

DC-SIGN-Fc from 0 – 12 μM. For Lex-PAA the apparent Kd is 1.74 μM (Figure 6B),

whereas the apparent Kd to Man8GlcNAc2 and bi-LDNF is at least 2 times lower than

the Kd measured for Lex-PAA neoglycoconjugate (results not shown).

Figure 6. Binding of DC-SIGN-Fc to bi-LDNF, Man8GlcNAc2 and Lex-PAA as assessed by Surface Plasmon Resonance (SPR) A) Specific binding is shown of DC-SIGN-Fc to bi-LDNF, Man8GlcNAc2 and Lex-PAA. The SPR-response (in resonance units) versus time (in seconds) is shown using 6 μM DC-SIGN-Fc. B) Affinity of DC-SIGN-Fc binding to Lex-PAA as measured by SPR. The equilibrium SPR response is plotted versus the DC-SIGN-Fc concentration, using DC-SIGN-Fc concentrations of 0 – 12 μM. The data were analyzed by non-linear curve fitting and one representative experiment out of four is shown.


59

Discussion

Recent evidence indicates that dendritic cell associated DC-SIGN may have a dual

function in the induction of tolerance to self-antigens and recognition of pathogens,

respectively. Because the function of dendritic cells may be dependent on their

binding properties to self-antigens and pathogens, it is essential to obtain detailed

insight in the carbohydrate-binding properties of DC-SIGN. In this report, we

describe the glycan-binding profile of DC-SIGN by determining its binding properties

to a library of glycan structures and glycopeptides on a glycan array, as well as to

glycans expressed multivalently, and cell-surface expressed glycans. For these studies

we used an Ig fusion protein, DC-SIGN-Fc, which has a binding site on each arm of

the IgG chimera, and is therefore bivalent (18). Using glycan arrays assembled by the

Consortium for Functional Glycomics, we showed that DC-SIGN-Fc interacts with

various α1-3 and α1-4 fucosylated tri- and tetrasaccharides, such as the monovalent

Lewis antigens and LDNF, and with increased affinity to mannose type N-glycans

carrying 5 – 9 mannose residues and diantennary glycans comprising a Lex or LDNF

antigen within each of the branches. Although some slight differences are seen, the

general conclusion is that the binding properties of DC-SIGN-Fc are very similar to

those of the renatured tetramer of DC-SIGN, as reported recently by Guo et al. (13).

In previous studies we already demonstrated that bivalent DC-SIGN-Fc and natural,

cell-surface expressed DC-SIGN that is understood to be tetrameric (31, 28), show

very similar binding properties (9, 14). Together, these data indicate that DC-SIGN-

Fc is a reliable tool to study the binding properties of DC-SIGN to its glycan ligands.

Using extended glycan arrays from the Consortium of Functional Glycomics and

cellular adhesion assays, we show here for the first time that DC-SIGN is able to bind

LDNF present within N-glycans. The difference in structure between Lex and LDNF is

the N-acetyl group of the GalNAc residue in LDNF. Apparently, this additional N-

acetyl group does not interfere with DC-SIGN binding, similar to the situation in Ley

where an additional fucose occurs that is linked to the 2 position of Gal (14).

However, in contrast to the situation for Lewis structures or LDNF, DC-SIGN is

highly specific for the nature of the glycans expressing Fucα1-3GlcNAc moieties,

since it does not bind to that structure when it is part of the core structure of an N-

glycan. This may be due to the lack of a GlcNAc linked Gal or GalNAc that contributes

to the binding to the CRD domain of DC-SIGN and/or spatial interference of the

Chapter 2 _

60

distal aspects of the N-glycan (13, 14). This lack of binding to core α1-3-fucose

residues indicates that DC-SIGN is not directly involved in the induction of immune

responses to this glycan epitope or glycotope that have been demonstrated to occur in

plant- and insect induced allergies (32).

The glycan array data indicate that a 4-fold increase in binding affinity of DC-SIGN-

Fc was found towards a diantennary N-glycan containing Lex (bi-Lex) and a

diantennary N-glycan containing LDNF (bi-LDNF), compared to the respective

trisaccharide determinants. Considering the bivalent nature of DC-SIGN-Fc it would

in principle be possible that the two binding sites on each arm of the IgG chimera

associate and dissociate from the two Lex/LDNF units of the diantennary glycan with

the same binding parameters. To test if a multivalent presentation would increase the

affinity even further, we used SPR to analyze the specificity and affinity of the binding

of DC-SIGN-Fc to a neoglycoconjugate where Lex is coupled multivalently to

polyacrylamide (Lex-PAA), and compared the binding properties to those towards bi-

LDNF and the oligomannose-type glycan Man8GlcNAc2. The SPR data show that

binding of DC-SIGN-Fc to all three ligands is specific. By analysis of the DC-SIGN-Fc

data for equilibrium binding responses, an apparent Kd of 1.7 μM was found towards

Lex-PAA, whereas the apparent Kd for Man8GlcNAc2 and bi-LDNF was at least 5 μM.

Whereas these experiments give insight in the affinity range of DC-SIGN binding to

its ligands, it should be noted that the data cannot directly be compared

quantitatively, since the polyvalent nature of the ligand Lex-PAA will introduce

avidity effects, whereas Man8GlcNAc2 is a monovalent ligand by contrast. In

addition, and in contrast to the binding pattern to Lex-PAA and Man8GlcNAc2, we

could not determine a consistent binding pattern of DC-SIGN-Fc to bi-LDNF by SPR.

It may be that both DC-SIGN subunits differentially interact with the bi-LDNF

structure because the spacing or orientation of both branches does not allow proper

bivalent binding to both LDNF units.

The affinity of DC-SIGN binding in the low μM range (2 - 10 μM) to its glycan ligands

is in the same range to those found for other mammalian lectins of biological

importance. For example, both Siglec 8 and galectin 1 bind to their respective ligands

with apparent Kd ~ 2-4 μM (24, 33). In vivo, we propose that a high degree of glycan

binding can be achieved through tetramerisation of DC-SIGN at the cell surface (31,


61

28), which for example facilitates binding to oligomannose glycans as found on HIV-1

(34). In addition, other pathogens are strongly recognized by DC-SIGN, which is

likely to occur by combining an intermediate affinity with varying avidity effects, such

as Schistosoma mansoni that expresses both Lex and LDNF antigens (35). We show

here that DC-SIGN-Fc strongly binds to mammalian cells engineered to express N-

glycans carrying antennae with repeating LDNF units (23) structures that are indeed

found within Schistosoma mansoni worms (36). These LDNF-expressing

glycoproteins as well as Lex and pseudo-Ley expressing glycoproteins and/or

glycolipids found in schistosomes are expected to be targets of humoral and cellular

immune reponses during schistosome infection, in which DC-SIGN might play an

important role (10, 11).

It is becoming increasingly clear that an important aspect of DC-SIGN binding may

also be provided by its potential to bind with high avidity to glycan ligands that are

bound with very low relative affinity in their monovalent context. In the glycan array,

we showed that DC-SIGN-Fc has no significant affinity to truncated N-glycans

(Manα1-3(Manα1-6)Manβ1-2GlcNAcβ1-4GlcNAc-R, Man3). However significant DC-

SIGN-Fc binding was observed to glycosylation mutant cells expressing mainly

Man3GlcNAc2 on their cell-surface, or to Manα1-3(Manα1-6)Man linked to PAA.

Similar observations were obtained with H-type 2 glycans, carrying a α1-2-linked

fucose. Interestingly, it was recently reported that a Neisseria meningitides LPS

oligosaccharide mutant IgtB, which expresses GlcNAcβ1-3Galβ1-4-Glc-R outer core

units, targets dendritic cells through DC-SIGN, thereby mediating highly efficient

bacterial uptake and skewing of the immune response into a TH1 direction (37).

Although our current glycan array data do not reveal GlcNAc as a ligand for DC-SIGN

(13), we show here that DC-SIGN-Fc exhibits binding to the CHO glycosylation

mutant Lec8 that expresses N-glycans carrying a terminal GlcNAc on its cell-surface.

These data suggest that DC-SIGN may bind to terminal GlcNAc residues when they

are presented at high density. Since a high density of repeating glycan moieties is

generally lacking on mammalian cell surfaces or glycoproteins, this feature of DC-

SIGN binding through avidity and possibly clustering of DC-SIGN on the cell surface

(31) may be of particular importance for pathogen recognition.

Chapter 2 _

62

Our data show that DC-SIGN can bind various ligands in different ways, which may

have consequences for how the pathogen or antigen is processed by DCs. Many

pathogens exploit self-glycans or glycans that specifically target C-type lectins

including DC-SIGN to direct the immune response in favor of their own survival and

thus evade host immunity (38). The detailed dissection of molecular interactions

between DC lectins and its glycan ligands as described here will, facilitate future

studies to clarify the role of these lectins in modulation of dendritic cell functions.

References

1. Thoma-Uszynski, S., Stenger, S., Takeuchi, O., Ochoa, M. T., Engele, M., Sieling, P. A.,

Barnes, P. F., Rollinghoff, M., Bolcskei, P. L., Wagner, M., Akira, S., Norgard, M. V., Belisle, J. T., Godowski, P. J., Bloom, B. R., and Modlin, R. L.,Science.23-2-2001.291:1544-1547.

2. Weis, W. I., Taylor, M. E., and Drickamer, K.,Immunol. Rev.1998.163:19-34. 3. Figdor, C. G., van Kooyk, Y., and Adema, G. J.,Nat. Rev. Immunol.2002.2:77-84. 4. Weis, W. I. and Drickamer, K.,Annu. Rev. Biochem.1996.65:441-473. 5. Geijtenbeek, T. B., Torensma, R., Van Vliet, S. J., van Duijnhoven, G. C., Adema, G. J., van

Kooyk, Y., and Figdor, C. G.,Cell.3-3-2000.100:575-585. 6. Feinberg, H., Mitchell, D. A., Drickamer, K., and Weis, W. I.,Science.7-12-2001.294:2163-

2166. 7. Geijtenbeek, T. B., Kwon, D. S., Torensma, R., Van Vliet, S. J., van Duijnhoven, G. C.,

Middel, J., Cornelissen, I. L., Nottet, H. S., KewalRamani, V. N., Littman, D. R., Figdor, C. G., and van Kooyk, Y.,Cell.3-3-2000.100:587-597.

8. van Gisbergen, K. P., Sanchez-Hernandez, M., Geijtenbeek, T. B., and van Kooyk, Y.,J. Exp. Med.18-4-2005.201:1281-1292.

9. Appelmelk, B. J., Van, Die, I, Van Vliet, S. J., Vandenbroucke-Grauls, C. M., Geijtenbeek, T. B., and van Kooyk, Y.,J. Immunol.15-2-2003.170:1635-1639.

10. Meyer, S., Van Liempt, E., Imberty, A., van Kooyk, Y., Geyer, H., Geyer, R., and Van, Die, I,J. Biol. Chem.11-11-2005.280:37349-37359.

11. Van Die, I, Van Vliet, S. J., Nyame, A. K., Cummings, R. D., Bank, C. M., Appelmelk, B., Geijtenbeek, T. B., and van Kooyk, Y.,Glycobiology.2003.13:471-478.

12. Blixt, O., Head, S., Mondala, T., Scanlan, C., Huflejt, M. E., Alvarez, R., Bryan, M. C., Fazio, F., Calarese, D., Stevens, J., Razi, N., Stevens, D. J., Skehel, J. J., Van, Die, I, Burton, D. R., Wilson, I. A., Cummings, R., Bovin, N., Wong, C. H., and Paulson, J. C.,Proc. Natl. Acad. Sci. U. S. A.7-12-2004.101:17033-17038.

13. Guo, Y., Feinberg, H., Conroy, E., Mitchell, D. A., Alvarez, R., Blixt, O., Taylor, M. E., Weis, W. I., and Drickamer, K.,Nat. Struct. Mol. Biol.2004.11:591-598.

14. Van Liempt, E., Imberty, A., Bank, C. M., Van Vliet, S. J., van Kooyk, Y., Geijtenbeek, T. B., and Van, Die, I,J. Biol. Chem.6-8-2004.279:33161-33167.

15. Van Die, I, Gomord, V., Kooyman, F. N., van den Berg, T. K., Cummings, R. D., and Vervelde, L.,FEBS Lett.10-12-1999.463:189-193.

16. Wuhrer, M., Dennis, R. D., Doenhoff, M. J., Lochnit, G., and Geyer, R.,Glycobiology.2000.10:89-101.

17. Nyame, A. K., Leppanen, A. M., Bogitsh, B. J., and Cummings, R. D.,Exp. Parasitol.2000.96:202-212.

18. Geijtenbeek, T. B., van Duijnhoven, G. C., Van Vliet, S. J., Krieger, E., Vriend, G., Figdor, C. G., and van Kooyk, Y.,J. Biol. Chem.29-3-2002.277:11314-11320.

19. Heffernan, M. and Dennis, J. W.,Nucleic Acids Res.11-1-1991.19:85-92. 20. Deutscher, S. L., Nuwayhid, N., Stanley, P., Briles, E. I., and Hirschberg, C.

B.,Cell.1984.39:295-299. 21. Deutscher, S. L. and Hirschberg, C. B.,J. Biol. Chem.5-1-1986.261:96-100. 22. Zeng, Y. and Lehrman, M. A.,Anal. Biochem.2-3-1991.193:266-271.


63

23. Kawar, Z. S., Haslam, S. M., Morris, H. R., Dell, A., and Cummings, R. D.,J. Biol. Chem.1-4-2005.280:12810-12819.

24. Bochner, B. S., Alvarez, R. A., Mehta, P., Bovin, N. V., Blixt, O., White, J. R., and Schnaar, R. L.,J Biol. Chem.11-2-2005.280:4307-4312.

25. Coombs, P. J., Taylor, M. E., and Drickamer, K., (2006). Glycobiology 16, 1C-7C. 26. Drickamer, K.,Curr. Opin. Struct. Biol.1999.9:585-590. 27. Frison, N., Taylor, M. E., Soilleux, E., Bousser, M. T., Mayer, R., Monsigny, M., Drickamer,

K., and Roche, A. C.,J. Biol. Chem.27-6-2003.278:23922-23929. 28. Mitchell, D. A., Fadden, A. J., and Drickamer, K.,J. Biol. Chem.3-8-2001.276:28939-28945. 29. Lowe, J. B., Kukowska-Latallo, J. F., Nair, R. P., Larsen, R. D., Marks, R. M., Macher, B. A.,

Kelly, R. J., and Ernst, L. K.,J. Biol. Chem.15-9-1991.266:17467-17477. 30. Bakker, H., Schijlen, E., de Vries, T., Schiphorst, W. E., Jordi, W., Lommen, A., Bosch, D.,

and Van, Die, I,FEBS Lett.2-11-2001.507:307-312. 31. Cambi, A., de Lange, F., van Maarseveen, N. M., Nijhuis, M., Joosten, B., van Dijk, E. M., de

Bakker, B. I., Fransen, J. A., Bovee-Geurts, P. H., van Leeuwen, F. N., van Hulst, N. F., and Figdor, C. G.,J Cell Biol.5-1-2004.164:145-155.

32. van Ree, R., Cabanes-Macheteau, M., Akkerdaas, J., Milazzo, J. P., Loutelier-Bourhis, C., Rayon, C., Villalba, M., Koppelman, S., Aalberse, R., Rodriguez, R., Faye, L., and Lerouge, P.,J Biol. Chem.14-4-2000.275:11451-11458.

33. Leppanen, A., Stowell, S., Blixt, O., and Cummings, R. D.,J Biol. Chem.18-2-2005.280:5549-5562.

34. Bernhard, O. K., Lai, J., Wilkinson, J., Sheil, M. M., and Cunningham, A. L.,J. Biol. Chem.10-12-2004.279:51828-51835.

35. Van Die, I and Cummings, R. D.,Chem. Immunol Allergy.2006.90:91-112. 36. Wuhrer, M., Koeleman, C. A., Deelder, A. M., and Hokke, C. H.,FEBS J.2006.273:347-361. 37. Steeghs, L., Van Vliet, S. J., Uronen-Hansson, H., van Mourik, A., Engering, A., Sanchez-

Hernandez, M., Klein, N., Callard, R., van Putten, J. P., van der, Ley P., van Kooyk, Y., and van de Winkel, J. G.,Cell Microbiol.2006.8:316-325.

38. Engering, A., Geijtenbeek, T. B., and van Kooyk, Y.,Trends Immunol.2002.23:480-485.

Carbohydrate profiling reveals a distinctive role for the C-type lectin MGL in the recognition of helminth parasites and tumor antigens by dendritic cells

Sandra J. van Vliet, Ellis van Liempt, Eirikur Saeland, Corlien A.

Aarnoudse, Ben Appelmelk, Tatsuro Irimura, Teunis B.H. Geijtenbeek,

Ola Blixt, Richard Alvarez, Irma van Die and Yvette van Kooyk

International Immunology 2005; 17, 661-669.

Chapter 3

MGL recognition of terminal GalNAc residues

67

Abstract

Dendritic cells are key to the maintenance of peripheral tolerance to self-antigens and

the orchestration of an immune reaction to foreign antigens. C-type lectins, expressed

by dendritic cells, recognize carbohydrate moieties on antigens that can be

internalized for processing and presentation. Little is known about the exact glycan

structures on self-antigens and pathogens that are specifically recognized by the

different C-type lectins and how this interaction influences dendritic cell function. We

have analyzed the carbohydrate specificity of the human C-type lectin MGL using

glycan micro array profiling and identified an exclusive specificity for terminal α- and

β-linked GalNAc residues that naturally occur as parts of glycoproteins or

glycosphingolipids. Specific glycan structures containing terminal GalNAc moieties,

expressed by the human helminth parasite Schistosoma mansoni as well as tumor

antigens and a subset of gangliosides, were identified as ligands for MGL. Our results

indicate an endogenous function for dendritic cell expressed MGL in the clearance

and tolerance to self-gangliosides, and in the pattern recognition of tumor antigens

and foreign glycoproteins derived from helminth parasites.

Chapter 3 _

68

Introduction

Antigen presenting cells (APC), such as dendritic cells (DC) and macrophages (MØ)

are the key players in the initiation and control of innate and adaptive immune

responses. In order to perform their function both DC and MØ are equipped with a

full array of specialized receptors, including adhesion receptors, costimulatory

molecules and several pattern recognition receptors, such as C-type lectins and Toll-

like receptors (1).

Within the last few years several C-type lectins, which recognize specific carbohydrate

structures in a Ca2+-dependent manner, C-type lectin-like molecules and Selectins

have been identified on both DC and MØ, including DC-SIGN (2), Mannose Receptor,

Langerin, DEC205 and L-selectin (3). Specific glycosylation patterns regulate

leukocyte homing and trafficking processes within the immune system (4). Changes

in glycosylation can similarly control the interaction of DC with other cell types,

thereby modulating migration and immune responses (5). Most C-type lectins, with

the exception of DC-SIGN and Mannose Receptor, have been poorly characterized

with respect to their carbohydrate specificity and function within the immune system.

It has been postulated that C-type lectins function in cell-cell adhesion, antigen

recognition and serve as signaling molecules influencing the balance between

tolerance and immunity (6). C-type lectin stimulation can either enhance or inhibit

TLR signaling thereby modulating DC phenotype and outcome of immune responses

(7;8). The cytoplasmic tail of C-type lectins often contains signaling motifs or

internalization motifs for processing of antigens (9).

Predictions on carbohydrate specificities of C-type lectins for either Galactose-type or

Mannose-type glycans can be made based on the primary amino acid sequence.

However, knowledge on the exact carbohydrate recognition profile is essential to

understand the importance of these receptors in immune related functions. Studies

on carbohydrate recognition have long been hampered due to the complexity of

glycan synthesis and the limited availability of isolated or synthesized glycans.

Recognition of mannose- and fucose structures by DC-SIGN and Mannose Receptor

on DC has been widely investigated. However, studies on Galactose or GalNAc

recognition by DC are limited. One Galactose-type C- type lectin has been reported to

be expressed by human DC, namely the Macrophage Galactose-type lectin (MGL, also


69

called DC-ASGPR or HML) (10-12). MGL is a member of the type II family of C- type

lectins. MGL and is expressed on human and mouse immature DC and MØ in skin

and lymph node (13). No natural ligand or function for MGL has been established yet

(14). Mice contain two functional copies of the MGL gene, mMGL1 and mMGL2,

whereas in humans only one MGL gene is found. mMGL1 and mMGL2 have different

carbohydrate specificities for respectively Lewis X and α/β-GalNAc structures (15).

Earlier studies on COS-1 transfectants of MGL suggested a specificity for the

monosaccharides Galactose and GalNAc (16). In contrast, recombinant MGL

produced in a bacterial expression system displayed restricted binding to GalNAc

(17). The recognition of more complex oligosaccharides by human MGL has not been

thoroughly investigated yet.

To gain more insight in the function and carbohydrate specificity of MGL and

Galactose/GalNAc recognition by human DC we set out to identify the carbohydrate

recognition profile of human MGL using glycan microarray screening. The glycan

array was developed by the Consortium for Functional Glycomics

(http://web.mit.edu/glycomics/consortium) and consists of more than one hundred

synthetic and natural glycan structures. The use of glycan arrays for the elucidation of

carbohydrate recognition profiles of individual C-type lectins has been applied to

Selectins, langerin and DC-SIGN homologues (18-20).

Using a MGL-Fc chimeric protein, we identified oligosaccharides containing terminal

α- or β-linked GalNAc residues as high affinity ligands for MGL. Such terminal

GalNAc residues can be part of protein N- or O-linked glycans, or glycosphingolipids.

Identification of this specificity led to the discovery of glycan antigens within egg

glycoproteins of the pathogenic helminth Schistosoma mansoni as counterstructures

for MGL. In addition MGL strongly interacted with tumor cells in a GalNAc-specific

manner. Our results strongly implicate a role for MGL in recognition of self-

gangliosides, tumor antigens and pathogenic helminths by DC.

Methods

Cells. The adenocarcinoma cell lines SW948, SKBR3 and ZR75.1, CHO and CHO-

MGL cells and the melanoma cell lines BLM, FM3.29, FM6, SK23mel, 90.07 and

00.09 were maintained in RPMI or DMEM medium (Invitrogen, Carlsbad, CA)

Chapter 3 _

70

containing 8-10% fetal calf's serum. Immature monocyte derived DC were cultured

for 5-7 days from monocytes obtained from buffy coats of healthy donors (Sanquin,

Amsterdam) in the presence of IL-4 (500 U/ml) and GM-CSF (800 U/ml).

Antibodies and reagents. The following mAbs were used: MLD-1 (anti-MGL (21)),

AZN-D1 (anti-DC-SIGN), SMLDN1.1 and SMFG4.1 (anti-LDN (22) and anti-LDNF,

respectively, kindly provided by dr. A. Nyame and dr. R. Cummings, University of

Oklahoma Health Sciences Center, USA) and 6H3 (anti-Lewis X). Biotinylated

polyacrylamide coupled glycoconjugates were obtained from Lectinity (~20%

substitution, Lappeenranta, Finland). Crude Schistosoma mansoni soluble egg

antigen extract was prepared as previously described (kindly provided by Dr. F.

Lewis) (23). Forssman glycolipid was a kind gift from Dr. R. Geyer (University of

Giessen, Germany). DC-SIGN-Fc has been described previously (24). The peroxidase

labeled or biotinylated lectins Con A (Canavalia ensiformis), HPA (Helix pomatia),

MAA (Maackia amurensis), PNA (Arachis hypogaea), SBA (Glycin max), SNA

(Sambucus nigra) and WGA (Triticum vulgaris), were obtained from Sigma-Aldrich

(St. Louis, MO).

Isolation and expression of the cDNA encoding MGL and MGL-Fc. The cDNA

encoding human MGL (25) was amplified on total RNA from immature DC, cloned

into expression vector pRc/CMV and confirmed by sequence analysis. Stable CHO

transfectants were generated using lipofectamin (Invitrogen). MGL positive cells

were sorted using the MoFlo (DAKOcytomation, Glostrup, Denmark).The

extracellular part of MGL (amino acids 61-289) was amplified on pRc/CMV-MGL

with PCR, confirmed by sequence analysis and fused at the C-terminus to human

IgG1-Fc in the Sig-pIgG1-Fc-vector. MGL-Fc was produced by transient transfection

of CHO cells. MGL-Fc concentrations were determined by ELISA.

Glycan array (Consortium for Functional Glycomics). Biotinylated synthetic or

natural glycan structures were coated at saturating densities to streptavidin coated

high binding capacity black plates (Pierce, Rockford, IL) and probed with MGL-Fc

(2.5 μg/ml). Bound MGL-Fc was detected using a FITC-labeled anti-human IgG-Fc

antibody. Plates were read at 485-535 nm on a Wallac Victor2 1420 multi-label

counter (Perkin Elmer, Wellesley, MA). Standard procedures for glycan array testing


71

are available at (http://web.mit.edu/glycomics/consortium). The repertoire of glycan

structures probed are described elsewhere (26;27).

MGL-Fc adhesion assay. Schistosoma mansoni soluble egg antigens and biotinylated

polyacrylamide-coupled glycoconjugates were coated (5 μg/ml or as indicated) on

streptavidin coated plates (Pierce) or NUNC maxisorb plates (Roskilde, Denmark)

overnight at room temperature. Plates were blocked with 1% BSA and MGL-Fc was

added (1 μg/ml) for 2 hours at room temperature in the presence or absence of 10

mM EGTA or 20 μg/ml mAbs. Binding was detected using a peroxidase labeled anti-

human IgG-Fc antibody (Jackson, West grove, PA). To identify the carbohydrate

nature of the MGL ligands, NUNC maxisorb plates were coated with goat anti-human

Fc antibody (4 μg/ml, Jackson), followed by a 1% BSA blocking step (30 minutes at

37°C) and MGL-Fc (1 μg/ml for 1 hour at 37°C). MGL-Fc coated plates were

incubated overnight at 4°C with tumor cell lysates (10.106 cells/ml). After extensive

washing 1 mg/ml biotinylated or peroxidase labeled lectins (Sigma) were added for 2

hours at room temperature. Binding of biotinylated lectins was detected using

peroxidase-labeled avidin (Vector Laboratories, Burlingham, CA).

Flowcytometry and cellular adhesion assays. Cells were incubated with primary

antibody (5 μg/ml), followed by staining with a secondary FITC-labeled anti-mouse

antibody (Zymed, San Francisco, CA) and analyzed on FACScalibur (BD Pharmingen,

San Diego, CA).Streptavidin coated fluorescent beads (488/645 nm, Molecular

Probes, Eugene, OR) were incubated with 1 μg of the PAA-coupled glycoconjugates or

biotinylated soluble egg antigens. Fluorescent bead adhesion assay was performed as

previously described (28) and analyzed on FACScalibur and presented as the

percentage of cells which have bound the fluorescent beads. 96-well plates (NUNC

maxisorb) were coated overnight at room temperature with biotinylated PAA-

glycoconjugates (5 μg/ml) or SEA (2 μg/ml) and afterwards blocked with 1% BSA.

Calceine AM labeled DC (Molecular probes) were added for 1.5 hours at 37ºC in the

presence or absence of 10 mM EGTA or 10 μg/ml mAbs. Non-adherent cells were

removed by gentle washing. Adherent cells were lysed and fluorescence was

quantified on a Fluorstar spectrofluorimeter (BMG Labtech, Offenburg, Germany).

Chapter 3 _

72

Results

MGL specifically recognizes terminal α- or β-linked GalNAc residues that naturally

occur as part of glycoproteins or glycosphingolipids

To allow efficient screening of multiple potential carbohydrate ligands, we

constructed a MGL-Fc chimeric protein, with the extracellular portion of human

MGL (amino acids 61-289) fused to a human IgG1-Fc tail. Recombinant MGL-Fc was

produced in CHO cells and using an ELISA based method we show that MGL-Fc

indeed comprises of the extracellular domains of MGL fused to the human IgG1-tail

(Fig. 1A).

Figure 1. MGL specifically recognizes GalNAc residues. (A) MGL-Fc comprises of a human IgG1 tail and the extracellular domains of MGL. MGL-Fc was detected in ELISA by anti-MGL and anti-human IgG-Fc Abs. DC-SIGN-Fc was used as a control. (B) MGL interacts with GalNAc residues. MGL-Fc binding to monosaccharides coated on the glycan array was detected by FITC-labeled anti human Fc-antibody. (C) MGL recognizes multivalent GalNAc. Streptavidin plates were coated with biotinylated PAA-glycoconjugates. MGL-Fc binding was determined by ELISA. Standard deviation <0.02 OD 450 nm. One representative experiment out of three is shown.


73

To identify the carbohydrate recognition profile and potential function of MGL, the

MGL-Fc chimera was used to screen for carbohydrate ligands on the glycan array of

the Consortium for Functional Glycomics (29;30). MGL-Fc strongly bound the

monosaccharides α-GalNAc and β-GalNAc, whereas no interaction was observed with

the related sugar Galactose, or other monosaccharides tested (Fig. 1B). The exclusive

specificity of MGL for GalNAc was confirmed using α- and β-GalNAc

monosaccharides multivalently linked to polyacrylamide (PAA) (Fig. 1C). Our results

demonstrate that MGL exclusively recognizes GalNAc, both in α- or β-linked

configuration, whereas no specificity for either α- or β-Galactose is observed.

We next investigated whether MGL recognizes GalNAc moieties present in extended

oligosaccharides. During O-glycan synthesis α-GalNAc is substituted with other

monosaccharides to form several O-glycan core structures. Using the glycan array we

investigated whether MGL recognizes specific O-glycan core-structures (Fig. 2A).

MGL specifically interacted with a single α-GalNAc residue, also known as the Tn-

antigen. Sialylation of the α-GalNAc residue completely abrogated MGL binding,

whereas sulfation did not alter the MGL reactivity. Substitution on position 3 of the

α-GalNAc, as found in the core 1-4 structures, abrogated MGL binding. In contrast,

addition of another α-GalNac-residue to position 3 (core 5) or a β-GlcNAc to position

6 (core 6) did not affect MGL binding activity (Fig. 2A). Thus, MGL-Fc specifically

recognizes Tn-antigen and core 5 and 6 O-glycan structures.

Glycan antigens with terminal β-GalNAc residues, such as the LDN (LacdiNAc,

GalNAcβ1-4GlcNAc) glycan epitope and its derivate LDNF (GalNAcβ1-4(Fucα1-

3)GlcNAc) are found in humans, but are much more abundantly expressed by human

helminth parasites such as Schistosoma mansoni (31;32). In humans complex-type

glycans usually contain a Lactosamine unit (LacNAc, Galβ1-4GlcNAc) or Lewis X

(Galβ1-4(Fucα1-3)GlcNAc). Indeed MGL recognized both LDN and LDNF

oligosaccharides, but not their Galactose-containing counterparts Lactosamine or

Lewis X (Fig. 2B).

Chapter 3 _

74

Figure 2. MGL recognizes terminal GalNAc residues in O-glycans, helminth associated glycans and glycans that are part of glycosphingolipids. MGL-Fc binding was determined by glycan array analysis of (A) O-glycan core structures, (B) LDN and LDNF glycans, and the related oligosaccharides LacNAc and Lewis X and (C) ganglioside glycan structures. Schematic representation of all carbohydrate structures tested is indicated in the figures.

Certain glycosphingolipids contain terminal GalNAc residues, such as the

gangliosides GM2, GD2 and the Forssman glycolipid (globopentosylceramide,

GalNAcα1-3GalNAcβ1-3Galα1-4Galβ1-4GlcCer). MGL strongly interacted with the

oligosaccharide component of GM2 and GD2, whereas no binding was observed to

oligosaccharides that do not contain a terminal GalNAc, as found in GM3 and GD3

(Fig. 2C). In addition, MGL-Fc recognized the Forssman glycolipid in a glycolipid

ELISA (results not shown). Our results strongly support a MGL recognition profile of

terminal α- and β-linked GalNAc residues (Table 1).


75

Table 1. Overview of carbohydrate structures recognized by the C-type lectin MGL.

a Signal to noise ratio. Signal ratios (S) were determined by dividing the fluorescence value obtained for each carbohydrate by the background fluorescence level (497 fluorescence units). All signal ratios were averaged out to a noise ratio (N) of 4.04. Individual signals (S) were then divided by 4.04 to give the listed signal to noise ratio (S/N). High affinity S/N>3*N; medium affinity S/N>2*N, low affinity S/N>1*N.

MGL is the major GalNAc-receptor on human dendritic cells

To confirm the GalNAc-specificity of MGL-Fc, MGL-expressing cells were analyzed

for their carbohydrate binding characteristics. CHO-MGL transfectants expressed

high levels of MGL on its cell surface (Fig. 3A). Both α-GalNAc and β-GalNAc-PAA

coupled beads showed strong binding activity to CHO-MGL, but not to the parental

CHO cells. MGL-mediated adhesion is completely inhibited by the Ca2+-chelator

EGTA or an anti-MGL antibody, but not by an isotype control antibody. Neither α-

nor β-Galactose was recognized by CHO-MGL (Fig. 3B), indicating that cell surface

expressed MGL exhibits a similar GalNAc specificity as recombinant MGL-Fc.

Human immature DC naturally express MGL on the cell surface (Fig. 3A). Despite the

fact that DC express multiple C- type lectins, binding of α- or β-GalNAc to DC was

substantially blocked by anti-MGL antibodies and not by the anti-DC-SIGN antibody

(Fig. 3C). DC displayed only low binding to Galactose, which could not be attributed

to MGL, as the interaction could not be blocked by anti-MGL antibodies. DC-

expressed MGL displayed an exclusive GalNAc-specificity and our results clearly

indicate a major role for MGL in GalNAc recognition by DC.

Chapter 3 _

76

Figure 3. Both cellular and recombinant MGL have identical specificities for αααα- and b-linked GalNAc. A) MGL expression on CHO transfectants and immature DCs. Open histograms represent the isotype control and filled histograms represent anti-MGL mAb staining. B) CHO-MGL strongly interacts with GalNAc but not with Galactose in the bead adhesion assay. Specificity was determined in the presence of the Ca2+-chelator EGTA, blocking antibodies to MGL or isotype control antibody (anti-DC-SIGN). Standard deviation for the bead adhesion assay is <5%. C) MGL is the major GalNAc receptor on immature DC. Binding of DC to PAA-coupled carbohydrates was determined using plate adhesion assay in the presence or absence of EGTA, blocking antibodies to MGL or DC-SIGN. All results are representative for three independent experiments.

MGL functions as a pattern recognition receptor for helminth antigens

The specific recognition of LDN and LDNF by MGL (Fig. 2) prompted us to look at

the interaction of MGL with helminth glycan antigens. The soluble egg antigens

(SEA) of the human parasite Schistosoma mansoni were selected as a natural source

for LDN- and LDNF-glycans. Both LDN-PAA and SEA-coupled beads showed high

binding activity to CHO-MGL, but not to parental CHO cells (Fig. 4A). MGL-

mediated adhesion was specific, as shown by the complete block with anti-MGL

antibodies or EGTA, but not with an isotype control antibody. Since SEA is composed

of a several glycoproteins, monoclonal antibodies against carbohydrate epitopes were

used to determine the relative contribution of LDN and LDNF in the binding of MGL

to SEA (Fig. 4B). Binding of MGL to SEA was substantially blocked by anti-LDN

mAbs (38% reduction) and to a lesser extent by anti-LDNF mAbs (22% reduction),

whereas a combination of both anti-LDN and anti-LDNF mAbs further reduced MGL

reactivity (46% inhibition), indicating that MGL recognizes both terminal β-GalNAc

residues of LDN and LDNF structures present in SEA.


77

Figure 4. MGL strongly interacts with soluble egg glycoproteins of Schistosoma mansoni. A) CHO-MGL binds to LDN glycans and SEA as measured by bead adhesion assay. Specificity was determined in the presence of the Ca2+-chelator EGTA, blocking antibodies to MGL or isotype control antibody (anti-DC-SIGN). Standard deviation for the bead adhesion assay is <5%. B) MGL interacts with LDN and LDNF glycans present in the SEA. Binding of MGL-Fc to SEA was determined by ELISA in the presence or absence of EGTA, blocking mAbs to MGL and DC-SIGN (isotype control) or specific anti-glycan mAbs. C) Binding of SEA to immature DC is mediated by both MGL and DC-SIGN. Binding of DC was determined by plate adhesion assay in the presence or absence of EGTA, blocking mAbs to MGL or DC-SIGN. NT, not tested. All results are representative for three independent experiments.

Next, blocking antibodies were used to determine the relative contribution of MGL in

relation to other DC expressed C-type lectins, in the binding of LDN and SEA. MGL

mediated 50% of the adhesion of DC to LDN, as shown by the significant reduction in

binding with anti-MGL antibodies (Fig. 4C). Since other C-type lectins on DC, such as

DC-SIGN, are reported to be involved in binding SEA through Lewis X structures

(33), the interaction of DC with SEA was further analyzed using blocking anti-MGL

and anti-DC-SIGN antibodies. Both MGL and DC-SIGN are responsible for 30% of

the DC reactivity, whereas a combination of anti-DC-SIGN and anti-MGL antibodies

reduced adhesion by 50% (Fig. 4C). Therefore, DC-expressed MGL functions as a

pattern recognition receptor for helminth parasites.

Chapter 3 _

78

The tumor specific Tn-antigen is bound with high affinity by MGL

Tumorigenicity is associated with an increased degree of sialylation and a reduction

in length of the O-glycans expressed (34). Tumor cells, especially of adenocarcinoma

origin, are frequently positive for the Tn-antigen (single α-GalNAc linked to Serine or

Threonine). The tumor-associated Tn-antigen was preferentially recognized by MGL

(Fig. 2A), therefore several adenocarcinoma cell lines and melanoma cell lines were

analyzed for specific recognition by MGL. All adenocarcinoma cell lines tested and 3

out of 6 melanoma cell lines displayed a strong interaction with MGL-Fc (Fig. 5A).

One high binding adenocarcinoma cell line, ZR75-1, and one melanoma cell line,

00.09, were selected to investigate the nature of the recognized carbohydrates on

tumor glycoproteins. Carbohydrate ligands were captured from tumor cell lysates

with MGL-Fc and probed with commercially available plant/invertebrate lectins with

known specificities. The lectins, SBA and HPA, which both have specificity for α-

GalNAc residues, showed consistent reaction with glycoproteins, captured by MGL

from tumor cells (Fig. 5B), indicating the presence of terminal α-GalNAc residues on

the tumor antigens recognized by MGL. Since our previous data showed that

recombinant and cellular MGL have identical carbohydrate recognition profiles, these

results indicate that MGL might function as a DC-specific receptor for tumor derived

cell types.

Figure 5. MGL recognizes α-GalNAc residues on tumor cells. A) MGL recognizes both adenocarcinoma and melanoma tumor cells. Binding of MGL-Fc to tumor cell lines was determined by flowcytometry. B) MGL recognizes GalNAc residues on tumor glycoproteins. Presence of specific carbohydrate structures on glycoproteins captured by MGL was determined using biotinylated plant/invertebrate lectins with known specificities in an ELISA based assay. Values were normalized to the HPA reactivity. Standard deviation <0.02 OD 450 nm. All results are representative for three independent experiments.


79

Discussion

Here we report the carbohydrate recognition profile of the C-type lectin MGL and the

implications these results may have for the recognition of self-gangliosides, helminth

parasites and tumor cells by DC.

Using a high throughput glycan array screening, developed by the Consortium of

Functional Glycomics, terminal α-and β-linked GalNAc residues were identified as

the main carbohydrate determinants for MGL recognition. Carbohydrate mircoarrays

for studying protein-carbohydrate interactions are just emerging and most of them

work as a proof-of- principle, using lectins with known specificities to validate the

array system (35). To our knowledge this is one of the first reports describing the

identification of the carbohydrate recognition profile of a single C-type lectin with the

use of a carbohydrate array. Carbohydrate recognition profiles of Selectins, Langerin

and DC-SIGN homologues have been further refined with the use of glycan arrays

(36-38).

Both Galactose/GalNAc and GalNAc specificity have been reported for human MGL

(39;40). Initially the specificity of MGL was evaluated using lysates of MGL

transfected into COS-1. Purification on a Galactose-Sepharose column showed that

Galactose, GalNAc and even fucose were able to elute MGL from the purification

column (12). However subsequent binding studies with recombinant MGL produced

in a bacterial expression system identified a restricted GalNAc specificity (16).

Moreover the MGL specificity was not confirmed for cells naturally expressing MGL.

In this article we define the carbohydrate recognition profile of human MGL-Fc

chimeric protein by glycan array and confirm this profile using MGL transfectants

and MGL positive immature dendritic cells.

Our data clearly demonstrates that both recombinant MGL-Fc and MGL expressed by

transfectants and DC have an identical and exclusive specificity for terminal α- or β-

linked GalNAc residues and no specificity for Galactose. Substitution on position 3 or

4 of the GalNAc residue and sialylation, either on position 3 or 6 of the GalNAc,

completely eliminates MGL recognition. The effect of the sialylation could be due to

the addition of a dominant negative charge, which has been described for other C-

type lectins to interfere in binding (41). However addition of a negative charge in the

Chapter 3 _

80

form of a sulfate group on position 6 does not affect MGL binding (Fig. 2A). The

blocking effect of sialic acid on position 6 of the GalNAc is unlikely to be due to steric

hindrance, since the addition of GlcNAc on this position does not preclude MGL

recognition. The exclusive GalNAc specificity indicates that human MGL is

functionally most closely related to mouse mMGL2, which shares the GalNAc

specificity with human MGL (42).

Our finding that anti-MGL antibodies do not completely block binding of α-GalNAc

or LDN to DC, suggests that DC express next to MGL another receptor with GalNAc

specificity. No candidate C-type lectins have been reported to be expressed by

immature DC, since the well known Galactose/GalNAc-specific lectin ASGP-R (43),

abundantly expressed by liver parenchymal cells, is not expressed by DC (data not

shown). Although MGL and ASGP-R have partially overlapping carbohydrate

recognition profiles (GalNAc and Galactose/GalNAc respectively), the exclusive

expression of MGL on immature DC and MØ, implicates non-redundant cellular

functions for these C-type lectins. Recently Galectin-3 was shown to be involved in

uptake of SEA by MØ through recognition of LDN (44). Since Galectin-3 is expressed

by DC (45), Galectin-3 might be a promising candidate receptor. Recognition of LDN

by DC could therefore be mediated by both MGL and Galectin-3 simultaneously.

Most C-type lectins contain special motifs within their cytoplasmic tails, which

facilitate antigen uptake and thereby enhance antigen processing and presentation.

Although C-type lectins do not directly stimulate the immune system, they affect the

balance between immunity and tolerance by influencing Toll-like receptor signaling

(46;47). C-type lectins probably have an important endogenous role in maintaining

tolerance towards self-glycoproteins (48).

The specific interaction of MGL with SEA glycoproteins containing LDN and LDNF,

demonstrates that MGL functions as a pattern recognition receptor for the human

helminth parasite Schistosoma mansoni. SEA are known to skew the immune system

towards a TH2-type response (49). Recently Ebola and Marburg filoviruses have been

reported as pathogenic ligands for human MGL (50). Interestingly both SEA and

filoviruses target DC-SIGN as well, in a fucose and high-mannose type manner

respectively (51;52). In addition the mouse Mannose Receptor recognizes SEA in a

mannose dependent fashion (53). The residual binding of DC to SEA, after complete


81

block of MGL and DC-SIGN, might therefore be mediated by the human Mannose

Receptor. Since several pathogens misuse the tolerogenic pathway induced by C- type

lectins for their own survival (54), it will be interesting to pursue how targeting of

pathogens to MGL and other cooperating C-type lectins may modulate DC

maturation and the induction of adaptive immune responses.

Furthermore, MGL recognized glycosphingolipids, mainly of the ganglioside subtype.

As MGL has the capacity to internalize synthetic glycoconjugates (55), it might

internalize glycolipids for loading onto CD1 molecules, similarly as reported for the C-

type lectin Langerin (56). Langerin is capable of loading CD1a molecules with foreign

glycolipids derived from Mycobacteria leprae, however the gangliosides which bind

MGL are normally expressed in the spleen (57). The fact that gangliosides inhibit APC

function (58), may hint to a possible function of MGL in antigen presentation and

maintenance of tolerance to self-glycolipids.

Our data demonstrates that MGL might be involved in the recognition of tumor cells

by DC. In normal leukocytes and epithelial cells O-glycans are essentially all of core 1

or extended core 2 subtype. Tumorigenicity is associated with increased sialylation

and a reduction in length of the O-glycans expressed (59). Tumor cells, especially of

adenocarcinoma origin, are frequently positive for the Tn-antigen (single α-GalNAc)

or TF-antigen (Galβ1-3GalNAc). Positivity for the Tn-antigen specific lectin HPA

serves as a diagnostic marker for a wide range of adenocarcinomas and

coloncarinomas and is associated with lymph node metastases, poor prognosis and

lower survival rates (60). A high correlation was found between the GalNAc-specific

lectins HPA/SBA, and MGL recognition of α-GalNAc in tumor glycoproteins.

Recently cytotoxic T cells have been described with specificity for the Tn-antigen (61),

indicating that it is possible to generate a T cell response against carbohydrate

antigens. Targeting of tumor antigens containing the Tn-antigen to MGL on DC can

potentially result in enhanced presentation in MHC I and II. Yet targeting of antigens

to C- type lectins without any additional DC activation may have tolerizing effects and

inhibit anti-tumor responses (6;62). We postulate that the expression of Tn-antigen

by tumors might modulate immune responses via targeting to C-type lectins, such as

MGL.

Chapter 3 _

82

Our data shows that MGL specifically recognizes terminal α- and β-linked GalNAc

moieties that are present on tumor derived cell types, pathogens such as helminth

parasites and self-antigens, such as glycosphingolipids. Future studies should address

whether antigen targeting to MGL on APC, such as DC and MØ, leads to antigen

presentation as well as immune modulation.

References

1 Janeway, C. A. and Medzhitov, R. 2002. Innate immune recognition. Annu Rev Immunol 20:197-216.

2 Geijtenbeek, T. B. H., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C. F., Adema, G. J., van Kooyk, Y., and Figdor, C. G. 2000. Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell 100:575-85.

3 Figdor, C. G., van Kooyk, Y., and Adema, G. J. 2002. C-type lectin receptors on dendritic cells and Langerhans cells. Nature Rev Immunol 2:77-84.

4 Homeister, J. W., Thall, A. D., Petryniak, B., Maly, P., Rogers, C. E., Smith, P. L., Kelly, R. J., Gersten, K. M., Askari, S. W., Cheng, G., Smithson, G., Marks, R. M., Misra, A. K., Hindsgaul, O., von Andrian, U. H., and Lowe, J. B. 2001. The alpha(1,3)fucosyltransferases FucT-IV and FucT-VII exert collaborative control over selectin-dependent leukocyte recruitment and lymphocyte homing. Immunity. 15:115-126.

5 Geijtenbeek, T. B., van Vliet, S. J., Engering, A., 't hart, B. A., and van Kooyk, Y. 2004. Self- and Nonself-Recognition by C-Type Lectins on Dendritic Cells. Annu Rev Immunol 22:33-54.

6 Steinman, R. M., Hawiger, D., and Nussenzweig, M. C. 2003. Tolerogenic dendritic cells. Annu Rev Immunol 21:685-711.

7 Gantner, B. N., Simmons, R. M., Canavera, S. J., Akira, S., and Underhill, D. M. 2003. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J.Exp.Med. 197:1107-1117.

8 Geijtenbeek, T. B., van Vliet, S. J., Koppel, E. A., Sanchez-Hernandez, M., Vandenbroucke-Grauls, C. M., Appelmelk, B., and van Kooyk, Y. 2003. Mycobacteria Target DC-SIGN to Suppress Dendritic Cell Function. J Exp Med 197:7-17.

9 Bonifaz, L., Bonnyay, D., Mahnke, K., Rivera, M., Nussenzweig, M. C., and Steinman, R. M. 2002. Efficient targeting of protein antigen to the dendritic cell receptor DEC-205 in the steady state leads to antigen presentation on major histocompatibility complex class I products and peripheral CD8+ T cell tolerance. J Exp Med 196:1627-38.

10 Higashi, N., Fujioka, K., Denda-Nagai, K., Hashimoto, S., Nagai, S., Sato, T., Fujita, Y., Morikawa, A., Tsuiji, M., Miyata-Takeuchi, M., Sano, Y., Suzuki, N., Yamamoto, K., Matsushima, K., and Irimura, T. 2002. The macrophage C-type lectin specific for galactose/N-acetylgalactosamine is an endocytic receptor expressed on monocyte-derived immature dendritic cells. J.Biol.Chem. 277:20686-20693.

11 Valladeau, J., Duvert-Frances, V., Pin, J. J., Kleijmeer, M. J., Ait-Yahia, S., Ravel, O., Vincent, C., Vega, F., Helms, A., Gorman, D., Zurawski, S. M., Zurawski, G., Ford, J., and Saeland, S. 2001. Immature human dendritic cells express asialoglycoprotein receptor isoforms for efficient receptor-mediated endocytosis. J Immunol 167:5767-74.

12 Suzuki, N., Yamamoto, K., Toyoshima, S., Osawa, T., and Irimura, T. 1996. Molecular cloning and expression of cDNA encoding human macrophage C- type lectin. Its unique carbohydrate binding specificity for Tn antigen. J Immunol 156:128-35.

13 Higashi, N., Morikawa, A., Fujioka, K., Fujita, Y., Sano, Y., Miyata-Takeuchi, M., Suzuki, N., and Irimura, T. 2002. Human macrophage lectin specific for galactose/N-acetylgalactosamine is a marker for cells at an intermediate stage in their differentiation from monocytes into macrophages. Int Immunol 14:545-54.

14 Onami, T. M., Lin, M. Y., Page, D. M., Reynolds, S. A., Katayama, C. D., Marth, J. D., Irimura, T., Varki, A., Varki, N., and Hedrick, S. M. 2002. Generation of mice deficient for macrophage galactose- and N-acetylgalactosamine-specific lectin: limited role in lymphoid and erythroid homeostasis and evidence for multiple lectins. Mol.Cell Biol. 22:5173-5181.


83

15 Tsuiji, M., Fujimori, M., Ohashi, Y., Higashi, N., Onami, T. M., Hedrick, S. M., and Irimura, T. 2002. Molecular cloning and characterization of a novel mouse macrophage C-type lectin, mMGL2, which has a distinct carbohydrate specificity from mMGL1. J.Biol.Chem. 277:28892-28901.


17 Iida, S., Yamamoto, K., and Irimura, T. 1999. Interaction of human macrophage C-type lectin with O-linked N-acetylgalactosamine residues on mucin glycopeptides. J.Biol.Chem. 274:10697-10705.

18 Feizi, T., Fazio, F., Chai, W., and Wong, C. H. 2003. Carbohydrate microarrays - a new set of technologies at the frontiers of glycomics. Curr.Opin.Struct.Biol. 13:637-645.

19 Galustian, C., Park, C. G., Chai, W., Kiso, M., Bruening, S. A., Kang, Y. S., Steinman, R. M., and Feizi, T. 2004. High and low affinity carbohydrate ligands revealed for murine SIGN-R1 by carbohydrate array and cell binding approaches, and differing specificities for SIGN-R3 and langerin. Int.Immunol. 16:853-866.


21 Higashi, N., Fujioka, K., Denda-Nagai, K., Hashimoto, S., Nagai, S., Sato, T., Fujita, Y., Morikawa, A., Tsuiji, M., Miyata-Takeuchi, M., Sano, Y., Suzuki, N., Yamamoto, K., Matsushima, K., and Irimura, T. 2002. The macrophage C-type lectin specific for galactose/N-acetylgalactosamine is an endocytic receptor expressed on monocyte-derived immature dendritic cells. J.Biol.Chem. 277:20686-20693.

22 Van Die, I., van Vliet, S. J., Nyame, A. K., Cummings, R. D., Bank, C. M., Appelmelk, B., Geijtenbeek, T. B., and van Kooyk, Y. 2003. The dendritic cell-specific C-type lectin DC-SIGN is a receptor for Schistosoma mansoni egg antigens and recognizes the glycan antigen Lewis x. Glycobiology 13:471-478.

23 Nyame, A. K., Lewis, F. A., Doughty, B. L., Correa-Oliveira, R., and Cummings, R. D. 2003. Immunity to schistosomiasis: glycans are potential antigenic targets for immune intervention. Exp.Parasitol. 104:1-13.

24 Appelmelk, B. J., Van Die, I., van Vliet, S. J., Vandenbroucke-Grauls, C. M., Geijtenbeek, T. B., and van Kooyk, Y. 2003. Cutting edge: carbohydrate profiling identifies new pathogens that interact with dendritic cell-specific ICAM-3-grabbing nonintegrin on dendritic cells. J.Immunol. 170:1635-1639.


26 Bochner, B. S., Alvarez, R. A., Mehta, P., Bovin, N. V., Blixt, O., White, J. R., and Schnaar, R. L. 2005. Glycan array screening reveals a candidate ligand for siglec-8. J.Biol.Chem. 280:4307-4312.

27 Blixt, O., Head, S., Mondala, T., Scanlan, C., Huflejt, M. E., Alvarez, R., Bryan, M. C., Fazio, F., Calarese, D., Stevens, J., Razi, N., Stevens, D. J., Skehel, J. J., Van, D., I, Burton, D. R., Wilson, I. A., Cummings, R., Bovin, N., Wong, C. H., and Paulson, J. C. 2004. Printed covalent glycan array for ligand profiling of diverse glycan binding proteins. Proc.Natl.Acad.Sci.U.S.A 101:17033-17038.

28 Geijtenbeek, T. B. H., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C. F., Adema, G. J., van Kooyk, Y., and Figdor, C. G. 2000. Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell 100:575-85.

29 Bochner, B. S., Alvarez, R. A., Mehta, P., Bovin, N. V., Blixt, O., White, J. R., and Schnaar, R. L. 2005. Glycan array screening reveals a candidate ligand for siglec-8. J.Biol.Chem. 280:4307-4312.

30 Blixt, O., Head, S., Mondala, T., Scanlan, C., Huflejt, M. E., Alvarez, R., Bryan, M. C., Fazio, F., Calarese, D., Stevens, J., Razi, N., Stevens, D. J., Skehel, J. J., Van, D., I, Burton, D. R., Wilson, I. A., Cummings, R., Bovin, N., Wong, C. H., and Paulson, J. C. 2004. Printed covalent glycan array for ligand profiling of diverse glycan binding proteins. Proc.Natl.Acad.Sci.U.S.A 101:17033-17038.

31 Nyame, A. K., Leppanen, A. M., DeBose-Boyd, R., and Cummings, R. D. 1999. Mice infected with Schistosoma mansoni generate antibodies to LacdiNAc (GalNAc beta 1-->4GlcNAc) determinants. Glycobiology 9:1029-1035.

Chapter 3 _

84

32 Van den Eijnden, D. H., Bakker, H., Neeleman, A. P., van den Nieuwenhof, I., and van Die, I. 1997. Novel pathways in complex-type oligosaccharide synthesis: new vistas opened by studies in invertebrates. Biochem.Soc.Trans. 25:887-893.


34 Brockhausen, I. 1999. Pathways of O-glycan biosynthesis in cancer cells. Biochim.Biophys.Acta 1473:67-95.



37 Galustian, C., Park, C. G., Chai, W., Kiso, M., Bruening, S. A., Kang, Y. S., Steinman, R. M., and Feizi, T. 2004. High and low affinity carbohydrate ligands revealed for murine SIGN-R1 by carbohydrate array and cell binding approaches, and differing specificities for SIGN-R3 and langerin. Int.Immunol. 16:853-866.


39 Iida, S., Yamamoto, K., and Irimura, T. 1999. Interaction of human macrophage C-type lectin with O-linked N-acetylgalactosamine residues on mucin glycopeptides. J.Biol.Chem. 274:10697-10705.



42 Tsuiji, M., Fujimori, M., Ohashi, Y., Higashi, N., Onami, T. M., Hedrick, S. M., and Irimura, T. 2002. Molecular cloning and characterization of a novel mouse macrophage C-type lectin, mMGL2, which has a distinct carbohydrate specificity from mMGL1. J.Biol.Chem. 277:28892-28901.

43 Spiess, M. and Lodish, H. F. 1985. Sequence of a second human asialoglycoprotein receptor: conservation of two receptor genes during evolution. Proc.Natl.Acad.Sci.U.S.A 82:6465-6469.

44 van den Berg, T. K., Honing, H., Franke, N., van Remoortere, A., Schiphorst, W. E., Liu, F. T., Deelder, A. M., Cummings, R. D., Hokke, C. H., and Van, D., I 2004. LacdiNAc-glycans constitute a parasite pattern for galectin-3-mediated immune recognition. J.Immunol. 173:1902-1907.

45 Sato, S. and Nieminen, J. 2004. Seeing strangers or announcing "danger": galectin-3 in two models of innate immunity. Glycoconj.J. 19:583-591.

46 Geijtenbeek, T. B., van Vliet, S. J., Koppel, E. A., Sanchez-Hernandez, M., Vandenbroucke-Grauls, C. M., Appelmelk, B., and van Kooyk, Y. 2003. Mycobacteria Target DC-SIGN to Suppress Dendritic Cell Function. J Exp Med 197:7-17.

47 Engering, A., Geijtenbeek, T. B., and van Kooyk, Y. 2002. Immune escape through C-type lectins on dendritic cells. Trends Immunol 23:480-5.


49 Thomas, P. G. and Harn, D. A., Jr. 2004. Immune biasing by helminth glycans. Cell Microbiol. 6:13-22.

50 Takada, A., Fujioka, K., Tsuiji, M., Morikawa, A., Higashi, N., Ebihara, H., Kobasa, D., Feldmann, H., Irimura, T., and Kawaoka, Y. 2004. Human macrophage C-type lectin specific for galactose and N-acetylgalactosamine promotes filovirus entry. J.Virol. 78:2943-2947.


52 Alvarez, C. P., Lasala, F., Carrillo, J., Muniz, O., Corbi, A. L., and Delgado, R. 2002. C-type lectins DC-SIGN and L-SIGN mediate cellular entry by Ebola virus in cis and in trans. J Virol 76:6841-4.


85

53 Linehan, S. A., Coulson, P. S., Wilson, R. A., Mountford, A. P., Brombacher, F., Martinez-Pomares, L., and Gordon, S. 2003. IL-4 receptor signaling is required for mannose receptor expression by macrophages recruited to granulomata but not resident cells in mice infected with Schistosoma mansoni. Lab Invest 83:1223-1231.

54 van Kooyk, Y. and Geijtenbeek, T. B. 2003. DC-SIGN: escape mechanism for pathogens. Nat.Rev.Immunol. 3:697-709.

55 Denda-Nagai, K., Kubota, N., Tsuiji, M., Kamata, M., and Irimura, T. 2002. Macrophage C-type lectin on bone marrow-derived immature dendritic cells is involved in the internalization of glycosylated antigens. Glycobiology 12:443-450.

56 Hunger, R. E., Sieling, P. A., Ochoa, M. T., Sugaya, M., Burdick, A. E., Rea, T. H., Brennan, P. J., Belisle, J. T., Blauvelt, A., Porcelli, S. A., and Modlin, R. L. 2004. Langerhans cells utilize CD1a and langerin to efficiently present nonpeptide antigens to T cells. J.Clin.Invest 113:701-708.

57 Kovacic, N., Muthing, J., and Marusic, A. 2000. Immunohistological and flow cytometric analysis of glycosphingolipid expression in mouse lymphoid tissues. J.Histochem.Cytochem. 48:1677-1690.

58 Caldwell, S., Heitger, A., Shen, W., Liu, Y., Taylor, B., and Ladisch, S. 2003. Mechanisms of ganglioside inhibition of APC function. J.Immunol. 171:1676-1683.

59 Brockhausen, I. 1999. Pathways of O-glycan biosynthesis in cancer cells. Biochim.Biophys.Acta 1473:67-95.

60 Brooks, S. A. 2000. The involvement of Helix pomatia lectin (HPA) binding N-acetylgalactosamine glycans in cancer progression. Histol.Histopathol. 15:143-158.

61 Xu, Y., Gendler, S. J., and Franco, A. 2004. Designer Glycopeptides for Cytotoxic T Cell-based Elimination of Carcinomas. J.Exp.Med. 199:707-716.


Molecular basis of the differences in binding properties of the highly related C-type lectins DC-SIGN and L-SIGN to Lewis x trisaccharide and Schistosoma

mansoni egg antigens

Ellis van Liempt, Anne Imberty, Christine M.C. Bank, Sandra J. van

Vliet, Yvette van Kooyk, Teunis B.H. Geijtenbeek, and Irma van Die

Journal of biological chemistry 2004; 279 (32): 33161-33167.

Chapter 4

Differential binding of DC-SIGN and L-SIGN to Lewis antigens

89

Abstract

The dendritic cell specific C-type lectin DC-SIGN functions as a pathogen receptor

that recognizes Schistosoma mansoni egg antigens (SEA) through its major glycan

epitope Galβ1,4(Fucα1,3)GlcNAc (Lex). Here we report that L-SIGN, a highly related

homologue of DC-SIGN found on liver sinusoidal endothelial cells, binds to S.

mansoni SEA but not to the Lex epitope. L-SIGN does bind the Lewis antigens Lea,

Leb and Ley, similar as DC-SIGN. A specific mutation in the carbohydrate recognition

domain (CRD) of DC-SIGN (V351G) abrogates binding to all Lewis antigens. In L-

SIGN Ser363 is present at the corresponding position of Val351 in DC-SIGN.

Replacement of this Ser into Val resulted in a “gain of function” L-SIGN mutant that

binds Lex, and shows increased binding to the other Lewis antigens. These data

indicate that Val351 is important for the fucose-specificity of DC-SIGN. Molecular

modeling, and docking of the different Lewis antigens in the CRDs of L-SIGN, DC-

SIGN, and their mutant forms, demonstrate that Val351 in DC-SIGN creates a

hydrophobic pocket that strongly interacts with the Fucα1,3/4-GlcNAc moiety of the

Lewis antigens. The equivalent amino acid residue Ser363 in L-SIGN creates a

hydrophilic pocket that prevents interaction with Fucα1,3-GlcNAc in Lex but supports

interactions with the Fucα1,4-GlcNAc moiety in Lea and Leb antigens. These data

demonstrate for the first time that DC-SIGN and L-SIGN differ in their carbohydrate

binding profiles, and will contribute to our understanding of the functional roles of

these C-type lectin receptors, both in recognition of pathogen and self glycan

antigens.

Chapter 4 _

90

Introduction

Dendritic cell specific intercellular adhesion molecule-3 (ICAM-3) grabbing

nonintegrin (DC-SIGN, CD209), is a type II membrane C-type lectin with a short

amino terminal cytoplasmic tail and a single carboxyl terminal carbohydrate

recognition domain (CRD). DC-SIGN is a cell adhesion receptor that mediates

interactions between dendritic cells (DCs) and resting T cells through binding to

ICAM-3 and supports trans-endothelial migration through interaction with ICAM-2

(1-3). DC-SIGN has also been described as a pathogen receptor. It binds HIV-1 gp120

and facilitates the transport of HIV from mucosal sites to draining lymph nodes

where infection of T-lymphocytes occurs (2). Recent reports show that DC-SIGN

binds to other viruses like hepatitis C (4;5), Ebola (6), CMV (7) and Dengue (8), as

well as other pathogens such as Mycobacterium (9-11), Leishmania (12;13) and

Candida albicans (14). Recently we showed that DC-SIGN binds soluble egg

glycoproteins (SEA) of the helminth parasite Schistosoma mansoni through the

Lewis x (Lex, CD15) glycan antigen (15). This binding to Lex and SEA was abrogated

by mutation of the Val at position 351 in the CRD of DC-SIGN.

Liver/lymph node specific ICAM-3-grabbing nonintegrin (L-SIGN/CD209L/DC-

SIGN-R) is a human homologue of DC-SIGN. L-SIGN shares 77% amino acid

sequence identity with DC-SIGN and has functional similarity by recognizing ICAM-

2, ICAM-3 and HIV-1 gp120. In addition, elucidation of the crystal structures of the

CRDs of both DC-SIGN and L-SIGN, in combination with binding studies revealed

that both receptors recognize high-mannose oligosaccharides (16;17). Whereas for

DC-SIGN increasing evidence indicates that its major ligands are α3/α4-fucosylated

glycans (15,18,19), no data so far indicate a role for L-SIGN in the binding of

fucosylated oligosaccharides. L-SIGN is not expressed by DCs, but is expressed by

endothelial cells present in lymph node sinuses, capillary endothelial cells of the

placenta and liver sinusoidal endothelial cells (LSECs)(18-21). Since LSECs function

as a liver-resident antigen presenting cell population (24), it is of particular interest

to investigate whether L-SIGN plays a role in the recognition and uptake of

glycosylated Schistosome egg antigens that are secreted by eggs trapped in the liver of

Schistosome infected hosts.


91

Here we demonstrate that L-SIGN interacts with S. mansoni SEA, but recognizes

another glycoprotein fraction than DC-SIGN, suggesting that L-SIGN does not

recognize Lex. Indeed, binding assays with L-SIGN demonstrated a lack of binding of

L-SIGN to neoglycoconjugates carrying Lex, but show that L-SIGN recognizes other

fucosylated glycans, i.e. Lewis a (Lea), Lewis b (Leb) and Lewis y (Ley). Site-specific

mutagenesis of the amino acid residue Ser363 in L-SIGN into a Val, as is present in

DC-SIGN at this position, resulted in a “gain of function” mutant that binds to

neoglycoconjugates carrying Lex, and shows increased binding to the other Lewis

antigens. Molecular modeling of the CRDs of the wild-type and mutant lectins

demonstrated that Val351 in DC-SIGN, which is lacking in L-SIGN, may be critically

involved in the binding to Lex and Lea by creating a strong hydrophobic contact with

the fucose. These data show for the first time that DC-SIGN and L-SIGN differ in

their carbohydrate recognition profiles, and propose a molecular model that explains

the observed differential binding of these lectins to fucosylated glycan antigens.

Experimental Procedures

Antibodies and neoglycoconjugates. The following antibodies were used: AZN-D1

(IgG1, anti-DC-SIGN), AZN-D2 (anti-DC-SIGN/anti-L-SIGN) (22), anti-LDN mAb

SMLDN1.1 (23). Crude Schistosoma mansoni soluble egg (SEA) extract was

centrifuged for 90 min. at 100,000 x g at 4ºC and sterilized by passing through a 0.2

μM filter, essentially as described by Nyame et al., (26). Neoglycoconjugates,

containing glycans multivalently coupled to biotinylated polyacrylamide (PAA) were

from Lectinity (Finland).

Mutagenesis. Mutations in the cDNA encoding L-SIGN were generated using the

QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and pRc/CMV-

L-SIGN plasmid according to the manufacturers protocol. Plasmid sequencing

confirmed the introduction of a mutation in the Ser residue at position 363 into Val

(S363V) or Gly (S363G), respectively. Stable K562 cell lines expressing L-SIGN

mutants were generated by transfection of K562 cells with 10 μg of plasmid as

described previously (24). Positive cells were sorted several times with the antibody

AZN-D2, to obtain stable transfectants with similar expression levels (> 85%, Figure

3B).

Chapter 4 _

92

Binding assay. Stable K562 cells expressing different wild-type and mutant C-type

lectins (5 x 104 cells) were incubated in a total volume of 25 μl with biotinylated

polyacrylamide (PAA)-linked glycoconjugates (5 μg/ml) in adhesion buffer (20 mM

Tris-HCl [pH 8.0], 150 mM NaCl, 1 mM CaCl2, 2mM MgCl2 and 0.5% BSA) for 30

min at 37ºC. Cells were washed with adhesion buffer and incubated with

streptavidine-alexa fluor 488 secondary antibody (Molecular Probes, Inc., Eugene,

OR) for 20 min at room temperature and analyzed using flow cytometry in the FL-1

channel (FACScan, Becton Dickinson, Oxnard, CA).

Fluorescent bead adhesion assay. For measuring SEA binding to whole cells, a bead

adhesion assay was used as described previously (25). Streptavidin was covalently

coupled to TransFluorSpheres, fluorescent beads with a size of 1.0 μm and

fluorescence at 488/654 nm (Molecular Probes Inc., Eugene, OR). The streptavidin-

coated beads were incubated with biotinylated F(ab’)2 fragment of goat anti-mouse

IgG (6 μg/ml); Jackson Immunoresearch), followed by an overnight incubation at

4ºC with anti-LDN mAb. The beads were washed and incubated with 1 μg/ml SEA

overnight at 4ºC (26). Alternatively, SEA was biotinylated with EZ-linkTM NHS-LC-

LC-Biotin, according to the manufacturers protocol (Pierce, Rockford, IL).

Biotinylated SEA (SEA-bio) was directly coupled to the streptavidin coated

fluorescent beads. HIV gp120 fluorescent beads were prepared as described

previously (2). Briefly, for the fluorescent beads adhesion assay 50 x 103 cells were

resuspended in adhesion buffer (20 mM Tris-HCl [pH 8.0], 150 mM NaCl, 1 mM

CaCl2, 2mM MgCl2 and 0.5% BSA). Ligand-coated fluorescent beads (20 beads/cell)

were added to the cells and the suspension was incubated for 45 minutes at 37ºC.

Cells were washed and adhesion was determined using flow cytometry (FACScan,

Becton Dickinson, Oxnard, CA), by measuring the percentage of cells that had bound

fluorescent beads in the FL-3 channel.

Molecular modelling. The starting coordinates of human DC-SIGN and L-SIGN (17)

were taken from the Protein Data Bank (29), using files with code 1K9I and 1K9J,

respectively. Using the Sybyl software (Tripos Inc., St Louis), the structures were

edited in order to contain only one protein monomer together with calcium ions.

Protein hydrogen atoms were added, the peptide atoms partial charges were

calculated using the Pullman procedure and the calcium ions were given a charge of


93

2. The positions of the hydrogen atoms were refined with the use of the Tripos force

field (30). Lewis oligosaccharides were built from a database of 3D-structures of

monosaccharides, with their glycosidic torsion angles corresponding to the lowest

energy conformation previously determined (31). Atom types and charges for

oligosaccharides were defined using the PIM parameters developed for carbohydrates

(32). Docking of oligosaccharides in the binding sites was performed by testing the

several possible orientations of the fucose hydroxyl groups in the coordination sphere

of the calcium ion. Energy minimization was performed using the Tripos force-field

(30) with geometry optimization of the sugar and the side chains of amino acids in

the binding sites. A distance dependent dielectric constant was used in the

calculations. Energy minimizations were carried out using the Powell procedure until

a gradient deviation of 0.05 kcal·mol-1·Å-1 was attained.

Results

L-SIGN shows binding to Schistosoma mansoni SEA

In a previous study, we showed that DC-SIGN binds S. mansoni soluble egg antigens

(SEA) through the recognition of Lex antigens. To investigate the binding properties

of L-SIGN to SEA, we used a fluorescent bead adhesion assay with K562 transfectants

stably expressing L-SIGN or DC-SIGN (Figure 1A). Streptavidin coated fluorescent

beads were precoated with monoclonal antibodies recognizing LDN glycan antigens

(25) that occur on a SEA glycoprotein fraction that simultaneously carries Lex glycan

antigens (15). These LDN coated fluorescent beads were then used to capture SEA,

and incubated with K562 cells expressing L-SIGN as described previously for DC-

SIGN (27). The LDN captured SEA beads interacted with K562 cells expressing DC-

SIGN, however we could not observe any binding to L-SIGN (Figure 1C). However, by

using this approach only a fraction of the SEA was coated on the beads (i.e. only SEA

containing LDN glycans carrying also Lex (15)). To investigate binding of L-SIGN to

the whole SEA population, SEA was biotinylated and directly coated on streptavidin

coated fluorescent beads. Interestingly, K562 cells expressing L-SIGN bound to beads

carrying biotinylated SEA (Figure 1B,C). In agreement with previous results L-SIGN

was able to bind HIV-1 gp120 beads in a manner similar to DC-SIGN (Figure 1C)

(28). The binding of beads coated with biotinylated SEA to both DC-SIGN and L-

SIGN could be blocked by the anti-DC-SIGN/L-SIGN antibody AZN-D2 and by

EDTA, which removes the Ca2+ ions that are essential for carbohydrate binding,

Chapter 4 _

94

indicating that the carbohydrate recognition domains (CRDs) of the lectins are

involved in binding of SEA (Figure 1D). These data show that L-SIGN binds S.

mansoni SEA, but recognizes a different subset of SEA compared to DC-SIGN, which

suggests that L-SIGN differs from DC-SIGN in its ability to bind Lex glycan antigens.

Figure 1. Fluorescent beads adhesion assays of S. mansoni SEA with K562 cells expressing L-SIGN or DC-SIGN. (A) K562 cells stable transfected with L-SIGN or DC-SIGN have similar expression levels as determined by FACScan analysis using mAb AZN-D2 that recognizes a common epitope on L-SIGN and DC-SIGN. (B) SEA was biotinylated and coupled to streptavidin-coated fluorescent beads (SEA-bio). Binding of the beads to the cells was measured by FACScan analysis using Cellquest (Becton Dickinson, Oxnard, CA). The dotplots (left panel) show the forward-side scatter (FSC) of the cells in the presence of SEA-bio. The adhesion of the beads to the cells is measured in the FL-3 channel and shown as histoplots (right panel). (C) Binding of HIV-1 gp120 and SEA coated beads to the cells was measured using the fluorescent bead adhesion assay as in B and shown as % binding. In addition to SEA-bio (see B), fluorescent beads coupled to an anti-LDN-mAb (25) were used to capture SEA (SEA-LDN). One representative experiment out of three is shown. (D) The binding of fluorescent beads coated with biotinylated SEA (SEA-bio) was blocked by AZN-D2 (20 μg/ml) and EGTA (5mM). One representative experiment out of three is shown.


95

L-SIGN does not bind to Lex, but recognizes other Lewis antigens

As our previous data indicated that the trisaccharide Lex on schistosome SEA is a

ligand for DC-SIGN, we next investigated whether L-SIGN binds to Lex glycans linked

to biotinylated polyacrylamide (PAA). The results in Figure 2 show that K562 cells

expressing L-SIGN did not bind Lex-PAA, in contrast to K562 cells expressing DC-

SIGN that strongly bound to Lex-PAA. The binding of DC-SIGN to Lex-PAA could be

inhibited by a blocking antibody against DC-SIGN (AZN-D2) and by the calcium

chelator EGTA (Figure 2B).

Figure 2. Binding of Lex coupled to biotinylated polyacrylamide (Lex-PAA-bio) to K562 cells expressing L-SIGN or DC-SIGN. (A) Cells were incubated with Lex-PAA-bio in adhesion buffer for 30 min at 37ºC. After incubation with goat-anti-mouse streptavidin Alexa Fluor488, the binding was measured by FACScan analysis, and shown as a histoplot. The white graphs represent control cells, the black graphs show binding of the cells to Lex-PAA-bio. One representative experiment out of three is shown. (B) Binding of K562 cells expressing L-SIGN or DC-SIGN to Lex-PAA-bio (indicated as Lex) was measured as outlined in A, but shown here as % of binding. Binding of Lex–PAA-bio to DC-SIGN could be blocked by EGTA and the anti-L-SIGN/DC-SIGN antibody AZN-D2. One representative experiment out of three is shown.

It has been described that the CRD of DC-SIGN binds two Ca2+ ions and that amino

acids in close contact with these Ca2+ binding sites are essential for ligand binding

(1,28). The amino acid sequences of the CRD domains of L-SIGN and DC-SIGN show

a high identity (Figure 3A). Recently we showed that mutation of amino acid residue

Val351 into a Gly in DC-SIGN (V351G, Figure 3A) abrogated binding to SEA and Lex,

whereas binding to HIV gp120 was not affected (15,28). This suggests that Val351

within the CRD of DC-SIGN is important for binding of DC-SIGN to Lex. In L-SIGN, a

Ser is located at the position of Val in DC-SIGN. To determine the molecular basis for

the difference in carbohydrate specificity between L-SIGN and DC-SIGN, two

mutations were made in the CRD domain of L-SIGN in which Ser at position 363 is

converted into a Val (S363V) or alternatively into a Gly (S363G) (Figure 3A). The

Chapter 4 _

96

carbohydrate binding capacity of K562 cells expressing these L-SIGN mutant forms

was compared to K562 cells expressing similar levels of wild type L-SIGN, DC-SIGN

and the DC-SIGN V351G mutant, respectively (Figure 3B). Both wild type L-SIGN

and DC-SIGN showed binding to biotinylated neoglycoconjugates containing Lea, Leb

and Ley, but not to sialyl Lex (sLex) (Table 1, Figure 3C). EGTA and a blocking anti-

DC-SIGN/L-SIGN antibody could inhibit this binding (data not shown). Remarkably,

the L-SIGN mutant S363V showed binding to Lex, in contrast to the wild type L-SIGN

(Figure 3C). The introduction of this Val residue also induced increased binding of

the L-SIGN S363V mutant to Lea, Leb and Ley (Figure 3C), and to S. mansoni SEA

(data not shown). The conversion of Val351 into a Gly in DC-SIGN (DC-SIGN V351G)

abrogated binding to all Lewis antigens. Similarly, the L-SIGN S363G mutant showed

no binding to any of the Lewis antigens tested (Figure 3C). These results demonstrate

that cell-surface expressed L-SIGN and DC-SIGN differ in their binding properties to

Lex. Both lectins, however, show a functional similarity in their capacity to bind to

Lea, Leb and Ley glycan antigens, and their lack of binding to sLex. Our data indicate

that amino acid residue Val351 in DC-SIGN, which is lacking in L-SIGN, is critically

involved in the binding of DC-SIGN to Lex glycan structures.

Table 1: Structures of Lewis glycan antigens.

Lewis antigen Carbohydrate structure

Lewis x (Lex) Galβ1→4GlcNAc-R

3

↑ Fucα1

Lewis y (Ley) Fucα1→2Galβ1→4GlcNAc-R

3

↑ Fucα1

Lewis a (Lea) Galβ1→3GlcNAc-R

4

↑ Fucα1

Lewis b (Leb) Fucα1→2Galβ1→3GlcNAc-R

4

↑ Fucα1

sialyl-Lewis x (sLex) NeuAcα1→3Galβ1→4GlcNAc-R

3

↑ Fucα1


97

Figure 3. Binding of different Lewis antigens coupled to biotinylated polyacrylamide (PAA-bio) to K562 cells expressing L-SIGN, DC-SIGN or mutant forms of the lectins. (A) Amino acid sequence alignment of part of the carbohydrate recognition domains (CRDs) of L-SIGN (AAK20998) and DC-SIGN (AAK20997) is depicted. The CRD sequences are very similar as is shown by the black boxes. Mutations in the CRD of L-SIGN have been introduced at position Ser363, as indicated by an arrow. (B) Stable K562 transfectants express similar levels of L-SIGN, DC-SIGN and different mutant forms of L-SIGN and DC-SIGN, as determined by FACScan analysis using mAb AZN-D2. One representative experiment out of three is shown. (C) Binding of different Lewis antigens coupled to PAA-bio to K562 cells expressing wild-type or mutant forms of L-SIGN and DC-SIGN. Cells were incubated with the PAA-bio-neoglycoconjugates in adhesion buffer for 30 min at 37ºC. After incubation with goat-anti-mouse streptavidin Alexa Fluor 488, the binding was measured by FACScan analysis as in Figure 2A, and shown as % of binding. One representative experiment out of three is shown.

Remarkably, the L-SIGN mutant S363V showed binding to Lex, in contrast to the wild

type L-SIGN (Figure 3C). The introduction of this Val residue also induced increased

binding of the L-SIGN S363V mutant to Lea, Leb and Ley (Figure 3C), and to S.

mansoni SEA (data not shown). The conversion of Val351 into a Gly in DC-SIGN (DC-

SIGN V351G) abrogated binding to all Lewis antigens. Similarly, the L-SIGN S363G

mutant showed no binding to any of the Lewis antigens tested (Figure 3C). These

Chapter 4 _

98

results demonstrate that cell-surface expressed L-SIGN and DC-SIGN differ in their

binding properties to Lex. Both lectins, however, show a functional similarity in their

capacity to bind to Lea, Leb and Ley glycan antigens, and their lack of binding to sLex.

Our data indicate that amino acid residue Val351 in DC-SIGN, which is lacking in L-

SIGN, is critically involved in the binding of DC-SIGN to Lex glycan structures.

Docking of Lewis x in DC-SIGN

To gain more insight in the molecular basis that determines the differences in

binding properties of DC-SIGN and L-SIGN to Lex, molecular modelling studies were

undertaken. Since DC-SIGN and L-SIGN have been crystallized with mannose-

containing oligosaccharides (17), but not with fucose containing ones, the possible

interactions of Lex with the CRD of DC-SIGN was determined first. Several binding

modes of fucose, or fucose-containing oligosaccharides, have been observed when

comparing crystal structures of the whole C-type lectin family. sLex is bound to E-

and P-selectin with oxygen O3 and O4 of fucose interacting with the calcium ion (33).

Alternatively, fucose and several sialyl and sulfo-Lex derivatives are bound to

mannose-binding protein (MBP) with O2 and O3 of fucose involved in calcium

coordination (34-36).

Four docking modes were tested in the present study for Lex interaction with DC-

SIGN: the two described above, and two additional ones, with inversion of the fucose

orientation (i.e. inversion of O4 and O3 in the first binding mode, and inversion of O2

and O3 in the second one). Only the two binding modes previously observed in C-type

lectins yielded stable interactions without steric or hydrophobic conflict (Figure 4).

Binding mode A, which corresponds to the interaction observed for sLex in E- and P-

selectin, is energetically favoured since it is stabilized by five hydrogen bonds

between the fucose and the protein, and an additional one between O6 of galactose

and an acidic group (Figure 5). This particular hydrogen bond is also observed in

selectins with a conserved glutamate residue (33). The second binding mode (Figure

4B), corresponding to sulfo and sLex in MBP mutants (35), only displays four

hydrogen bonds. Thus it is proposed that DC-SIGN and L-SIGN bind fucosylated

oligosaccharides with similar orientations as found in the selectins (Figure 4A).


99

Figure 4. Two proposed binding modes for Lex trisaccharide with DC-SIGN. Ribbon presentation of the binding modes of Lex trisaccharide to DC-SIGN. The bound calcium ions in the structure are represented as grey spheres. (A) Similar to the observed binding of sialyl-Lex in E-selectin (33). (B) Similar to the observed binding site of 3-sulfo-Lewis x in modified MBPA (35). All drawings were performed with the MOLSCRIPT program (37).

Docking of other oligosaccharides in DC-SIGN

Energy minimized structures of DC-SIGN in complex with Lex and Lea trisaccharides,

and Ley and Leb tetrasaccharides have been calculated. The six hydrogen bonds

described above are conserved in all of these complexes (Table 2). In addition,

hydrophobic contact can be predicted between galactose aliphatic groups and the

aromatic ring of the amino acid residue Phe313. Val351 of DC-SIGN is close to the

fucose binding site and makes strong hydrophobic contact with CH at position 1 and

2 of fucose. For Lex, the methyl group of GlcNAc is also involved in this hydrophobic

patch (Figure 5A), whereas for Lea, the CH2 of the hydroxymethyl group plays the

same role, albeit at slightly longer distance (Figure 5B). No additional contacts are

observed for Leb and Ley. This model is fully compatible with the observed binding of

DC-SIGN to all Lewis antigens. In addition, sLex has been docked in the binding site

of DC-SIGN with the same conformation as observed in E- and P-selectin crystals

(33). In the latter structures, the acidic group of NeuAc closely interacts with amino

acid residue Tyr48, allowing for the occurrence of a strong hydrogen bond between

the acidic group of NeuAc monosaccharide and the hydroxyl group of the Tyr.

However, in DC-SIGN the equivalent position is occupied by Phe313. There is no

favourable interaction between the acidic group of NeuAc and the hydrophobic

aromatic group of Phe313, which may explain the lack of binding of DC-SIGN to sLex.

Chapter 4 _

100

Docking of oligosaccharides in L-SIGN

The hydrophilic amino acids of the L-SIGN binding site are identical to the ones in

DC-SIGN, and the Lewis oligosaccharides can be docked with establishing the same

network of 6 hydrogen bonds (Table 2). The only difference is Ser363 that replaces

Val351 in DC-SIGN. The substitution of a Val by a Ser destroys the hydrophobic wall

that was adjacent to the fucose residue, and creates a hydrophilic pocket that is not

favourable for the methyl group of GlcNAc in Lex (Figure 5C). This may explain the

lack of binding of L-SIGN to Lex. However, when Lea is docked, Ser363 can establish a

hydrogen bond with the O6 of GlcNAc, thereby restoring part of the contacts that are

lost (Figure 5D), resulting in binding of Lea. Leb and Ley have been modeled and did

not present additional interactions compared to their corresponding trisaccharides

Lea and Lex, respectively (data not shown). Whereas this model explains binding of L-

SIGN to Leb, the observed binding of L-SIGN to Ley is not supported by the model

proposed.

Docking of oligosaccharides in mutant forms of L-SIGN and DC-SIGN

When Val351 of DC-SIGN is substituted by a Gly residue, the hydrophobic interaction

with the fucose residue is lost. Furthermore, the GlcNAc residue does not interact at

all with the protein surface in this mutant, neither for Lex, nor for Lea (Figure 5E and

F). The loop that contains this Gly appears to be stable in our calculations, but it

could have greater mobility in solution, which will be entropically unfavorable for the

binding of oligosaccharides. The same observations are made for the S363G mutant

in L-SIGN (data not shown). These data are compatible with the observed lack of

binding of both the DC-SIGN V351G and L-SIGN S363G mutant to all Lewis antigens.

By contrast, the L-SIGN S363V mutant displays the same strong hydrophobic

stabilization of the fucose and the methyl (or hydroxymethyl group) of GlcNAc as is

observed in DC-SIGN (data not shown), which corresponds with the observed

increase in binding of this mutant to all Lewis antigens and S. mansoni SEA.


101

Figure 5. Models of the interaction of DC-SIGN, L-SIGN and DC-SIGN/V351G with Lex and Lea. Models of the interaction of DC-SIGN with Lex (A) and Lea trisaccharides (B); L-SIGN with Lex (C) and Lea trisaccharides (D); and DC-SIGN (V351G) with Lex (E) and Lea trisaccharides (F). The calcium ion is represented by a grey sphere. Only the amino acids interacting directly with the sugars have been displayed.

Chapter 4 _

102

Table II Hydrogen bonds involved in the binding of Lewis oligosaccharides by DC-SIGN

and L-SIGN.

Discussion

L-SIGN and DC-SIGN contain a single carbohydrate recognition domain (CRD),

which mediates recognition of either self-glycoproteins or carbohydrate antigens on

pathogens (38,39). The CRDs of L-SIGN and DC-SIGN show a high amino acid

sequence identity, suggesting that their carbohydrate recognition profiles may be

similar. Recently we have demonstrated that DC-SIGN binds to Schistosoma

mansoni soluble egg antigens (SEA) through recognition of Lex antigens (15). Here

we show that L-SIGN binds to a different subset of SEA than DC-SIGN, and does not

bind Lex antigens. These data show for the first time a clear difference in binding

properties between L-SIGN and DC-SIGN, which may have important consequences

for their functions. In S. mansoni infections, egg antigens and their major glycan

antigen Lex are able to cause a switch toward TH2-mediated immune responses (40).

Although direct evidence is still lacking, we consider it possible that the interaction

between Lex and DC-SIGN may contribute to a shift in the TH1/TH2 balance in favor

of persistence of the pathogen. The binding of L-SIGN to SEA suggests that also this

C-type lectin could play an important role in the recognition of S. mansoni egg

antigens. However, the specific antigens within SEA that are involved in interaction

with L-SIGN as well as the functional relevance of this interaction need to be further

investigated.

Our previous studies suggested that amino acid residue Val351 in DC-SIGN may have

a crucial role in binding the Lex antigen (15). Here we show that mutation of Val351

into Gly in DC-SIGN not only abrogated binding of DC-SIGN to Lex, but also to Lea,


103

Leb and Ley glycan antigens. L-SIGN has Ser363 in the position equivalent to Val351 of

DC-SIGN. Remarkably, although L-SIGN does not bind to Lex, it shows binding to

other Lewis antigens. Docking of the Lewis oligosaccharides into molecular models of

the CRDs of L-SIGN and DC-SIGN indicated that the Lewis antigens most likely dock

in a mode similar to sLex in E-selectin (Figure 4). Apart from being energetically the

most favorable mode, only this mode is in agreement with the data demonstrating

that DC-SIGN and L-SIGN do not bind sLex. In the docking mode based on MBP-A,

sialic acid does not make any additional contacts compared to Lex, which would

predict binding of DC-SIGN and L-SIGN to both Lex and sLex and contradicts binding

studies.

From the proposed models it appears that Val351 in DC-SIGN is close to the fucose

binding site and makes a strong hydrophobic contact with CH at position 1 and 2 of

fucose. In L-SIGN the presence of a Ser instead of a Val creates a hydrophilic pocket

that is not favorable for the methyl group of GlcNAc in Lex, but can establish a

hydrogen bond with the O6 of GlcNAc. This may explain the observed differences of

L-SIGN binding to Lex and Lea. However, changing L-SIGN Ser363 into a Val not only

did allow binding to Lex but also increased binding to all Lewis antigens, showing that

a Val residue is favored for binding the fucose containing oligosaccharides in the CRD

domain.

All binding assays in this study have been performed with cells expressing the

recombinant C-type lectins or their mutant forms at the cell surface, where they may

be assembled into tetramers and interact with glycan ligands presented in

multivalent form (16). The models that show docking of Lex, Lea, Leb and sLex in the

CRDs of DC-SIGN, L-SIGN, and their mutant forms, correspond very well to the

observed results of the binding assays. However, comparison of the docking of Ley

with Lex in L-SIGN did not reveal additional interactions that would explain binding

of Ley, but not Lex, by L-SIGN. It is possible that either additional contacts between

Ley and the CRD of L-SIGN are introduced in the tetrameric form of L-SIGN, or that

more than one CRD is involved in the binding of the oligosaccharide, which may

result in another binding mode of Ley in L-SIGN than proposed from the model.

It is remarkable, that DC-SIGN and L-SIGN interact with such different

oligosaccharide ligands, i.e. high mannose-type N-glycans and Lewis antigens using

Chapter 4 _

104

the same region in their CRDs. Many of the amino acid residues that interact with the

mannose-type glycans, i.e. Phe313 Glu347, Asn349, Val351, Glu354 and Asn365 in DC-SIGN,

and their corresponding residues in L-SIGN (16), are proposed here to be also

involved in binding to the Lewis structures. Interestingly, these amino acid residues

clearly interact with different monosaccharides, and the individual importance of

each of these contacts in the binding pocket may vary dependent on the glycan

bound. Recently it was shown that mutating Gly346 in DC-SIGN abrogated gp120

binding but enhanced ICAM-2 and ICAM-3 binding (41), whereas mutation of Val351

abrogates binding to ICAM-3 and Lex, but not to HIV-1 gp120 (15, 28). Thus, DC-

SIGN appears to bind in a distinct but overlapping manner to gp120 when compared

to ICAM-2, ICAM-3, and Lex. Differential recognition of carbohydrate ligands by DC-

SIGN and L-SIGN will be crucially involved in the functional consequences of these

interactions, which may lead to either immune activation or immune suppression.

Detailed structural knowledge of the molecular interactions of DC-SIGN and L-SIGN

with their carbohydrate ligands may be exploited to develop strategies for immune

intervention, such as HIV-1 dissemination by DC-SIGN, or dendritic cell-induced

immunity.

References 1. Geijtenbeek, T. B., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Adema, G. J., Van Kooyk,

Y., and Figdor, C. G. (2000) Cell 100, 575-585 2. Geijtenbeek, T. B., Krooshoop, D. J., Bleijs, D. A., van Vliet, S. J., van Duijnhoven, G. C.,

Grabovsky, V., Alon, R., Figdor, C. G., and Van Kooyk, Y. (2000) Nat.Immunol. 1, 353-357 3. Geijtenbeek, T. B., Kwon, D. S., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Middel, J.,

Cornelissen, I. L., Nottet, H. S., KewalRamani, V. N., Littman, D. R., Figdor, C. G., and Van Kooyk, Y. (2000) Cell 100, 587-597

4. Lozach, P. Y., Lortat-Jacob, H., de Lacroix, d. L., Staropoli, I., Foung, S., Amara, A., Houles, C., Fieschi, F., Schwartz, O., Virelizier, J. L., Arenzana-Seisdedos, F., and Altmeyer, R. (2003) J.Biol.Chem. 278, 20358-20366

5. Pohlmann, S., Zhang, J., Baribaud, F., Chen, Z., Leslie, G. J., Lin, G., Granelli-Piperno, A., Doms, R. W., Rice, C. M., and McKeating, J. A. (2003) J.Virol. 77, 4070-4080

6. Alvarez, C. P., Lasala, F., Carrillo, J., Muniz, O., Corbi, A. L., and Delgado, R. (2002) J.Virol. 76, 6841-6844

7. Halary, F., Amara, A., Lortat-Jacob, H., Messerle, M., Delaunay, T., Houles, C., Fieschi, F., Arenzana-Seisdedos, F., Moreau, J. F., and Dechanet-Merville, J. (2002) Immunity 17, 653-664

8. Tassaneetrithep, B., Burgess, T. H., Granelli-Piperno, A., Trumpfheller, C., Finke, J., Sun, W., Eller, M. A., Pattanapanyasat, K., Sarasombath, S., Birx, D. L., Steinman, R. M., Schlesinger, S., and Marovich, M. A. (2003) J.Exp.Med. 197, 823-829

9. Geijtenbeek, T. B., van Vliet, S. J., Koppel, E. A., Sanchez-Hernandez, M., Vandenbroucke-Grauls, C. M., Appelmelk, B., and Van Kooyk, Y. (2003) J.Exp.Med. 197, 7-17

10. Maeda, N., Nigou, J., Herrmann, J. L., Jackson, M., Amara, A., Lagrange, P. H., Puzo, G., Gicquel, B., and Neyrolles, O. (2003) J.Biol.Chem. 278, 5513-5516


105

11. Tailleux, L., Schwartz, O., Herrmann, J. L., Pivert, E., Jackson, M., Amara, A., Legres, L., Dreher, D., Nicod, L. P., Gluckman, J. C., Lagrange, P. H., Gicquel, B., and Neyrolles, O. (2003) J.Exp.Med. 197, 121-127

12. Colmenares, M., Puig-Kroger, A., Pello, O. M., Corbi, A. L., and Rivas, L. (2002) J.Biol.Chem. 277, 36766-36769

13. Colmenares, M., Corbi, A. L., Turco, S. J., and Rivas, L. (2004) J.Immunol. 172, 1186-1190 14. Cambi, A., Gijzen, K., de Vries, J. M., Torensma, R., Joosten, B., Adema, G. J., Netea, M. G.,

Kullberg, B. J., Romani, L., and Figdor, C. G. (2003) Eur.J.Immunol. 33, 532-538 15. Van Die, I., van Vliet, S. J., Nyame, A. K., Cummings, R. D., Bank, C. M., Appelmelk, B.,

Geijtenbeek, T. B., and Van Kooyk, Y. (2003) Glycobiology 13, 471-478 16. Mitchell, D. A., Fadden, A. J., and Drickamer, K. (2001) J.Biol.Chem. 276, 28939-28945 17. Feinberg, H., Mitchell, D. A., Drickamer, K., and Weis, W. I. (2001) Science 294, 2163-2166 18. Appelmelk, B. J., Van Die, I., van Vliet, S. J., Vandenbroucke-Grauls, C. M. J. E., Geijtenbeek, T. B.

H., and Van Kooyk, Y. (2003) J Immunol 170, 1635-1639 19. Frison, N., Taylor, M. E., Soilleux, E., Bousser, M. T., Mayer, R., Monsigny, M., Drickamer, K., and

Roche, A. C. (2003) J.Biol.Chem. 278, 23922 20. Pohlmann, S., Soilleux, E. J., Baribaud, F., Leslie, G. J., Morris, L. S., Trowsdale, J., Lee, B.,

Coleman, N., and Doms, R. W. (2001) Proc.Natl.Acad.Sci.U.S.A 98, 2670-2675 21. Soilleux, E. J., Barten, R., and Trowsdale, J. (2000) J.Immunol. 165, 2937-2942 22. Bashirova, A. A., Geijtenbeek, T. B., van Duijnhoven, G. C., van Vliet, S. J., Eilering, J. B., Martin,

M. P., Wu, L., Martin, T. D., Viebig, N., Knolle, P. A., KewalRamani, V. N., Van Kooyk, Y., and Carrington, M. (2001) J.Exp.Med. 193, 671-67820.

23. Engering A, Van Vliet SJ, Hebeda K, Jackson DG, Prevo R, Singh SK, Geijtenbeek TB, van Krieken H, Van Kooyk Y (2004). Am J Pathol. 164, 1587-1595.

24. Knolle, P. A. and Gerken, G. (2000) Immunol.Rev. 174, 21-34 25. Nyame, A. K., Leppanen, A. M., DeBose-Boyd, R., and Cummings, R. D. (1999). Glycobiology 9,

1029-1035 26. Nyame, A. K., Lewis, F. A., Doughty, B. L., Correa-Oliveira, R., and Cummings, R.D. (2003).

Exp.Parasitol. 104, 1-13. 27. Geijtenbeek, T. B., Van Kooyk, Y., van Vliet, S. J., Renes, M. H., Raymakers, R. A., and Figdor, C.

G. (1999) Blood 94, 754-764 28. Geijtenbeek, T. B., van Duijnhoven, G. C., van Vliet, S. J., Krieger, E., Vriend, G., Figdor, C. G., and

Van Kooyk, Y. (2002) J.Biol.Chem. 277, 11314-11320 29. Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H., Shindyalov, I. N.,

and Bourne, P. E. (2000) Nucleic Acids Res. 28, 235-242 30. Clark, M., Cramer, R. D. I., and van den Opdenbosch, N. (1989) J. Comput. Chem. 10, 982-1012 31. Imberty, A., Mikros, E., Koca, J., Mollicone, R., Oriol, R., and Pérez, S. (1995) Glycoconj. J. 12, 331-

349 32. Imberty, A., Bettler, E., Karababa, M., Mazeau, K., Petrova, P., and Pérez, S. (1999) in Perspectives

in Structural Biology (Vijayan, M., Yathindra, N., and Kolaskar, A. S., eds), pp. 392-409, Indian Academy of Sciences and Universities Press, Hyderabad

33. Somers, W. S., Tang, J., Shaw, G. D., and Camphausen, R. T. (2000) Cell 103, 467-479 34. Ng, K. K., Drickamer, K., and Weis, W. I. (1996) J. Biol. Chem. 271, 663-674 35. Ng, K. K., and Weis, W. I. (1997) Biochemistry 36, 979-988 36. Ng, K. K., Kolatkar, A. R., Park-Snyder, S., Feinberg, H., Clark, D. A., Drickamer, K., and Weis, W.

I. (2002) J. Biol. Chem. 277, 16088-16095 37. Kraulis, P. (1991) J. Appl. Crystallogr. 24, 946-950 38. Geijtenbeek, T.B., Van Vliet, S.J., Engering, A., ’T Hart, B.A., Van Kooyk, Y. (2004). Annu Rev

Immunol. 22, 33-54 39. Van Die, I., Engering, A. and Van Kooyk, Y. (2004) TIGG, in press 40. Okano, M., Satoskar,A.R., Nishizaki,K., and Harn, D.A. (2001) J Immunol 167, 442-450 41. Su, S.V, Hong, P, Baik, S., Negrete,O.A., Gurney, K.B., Lee, B.(2004) J Biol Chem 279, 19122-32

DC-SIGN mediates adhesion and rolling of dendritic cells on primary human umbilical vein endothelial cells through Lewis y antigen expressed on ICAM-2

Juan Jesús García Vallejo, Ellis van Liempt, Paula da Costa Martins,

Cora M.L. Beckers, Bert van het Hof, Sonja I. Gringhuis, Jaap-Jan

Zwaginga, Willem van Dijk, Teunis B.H. Geijtenbeek, Yvette van

Kooyk and Irma van Die

Submitted

Chapter 5

DC-SIGN binds LewisY present on ICAM-2

109

Abstract

Immature dendritic cells (DCs) are recruited from blood into tissues to patrol for

foreign antigens. After antigen uptake and processing, DCs mature and migrate to the

secondary lymphoid organs where they initiate immune responses. DC-SIGN is a DC-

specific C-type lectin that acts both as a pattern recognition receptor and as an

adhesion molecule. As an adhesion molecule, DC-SIGN is able to mediate rolling and

adhesion over endothelial cells under shear flow. The binding partner of DC-SIGN on

endothelial cells is the carbohydrate epitope LewisY (LeY), expressed on ICAM-2.

ICAM-2 expressed on CHO cells only served as a ligand for DC-SIGN when properly

glycosylated, underscoring its function as a scaffolding protein. The expression of LeY

on endothelial cells is directed by the enzyme FUT1. Silencing of FUT1 results in an

inhibition of the rolling and adhesion of immature DCs over endothelial cells. The

identification of LeY as the carbohydrate ligand of DC-SIGN in endothelial cells opens

new possibilities for the manipulation of DC migration.

Chapter 5 _

110

Introduction

Dendritic cells (DC) have a key role in the control of immunity by surveying

peripheral tissues in the search for pathogens (1). In order to create a network of

tissue-resident DCs, precursor DCs continuously migrate from the blood into

peripheral tissues, where they are highly efficient in capturing and processing

antigens as immature DCs (2, 3). Once activated, immature DCs mature and migrate

from the peripheral tissues to secondary lymphoid organs in order to interact with

specific T-cells and initiate an immune response (1). The molecular basis for the

migratory capacity of DCs is starting to be unraveled (4, 5), and several molecules

have been described to be involved, such as DC-SIGN (6), MR (7, 8), and selectins

(4). DC-SIGN (CD209) is a C-type lectin expressed by precursor and immature DCs

that was primarily identified through its high affinity interaction with ICAM-3 (9). In

addition, DC-SIGN also functions as an HIV-1 trans-receptor important in the

dissemination of HIV-1 (10). Importantly, DC-SIGN mediates rolling and adhesion of

precursor DC over the endothelium, which is suggested to be mediated through

interactions with ICAM-2 (6).

Thus DC-SIGN appears as a molecule with a dual role, acting as a pattern recognition

receptor and as an adhesion molecule. As a pattern recognition receptor, the

carbohydrate specificity of DC-SIGN has been carefully evaluated. It is now clear that

DC-SIGN is able to recognize high-mannose type N-glycans, as well as

glycoconjugates carrying non-sialylated, non-sulfated Lewis antigens (11-16). This

relatively large recognition profile converts DC-SIGN into a sort of broad-spectrum

pattern recognition receptor. Many pathogens have been found to be recognized and

internalized by DC-SIGN (4) and, although this mechanism is meant to allow the

development of an immune response, often is used by the pathogen to escape

immune surveillance (17). As an adhesion molecule, however, the identity of the

endogenous carbohydrate ligand(s) of DC-SIGN, especially in endothelial cells, still

remains inconclusive.

The present study was undertaken to identify the DC-SIGN ligands that are crucial

for the adhesion and rolling of dendritic cells on endothelial cells. We show here that

ICAM-2 expressed on endothelial cells constitutes the major scaffold protein ligand

for DC-SIGN. Importantly, the interaction of DC-SIGN with ICAM-2 is carbohydrate-


111

dependent, and we provide evidence that LeY antigens within ICAM-2 are of crucial

importance for the binding of DC-SIGN to endothelial cells, as well as for the rolling

and adhesion of dendritic cells over endothelial cells.

Materials and Methods

Cell lines and primary cells Human umbilical vein endothelial cells (HUVEC) were

isolated from 5 healthy donors by a modification of the method of Jaffe et al (18), as

previously described (19). The cells were resuspended in M199 (Biowhittaker, USA)

supplemented with 100 U/mL Penicilin-Streptomycin (Biowhittaker, USA), 10 %

human serum (Biowhittaker, USA), 10 % new born calf serum (Biowhittaker, USA), 5

U/ml heparin (Leo Pharmaceutical Products, The Netherlands), and 150 μg/mL

bFGF (Sigma, The Netherlands) and plated in gelatin coated plates. The cells were

cultured to confluency in the mentioned media in a 5 % CO2 atmosphere at 37 °C.

When confluency was reached, cells were trypsinized (0.18 % trypsin, 10 mM EDTA)

and plated again to 1/3 of their density. All endothelial cells used displayed the

presence of Von Willebrand factor, platelet endothelial cell adhesion molecule-1

(CD31), and VE-Cadherin (20). No immunoreactivity to the anti-cytokeratin 20

antibody or the anti-α-smooth muscle actin antibody was observed.

Chinese Hamster Ovary (CHO) cells were cultured in RPMI-1640 (Gibco BRL, USA)

supplemented with 10% FCS and 100 U/ml Penicillin-Streptomycin. Where

indicated, cells were cultured during 5 days in the presence of kifunensine

(Kitasatosporia kifunense, 2 μg/ml; Calbiochem, USA). Efficiency of treatment was

assessed by flow cytometry analysis using Con A as described under Flow cytometry.

Immature DCs were obtained from a buffycoat as previously described (21). In short,

human peripheral blood mononuclear cells (PBMCs) were isolated from a buffycoat

by a Ficoll gradient and followed by a CD14 magnetic microbeads isolation (MACS;

Miltenyibiotec, USA). The obtained CD14+ monocytes were differentiated into

immature DCs in the presence of interleukine-4 and granulocyte-macrophage colony

stimulating factor (500 and 800 U/ml, respectively; Schering-Plough, Belgium). At

day 6, the phenotype of the cultured DCs was confirmed by flow cytometric analysis.

Chapter 5 _

112

The immature DCs expressed high levels of major histocompatibility complex class I

and II, CD11b, CD11c, and ICAM-1; and low levels of CD80 and CD86.

Western blotting DC-SIGN-Fc consists of the extracellular portion of DC-SIGN

(amino acid residues 64-404) fused at the C-terminus to a human IgG1-Fc fragment

into the Sig-pIgG1-Fc vector (22). DC-SIGN-Fc was produced in Chinese hamster

ovary K1 cells by cotransfection of DC-SIGN-Sig-pIgG1 Fc (20 μg) and pEE14 (5 μg)

vector. DC-SIGN-Fc concentrations in the supernatant were determined by an anti-

IgG1 Fc ELISA. Cells were grown to confluency in a T175 flask (Corning, USA),

washed and resuspended in TSM, and lysed in 0.1 M Tris-HCl (pH 7.4), 0.05 M

CHAPS. Lysate was centrifuged and the supernatant incubated with DC-SIGN-Fc (0.5

mg/ml) at 4 °C in a rotating device (18 h). Subsequently, 20 μl protA/G-agarose

beads (Santa Cruz, USA) were added and incubated at 4 °C in a rotating device (4 h).

The beads were washed twice in TSM, resuspended in Laemmli sample buffer and

incubated at 95°C for 5 minutes prior to resolving in 10 % SDS-PAGE, according to

Laemmli (23).

After electrophoresis, the gel was blotted on to a PVDF (Millipore, The Netherlands)

membrane and stained with DC-SIGN-Fc or mouse anti-human-ICAM-2 (12A2)

using peroxidase-labeled goat anti-human (Jackson, USA) and rabbit anti-mouse

immunoglobulins (DakoCytomation, Denmark). The membrane was developed using

SuperSignal WestPico Chemiluminescence substrate (Pierce, USA) and the

chemiluminescence detected in an Epi Chemi II Darkroom (UVP, USA) using the

Labworks (UVP, USA) software.

Transient transfection of CHO cells Cells were incubated until 50-80 % confluent.

The transfection was performed according to the manufacturer’s protocol. In short,

both DNA (5 μg pcDM8-ICAM2 or pcDNA1-FUT4) and LipofectAMINE (Gibco BRL,

USA) were diluted in serum free medium and combined. After 30 min the cells were

washed with serum free medium and the complex solution was added to the cells.

After 5 h serum-enriched medium (20 %) was added. The medium was replaced with

fresh, complete medium 24 h after transfection. 24 h later the cells (5·104) were

resuspended, washed with TSM and analyzed by flow cytometry as indicated under


113

Flow cytometry. Alternatively, cells (106) were lysed in 0.1 M Tris-HCl (pH 7.4), 0.05

M CHAPS and analyzed by ELISA as indicated under ELISA.

Capture ELISA Goat anti-mouse-Fc was coated on ELISA plates (Nunc, USA; 2

μg/ml, 100 μl/well), followed by mouse anti-human ICAM2 (12A2) antibodies (1

μg/ml, 50 μl/well). Plates were blocked with 1 % ELISA grade BSA (Fraction V, Fatty

acid free; Calbiochem, USA), cell lysates were added, and incubated overnight at 4 °C.

After washing, the wells were incubated with DC-SIGN-Fc (5 μg/ml), anti-LewisY (5

μg/ml , clone F3, Calbiochem, USA) and digoxin-labeled Con A (5 μg/ml, Roche,

Switzerland), in the presence or absence of 50 mM α-D-CH3-Mannose/α-D-CH3-

Glucose (both Sigma, The Netherlands). Binding was detected using a peroxidase

labeled anti-human IgG-Fc, goat anti-mouse IgM (both Jackson, West Grove, PA) or

sheep anti-digoxin (Roche, Switzerland), respectively. Color development after

adding POD substrate (Roche, Switzerland) was measured in a spectrophotometer

(BioRad, USA) at 410 nm.

Flow cytometry Cells were washed twice in cold TSM (20 mM Tris, pH 7.4, 150 mM

NaCl, 1 mM CaCl2 and 2 mM MgCl2), resuspended in 1 % BSA/TSM and incubated 30

minutes at room temperature with 25 μL of 1 % BSA-TSM diluted primary

antibody/lectin (10 μg/ml), washed twice with TSM and incubated 30 minutes at

room temperature with secondary antibody according to manufacturers instructions.

After the second incubation, cells were washed twice with PBS and resuspended in a

final volume of 100 μL 1 % BSA/TSM for analysis in the FACS-Calibur (Becton-

Dickinson, USA). The primary monoclonal antibodies (mouse IgM) used were

specific for LewisX (DakoCytomation, Denmark), LewisY (clone F3, Calbiochem,

USA), Lewisa (clone T174, Calbiochem, USA), Lewisb (clone T128, Calbiochem, USA).

The lectins used were Con A (concanavalin A, digoxin-labeled, Roche, Switzerland),

UEA-I (Ulex europaeus agglutinin, biotin-labeled, EY Labs, USA), and AAL (Aleuria

aurantia, digoxin-labeled, Roche, Switzerland). The anti-carbohydrate antibodies,

were counter-stained with Alexa 488-labeled goat-anti-mouse secondary antibody

(Molecular Probes, The Netherlands). For the secondary staining of the biotin-labeled

lectins Alexa 488-streptavidin (Vector Laboratories, USA) and FITC-labeled anti-

digoxin (Sigma, USA) were used. Cells were analyzed for immunofluorescence on a

Chapter 5 _

114

FACS-Calibur flow cytometer by collecting data for 104 cells per histogram.

Corresponding negative controls were performed by omitting the antibody or lectin of

interest.

mRNA isolation and cDNA synthesis mRNA was isolated by capturing of poly(A+)

RNA in streptavidin-coated tubes with an mRNA Capture kit (Roche, Switzerland)

and cDNA was synthesized with the Reverse Transcription System kit (Promega,

USA) following manufacturer’s guidelines. Cells (2·105/well) were washed twice with

ice-cold PBS and harvested with 200 μL of lysis buffer. Lysates were incubated with

biotin-labeled oligo(dT)20 for 5 min at 37 ºC and then 50 μL of the mix were

transferred to streptavidin-coated tubes and incubated for 5 min at 37 ºC. After

washing 3 times with 250 μL of washing buffer, 30 μL of the reverse transcription

mix (5 mM MgCl2, 1x reverse transcription buffer, 1 mM dNTP, 0.4 U recombinant

RNasin ribonuclease inhibitor, 0.4 U AMV reverse transcriptase, 0.5 μg random

hexamers in nuclease-free water) were added to the tubes and incubated for 10 min at

room temperature followed by 45 min at 42 ºC. To inactivate AMV reverse

transcriptase and separate mRNA from the streptavidin-biotin complex, samples

were heated at 99 ºC for 5 min, transferred to microcentrifuge tubes and incubated

on ice for 5 min, diluted 1:2 in nuclease-free water and stored at –20 ºC until

analysis.

Quantitative real-time PCR Oligonucleotides (Table 1) have been designed by using

the computer software Primer Express 2.0 (Applied Biosystems, USA). All

oligonucleotides were synthesized by Invitrogen (Invitrogen, Belgium).

Oligonucleotide specificity was computer tested (BLAST, NCBI) by homology search

with the human genome and specifically, with all the known galactosyltransferases

(CLUSTALW, EMBL), and later confirmed by dissociation curve analysis and

resolving the PCR products in agarose electrophoresis. In the case of FUT3, FUT5

and FUT6, genes with a high homology, the specificity of the primers was tested using

plasmids (kindly provided by Dr. JB Lowe) encoding for each of the fucosyltrans-

ferases. The efficiency (24) of the oligonucleotides was determined using the

computer program LinReg (25) and resulted in an average of 90 %. PCR reactions

were performed with the SYBR Green method in an ABI 7900HT sequence detection

system (Applied Biosystems, USA). The reactions were set on a 96 well-plate by


115

mixing 4 μL of the 2 times concentrated SYBR Green Master Mix (Applied

Biosystems, USA) with 2 μL of a oligonucleotide solution containing 5 nmol/μL of

both oligonucleotides and 2 μL of a cDNA solution corresponding to 1/60 of the

cDNA synthesis product. The thermal profile for all the reactions was 2 min at 50 ºC,

followed by 10 min at 95 ºC and then 40 cycles of 15 sec at 95 ºC and 1 min at 60 ºC.

The fluorescence monitoring occurred at the end of each cycle. Additionally,

dissociation curve analysis was performed at the end of every run by increasing the

temperature of the block from 60 to 95 ºC at a rate of 1.75 ºC/min while continuously

monitoring fluorescence. The plot of the first derivative of the decrease in

fluorescence with respect to temperature showed in all cases one single peak at the

Tm predicted by the Primer Express 2.0 software. The Ct value is defined as the

number of PCR cycles where the fluorescence signal exceeds the detection threshold

value, which is fixed above 10 times the standard deviation of the fluorescence during

the first 15 cycles and typically corresponds to 0.2 relative fluorescence units. This

threshold is set constant throughout the study and corresponds to the log linear range

of the amplification curve. The normalized amount of target, or relative abundance

(26), reflects the relative amount of target transcripts with respect to the expression

of the endogenous reference gene. Due to the low expression of glycosyltransferases,

the results are shown as 100-times the relative abundance. In this study, the

endogenous reference gene chosen was GAPDH, based on previous results (19).

RNA interference The mammalian expression vector, pSUPER.retro.puro (27, 28) (a

kind gift of Dr. R. Agami, Netherlands Cancer Institute, Amsterdam, The

Netherlands) was used for expression of siRNA in HUVEC. The gene-specific insert

identifies a 19-nucleotide sequence corresponding to nucleotides 272-291

(tcagatgggacagtatgcc) of FUT-1 (NM_000148), nucleotides 362-381

(gacgacctacccgatagat) of FX (NM_003313), or the sequence 5’-ctgaatgaatcgtgacacg

with no significant similarity to any human gene sequence, therefore used as a non-

silencing control. The gene-specific insert was separated by a 9-nucleotide non-

complementary spacer (ttcaagaga) from the reverse complement of the same 19-

nucleotide sequence, and flanked by restriction sites for the enzymes Bgl II and Hind

III, producing a final insert of 60 nucleotides. These sequences were inserted into the

pSUPER.retro.puro backbone. The different vectors were referred to as

pSUPER/FUT-1, pSUPER/FX, and pSUPER/Scrambled, respectively. Plasmids were

Chapter 5 _

116

transfected into HUVEC using the Basic Nucleofector Kit for Primary Mammalian

Endothelial Cells (Amaxa, Germany) in an Amaxa Nucleofector (Amaxa, Germany),

according to manufacturer´s instructions. Immediately after transfection, cells were

seeded in glass coverslips coated with crosslinked gelatin (1 %) and fibronectin (5

mg/ml). Transfection efficiency was higher than 90 % as evaluated by flow cytometry

analysis of HUVEC co-transfected pmax/GFP (Amaxa, Germany) and the different

pSUPER constructs (data not shown). To test the efficiency of RNA interference, cells

were lysed after 48 h, mRNA isolated (mRNA Capture Kit, Roche, Switzerland) and

retrotranscribed into cDNA (Reverse Transcription System, Promega, USA),

according to manufacturer’s instructions. Gene expression of FUT-1, FX, and ICAM-2

was assessed by means of quantitative real-time PCR in an ABI 7900HT platform

(Applied Biosystems, USA) using the SYBR Green I chemistry (Applied Biosystems,

USA), as previously described (19), using the primers described in Table 1. The

silencing resulted in a decrease in gene expression higher than 80 % (data not

shown).

Table 1. Oligonucleotides used in the present study.

Gene GeneID Oligonucleotides

GAPDH 2597 Fwd: aggtcatccctgagctgaacgg Rev: cgcctgcttcaccaccttcttg

FX 7264 Fwd: agccatccagaaggtggtagc Rev: gacgtgtgtgggttggacc

FUT1 2523 Fwd: gcaggccatggactggtt Rev: cctgggaggtgtcgatgttt

FUT2 2524 Fwd: ctcgctacagctccctcatctt Rev: cgtgggaggtgtcaatgttct

FUT3 2525 Fwd: ccagtgggtcctcccga Rev: gccatgtccatagcaggatca

FUT4 2526 Fwd: gagctacgctgtccacatcacc Rev: cagctggccaagttccgtatg

FUT5 2527 Fwd: gtcccgagacgatgccact Rev: ccggtgacaggttccactg

FUT6 2528 Fwd: atcccactgtgtaccctaatgg Rev: tgccaggcaccatctctgag

FUT7 2529 Fwd: tccgcgtgcgactgttc Rev: accctcaaggtcctcatagacttg

FUT8 2530 Fwd: tcttcatccccgtcctcca Rev: gagacacccaccacactgca

FUT9 10690 Fwd: caaatcccatgcagttctgatc Rev: gtggcctagcttgctgaggta

Immature DC perfusion and evaluation of adhesion and rolling velocity

Immature DCs in suspension (2·106 cells/ml in incubation buffer) were aspirated

from a reservoir through plastic tubing and perfused through a chamber with a

Harvard syringe pump (Harvard Apparatus, South Natic, MA). The flow rate through

the chamber was precisely controlled and the immature DCs were perfused over


117

endothelial cells at 0.8 dyn/cm2. During perfusions the flow chamber was mounted

on a microscope stage (Axiovert 25, Zeiss, Germany), equipped with a B/W CCD

video camera (Sanyo, Osaka, Japan), and coupled to a VHS video recorder (29, 30).

Video images were evaluated for the number of adherent monocytes and the rolling

velocity per cell, with dedicated routines made in the image analysis software

Optimas 6.1 (Media Cybernetics Systems, Silverspring, MD, USA). The immature

dendritic cells that were in contact with the surface appeared as bright white-centered

cells after proper adjustment of the microscope during recording. The number of

surface-adherent immature dendritic cells was measured after 5 min of perfusion at a

minimum of 25 randomized high-power fields. To automatically determine the

velocity of rolling cells, custom-made software was developed in Optimas 6.1. A

sequence of 50 frames representing an adjustable time interval (δt, with a minimal

interval of 80 milliseconds) was digitally captured. The position of every cell was

detected in each frame, and for all subsequent frames the distance traveled by each

cell and the number of images in which a cell appears in focus was measured. The

cut-off value to distinguish between rolling and static adherent cells was set at 1

μm/s. With this method, static adherent, rolling and free flowing cells (which were

not in focus) could be clearly distinguished.

Results

ICAM-2 is the major DC-SIGN ligand on endothelial cells

Precursor DCs continuously traffic to peripheral tissues (1). The migration process is

highly dependent on the interaction of DC-SIGN with its ligand. In earlier studies,

ICAM-2 was identified as a ligand for DC-SIGN that supports binding under shear

stress conditions using a chimeric construct produced in CHO cells (ICAM-2-Fc) (6).

To identify counter receptors for DC-SIGN on primary endothelial cells, chimeric DC-

SIGN-Fc protein was used to immunoprecipitate ligands from a HUVEC cell lysate of

which the surface proteins had been labeled by biotin. Subsequently, the

immunoprecipitate and the supernatant were subjected to SDS-PAGE under reducing

conditions, and the isolated proteins analyzed by western blot. As shown in Fig 1A

and Fig 1C, the major surface-labeled protein that was selectively precipitated by DC-

SIGN-Fc has an apparent molecular weight of 55-60 KDa, which coincides with the

molecular weight of ICAM-2 (31, 32). The selective precipitation of ICAM-2 could be

Chapter 5 _

118

confirmed after western blotting analysis using an anti-ICAM-2 antibody for

immunodetection (Fig. 1B).

Figure 1. DC-SIGN binds to ICAM-2 in endothelial cells. HUVECs were labeled with biotin prior to lysis. DC-SIGN ligands were immunoprecipitated in a HUVEC lysate by incubation with DC-SIGN-Fc and Prot-A/G agarose beads as described in Materials and Methods. A. 10 % SDS-PAGE. One major band of approximately 55-60 KDa was detected in the immunoprecipitated fraction. B. Western Blot, immunodetection with anti-ICAM-2 antibody (12A2). The main immunoprecipitated band corresponds to ICAM-2. C. Western Blot, immunodetection with Streptavidin. The immunoprecipitated band identified as ICAM-2, is present in the extracellular membrane of HUVECs. Results are representative of 3 experiments.

DC-SIGN–ICAM-2 interaction is carbohydrate-dependent

ICAM-2 is also a ligand for LFA-1 and this interaction is carbohydrate-independent

(33). To investigate whether the DC-SIGN–ICAM-2 interaction is carbohydrate

dependent, CHO cells were transfected with a cDNA coding for ICAM-2, and either

grown in the presence of kifunensine or co-transfected with a cDNA coding for FUT4.

Kifunensine is an α-mannosidase I inhibitor that stops the processing of N-glycans at

the Man9-GlcNAc2-Asn stage (34). Cells grown in the presence of kifunensine

produce mainly high-mannose type N-glycans. FUT4 is an α1,3-fucosyltransferase

implicated in the synthesis of LeX (35). Both LeX and high-mannose N-glycans are

recognized by DC-SIGN (11, 13).


119

Figure 2. The DC-SIGN–ICAM-2 interaction is carbohydrate dependent. CHO cells were transfected with the plasmid pcDM8-ICAM-2 and either left untreated, treated with kifunensine or co-transfected with the plasmid pcDNA1-FUT4. Untreated or kifunensine-treated mock transfectant were used as controls. A. Flow cytometry analysis using an anti-ICAM-2 antibody (12A2) or the DC-SIGN-Fc chimeric protein (+ EDTA as a negative control). Gray lines denote the isotype control, while solid areas represent the staining with the above mentioned antibody or chimeric molecule. B. The binding of DC-SIGN-Fc, Con A and anti-LeX to ICAM-2 captured from the CHO cells transfected with the plasmid pcDM8-ICAM-2 was analyzed by ELISA in plates coated with the antibody 12A2. Results are representative of 3 experiments.

As shown in Fig. 2A, the DC-SIGN-Fc chimera does not bind to ICAM-2 expressed in

untreated cells, whereas it binds with high affinity to ICAM-2 expressing CHO cells

that were grown in the presence of kifunensine. Remarkably, DC-SIGN-Fc also

recognized glycoproteins other than ICAM-2 on the CHO cells that were grown in the

presence of kifunensine, as can be observed in the mock transfected CHO cells. In an

ICAM-2–immobilizing ELISA (Fig. 2B), we could show that the kifunensine

treatment resulted in an ICAM-2 population that showed increased binding of the

lectin Con A, as well as an increased DC-SIGN-Fc binding (Fig. 2B).

The co-transfection with FUT4 also resulted in an increase in the binding of DC-

SIGN-Fc, which correlated with an increase in the expression of LeX-containing

Chapter 5 _

120

ICAM-2 (Fig. 2A and B). Together, these data demonstrate that binding of DC-SIGN-

Fc to ICAM-2 is strictly carbohydrate dependent, and that the glycosylation potential

of the cells expressing ICAM-2 determines whether or not ICAM-2 can function as a

counter receptor for DC-SIGN.

ICAM-2 carries LeY in endothelial cells

In order to explore the glycosylation of ICAM-2 in endothelial cells, HUVECs were

analyzed by flow cytometry, ELISA, and western blotting. Using antibodies specific

for the Lewis antigens LeX, LeY, Lea, and Leb, it was demonstrated that HUVEC

expressed significant amounts of LeY (Fig 3A). Presence of the other Lewis antigens

could not be detected on HUVECs, whereas all antibodies showed specific binding to

control neoglycoconjugates expressing the respective Lewis antigens (data not

shown). Con A was also able to bind to endothelial cells (Fig. 3A). Con A recognizes

unsubstituted hydroxyl groups in mannose, as those present in high-mannose

structures, hybrid-type N-glycans and diantennary N-glycans (with this order of

affinity) (36, 37). Using increasing concentrations of methyl-mannoside it is possible

to discriminate whether Con A binds to the high affinity ligand (high-mannose

glycans) or to the low affinity ligands (diantennary N-glycans). A priori, as indicated

by previous in vitro studies (11, 13), both LeY and mannose-rich structures are

potential ligands for DC-SIGN.

To identify the carbohydrates present in ICAM-2, immobilized ICAM-2 from an

endothelial cell extract was tested for binding with anti-LeY antibodies and Con A in

ELISA. The data in Fig. 3B show that both anti-LeY antibodies and Con A bound to

the captured ICAM-2. Binding of Con A, however, could be completely abolished by

addition of low concentrations of methyl-mannoside (Fig. 3B), indicating that the low

affinity Con A-reactive glycans on ICAM-2 most likely correspond to diantennary N-

glycans, rather than high-mannose type N-glycans. This indicates that LeY most likely

represents the ligand for DC-SIGN on ICAM-2. Interestingly, there are other

glycoproteins on HUVEC carrying the LeY carbohydrate epitope (Fig. 3C), however,

they do not support an interaction with DC-SIGN, as previously shown (Fig. 1).


121

Figure 3. Endothelial cells express LeY and Con A-reactive epitopes. A. HUVEC were grown to confluency, mechanically detached, incubated with the corresponding lectin or antibody, and analyzed by flow cytometry. Gray lines denote the isotype control, while solid areas represent the staining with the above mentioned lectin or antibody. B. Alternatively, HUVEC were lysed and the binding of DC-SIGN-Fc (+ EDTA as a negative control), anti-LeY, Con A, and Con A + 50 mM methyl-mannoside to captured ICAM-2 was analyzed by ELISA in plates coated with anti-ICAM-2 (12A2). C. HUVEC were lysed, resolved by SDS-PAGE and blotted onto a PVDF membrane. The membrane was stained with an anti-LeY antibody (F3). Results are representative of 3 experiments.

HUVEC express FUT1 and FUT4 as the main α2- and α3-fucosyltransferases,

respectively

The expression of fucosylated carbohydrates depends upon the expression of

fucosyltransferases (38). To identify the fucosyltransferases that are involved in the

synthesis of LeY structures in HUVEC, a highly sensitive and specific real-time PCR

assay was designed. Special care was taken to design oligonucleotides able to

discriminate FUT3, FUT5 and FUT6, which have a large sequence identity. Plasmids

encoding for FUT3, FUT5 and FUT6 were used as positive control (data not shown).

The results showed significant mRNA levels for only three fucosyltransferase genes in

HUVEC. Amongst them, FUT4, which encodes an α3-fucosyltransferase involved in

the synthesis of Lewis-type structures, as well as the VIM-2 antigen (35), and FUT1

Chapter 5 _

122

that encodes an α2-fucosyltransferase (39), can contribute to the biosynthesis of LeY.

The third fucosyltransferase, FUT8, encodes for an α6-fucosyltransferase that

catalyzes the transfer of fucose to the first N-acetylglucosamine of the chitobiose core

of an N-glycan (40).

Figure 4. Fucosyltransferase gene expression profile. HUVEC were grown to confluency and assayed for the expression of a panel of fucosyltransferases (FUT1-9) using real-time PCR. GAPDH was used as an endogenous reference. Results are shown as the average ± SE of 5 experiments.

DC-SIGN interacts with the LeY structure on ICAM-2 expressed by endothelial cells

Based on the fucosyltransferase gene expression profile, FUT1 was the a priori

candidate to direct the synthesis of the DC-SIGN ligand LeY in HUVEC. To further

investigate this point, a silencing approach was followed (27, 28) to knock down the

expression of the enzymes that are expected to be crucial for the synthesis of LeY.

HUVECs were transfected with either pSUPER/Scrambled (non-silencing control),

pSUPER/FX or pSUPER/FUT-1. The plasmid pSUPER/FX targets the expression of

the gene FX, which encodes GDP-4-keto-6-deoxymannose 3,5-epimerase-4-

reductase, one of the enzymes necessary for the synthesis GDP-fucose from GDP-

mannose (41, 42). This pathway accounts for the vast majority of cellular GDP-fucose

production (43). GDP-fucose is the sugar donor used in the reactions catalyzed by

fucosyltransferases. In the absence of this enzyme, the pool of GDP-Fucose can be

rescued by adding fucose to the culture media, which is then metabolized to GDP-

Fucose via the salvage pathway (44). The efficiency of the silencing was evaluated by

assessing the transcript levels of FX and FUT-1 in HUVECs transfected with the

pSUPER/Scrambled plasmid, pSUPER/FX, or pSUPER/FUT-1 (Fig. 5A) and by flow

cytometric analysis of the transfected HUVEC using an anti-LeY antibody (data not

shown). As shown in Fig. 5B, the rolling velocity of immature DCs on a cell-layer of


123

primary HUVEC is increased when either FX or FUT1 were silenced. Simultaneously,

the tethering and adhesion (C) of the immature DCs to HUVEC is decreased. The

degree of increase in rolling velocity and decrease in tethering and adhesion was to

the same extend as was achieved using the monoclonal antibody AZN-D1, which is a

DC-SIGN blocking antibody. Furthermore, the effects obtained with pSUPER/FX

could be rescued by adding fucose to the HUVECs.

Figure 5. The binding of DC-SIGN to ICAM-2 in endothelial cells is blocked by silencing the expression of LeY using RNA interference. (A) The expression of FX and FUT-1 was reduced to less than 30 %. The rolling velocity (B) and adhesion (C) of monocyte-derived DCs over the transfected HUVEC was measured as indicated in Materials and Methods. Results are shown as the average ± SE of 3 experiments.

Discussion

Immature DCs use DC-SIGN as an adhesion molecule to recognize a counter-receptor

in endothelial cells. As a result of this interaction, immature DCs tether and adhere to

endothelial cells, starting the migration to the underlying tissue. In this study we have

shown that ICAM-2 expressed in endothelial cells constitutes the major scaffold

protein ligand for DC-SIGN. Furthermore, we have demonstrated that LeY present on

ICAM-2 acts as the major carbohydrate ligand that mediates DC-SIGN adhesion and

tethering to HUVEC.

ICAM-2 was identified as the major endothelial ligand for DC-SIGN employing a DC-

SIGN-Fc immune precipitation from HUVEC lysates (Fig. 1). Although the main

Chapter 5 _

124

visible band is situated around 55-60 KDa (Fig. 1A), coinciding with ICAM-2 as

detected by Western-Blot (Fig. 1B), two other minor bands (molecular weight > 100

KDa) are visible that are surface located (Fig. 1C), indicating that other proteins

expressed by HUVEC may contribute to the binding. It was also demonstrated that

the ICAM-2–DC-SIGN interaction is carbohydrate-dependent, as ICAM-2 expressed

in CHO cells is only able to be recognized by DC-SIGN when is properly glycosylated,

excluding an integrin-like interaction (Fig. 2). This system illustrates a complex

model in which both interaction partners perform dual functions, DC-SIGN as a

pattern-recognition receptor and an adhesion molecule, and ICAM-2 as an integrin

and a scaffold molecule for a lectin-ligand.

In this study, we have identified LeY as the major carbohydrate ligand for DC-SIGN

on endothelial cell-expressed ICAM-2, as is suggested by the flow cytometry analysis

of endothelial cells, and further demonstrated by an ICAM-2 specific capture ELISA

(Fig. 3), and the FUT-1 silencing experiments (Fig. 5). Recently, it was published that

ICAM-2 presents high-mannose N-glycans, which serve as carbohydrate ligands for

DC-SIGN (45). However, the work of Jiménez et al. has a serious technical

disadvantage, the conclusions are based on ICAM-2 produced in large amounts in

COS cells. It is very well known that glycosylation is a species and cell-type specific

property (46-48). This has also been evidenced in this study (Fig. 2). Additionally,

our rolling/adhesion assays demonstrate that fucosylation is essential for the rolling

and adhesion of monocyte-derived DCs (Fig. 5). Additionally, the silencing of FUT-1

results in a reduction in rolling and adhesion analogue to the inhibition obtained with

the anti-DC-SIGN antibody AZN-D1 (Fig. 5). In our opinion, this unequivocally

proves the identity of LeY as the carbohydrate ligand of DC-SIGN in HUVEC.

Interestingly, LeY is expressed by many endothelial cell glycoproteins (Fig. 3),

however only ICAM-2, and perhaps other high-molecular weight minor ligands, can

support the binding of DC-SIGN. This may be explained by spatial considerations,

since there is no evidence so far in other post-translational modifications being

necessary for the DC-SIGN-carbohydrate ligand interaction (11, 12, 15), as is the case

for P-Selectin (49). The discovery of FUT-1 as a key enzyme in the synthesis of the

endothelial DC-SIGN-ligand opens new possibilities in the manipulation of DC

migration.


125

References

1 Banchereau, J. and Steinman, R. M. 1998. Dendritic cells and the control of immunity. Nature

392:245-252. 2 Inaba, K., Inaba, M., Naito, M., and Steinman, R. M. 1993. Dendritic cells progenitors

phagocytose particulates, including bacillus Calmette-Guerin organisms, and sensitize mice to micobacterial antigens in vivo. J.Exp.Med. 178:479-488.

3 Svensson, M., Stockinger, B., and Wick, M. J. 1997. Bone marrow-derived dendritic cells can process bacteriafor MHC-I and MHC-II presentation to T cells. J.Immunol. 158:4229-4236.

4 Geijtenbeek, T. B., van Vliet, S. J., Engering, A., 't Hart, B. A., and van Kooyk, Y. 2004. Self- and nonself-recognition by C-type lectins on dendritic cells. Annu.Rev.Immunol. 22:33-54.

5 van Kooyk, Y. and Geijtenbeek, T. B. 2002. A novel adhesion pathway that regulates dendritic cell trafficking and T cell interactions. Immunol.Rev. 186:47-56.

6 Geijtenbeek, T. B., Krooshoop, D. J., Bleijs, D. A., van Vliet, S. J., van Duijnhoven, G. C., Grabovsky, V., Alon, R., Figdor, C. G., and van Kooyk, Y. 2000. DC-SIGN-ICAM-2 interaction mediates dendritic cell trafficking. Nat.Immunol. 1:353-357.

7 Leteux, C., Chai, W., Loveless, R. W., Yuen, C. T., Uhlin-Hansen, L., Combarnous, Y., Jankovic, M., Maric, S. C., Misulovin, Z., Nussenzweig, M. C., and Feizi, T. 2000. The cysteine-rich domain of the macrophage mannose receptor is a multispecific lectin that recognizes chondroitin sulfates A and B and sulfated oligosaccharides of blood group Lewis(a) and Lewis(x) types in addition to the sulfated N-glycans of lutropin. J.Exp.Med. 191:1117-1126.

8 Irjala, H., Johansson, E. L., Grenman, R., Alanen, K., Salmi, M., and Jalkanen, S. 2001. Mannose receptor is a novel ligand for L-selectin and mediates lymphocyte binding to lymphatic endothelium. J.Exp.Med. 194:1033-1042.

9 Geijtenbeek, T. B., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Adema, G. J., van Kooyk, Y., and Figdor, C. G. 2000. Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell 100:575-585.

10 Geijtenbeek, T. B., Kwon, D. S., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Middel, J., Cornelissen, I. L., Nottet, H. S., KewalRamani, V. N., Littman, D. R., Figdor, C. G., and van Kooyk, Y. 2000. DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells. Cell 100:587-597.


12 Feinberg, H., Mitchell, D. A., Drickamer, K., and Weiss, W. I. 2001. Structural basis for selective recognition of oligosaccharides by DC-SIGN and DC-SIGNR. Science 294:2163-2166.

13 Guo, Y., Feinberg, H., Conroy, E., Mitchell, D. A., Alvarez, R., Blixt, O., Taylor, M. E., Weiss, W. I., and Drickamer, K. 2004. Structural basis for distinct ligand-binding and targeting properties of the receptors DC-SIGN and DC-SIGNR. Nat.Struct.Mol.Biol. 11:591-598.



16 Van Liempt, E., Imberty, A., Bank, C. M., van Vliet, S. J., van Kooyk, Y., Geijtenbeek, T. B., and Van Die, I. 2004. Molecular basis of the differences in binding properties of the highly related C-type lectins DC-SIGN and L-SIGN to Lewis X trisaccharide and Schistosoma mansoni egg antigens. J.Biol.Chem. 279:33161-33167.

17 Blixt, O., Head, S., Mondala, T., Scanlan, C., Huflejt, M. E., Alvarez, R., Bryan, M. C., Fazio, F., Calarese, D., Stevens, J., Razi, N., Stevens, D. J., Skehel, J. J., Van Die, I., Burton, D. R., Wilson, I. A., Cummings, R. D., Bovin, N., Wong, C. H., and Paulson, J. 2004. Printed covalent glycan array for ligand profiling of diverse glycan binding proteins. Proc.Natl.Acad.Sci.U.S.A. 101:17033-17038.

18 van Kooyk, Y. and Geijtenbeek, T. B. 2003. DC-SIGN: escape mechanism for pathogens. Nat.Rev.Immunol. 3:697-709.

Chapter 5 _

126

19 Jaffe, E. A., Nachman, R. L., Becker, C. G., and Minick, C. R. 1973. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J.Clin.Invest 52:2745-2756.

20 Garcia-Vallejo, J. J., Van het Hof, B., Robben, J., Van Wijk, J. A. E., Van Die, I., Joziasse, D. H., and van Dijk, W. 2004. Approach for defining endogenous reference genes in gene expression experiments. Anal.Biochem. 329:293-299.

21 van Hinsbergh, V. W., Sprengers, E. D., and Kooistra, T. 1987. Effect of thrombin on the production of plasminogen activators and PA inhibitor-1 by human foreskin microvascular endothelial cells. Thromb.Haemost. 57:148-153.

22 Sallusto, F. and Lanzavecchia, A. 1994. J.Exp.Med. 179:1109-1118. 23 Geijtenbeek, T. B., van Duijnhoven, G. C., van Vliet, S. J., Krieger, E., Vriend, G., Figdor, C. G.,

and van Kooyk, Y. 2002. Identification of different binding sites in the dendritic cell-specific receptor DC-SIGN for intercellular adhesion molecule 3 and HIV-1. J.Biol.Chem. 277:11314-11320.

24 Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.

25 Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45.

26 Ramakers, C., Ruijter, J. M., Lekanne Deprez, R. H., and Moorman, A. F. M. 2003. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neuroscience Letters 339:62-66.

27 Livak, K. J. and Schmittgen, T. D. 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-CT Method. Methods 25:402-408.

28 Brummelkamp, T. R., Bernards, R., and Agami, R. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550-553.

29 Brummelkamp, T. R., Bernards, R., and Agami, R. 2002. Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell 2:243-247.

30 Sakariassen, K. S., Aarts, P. A., de Groot, P. G., Houdijk, W. P., and Sixma, J. J. 1983. A perfusion chamber developed to investigate platelet interaction in flowing blood with human vessel wall cells, their extracellular matrix, and purified components. J.Lab Clin.Med. 102:522-535.

31 van Zanten, H., Saelman, E. U., Schut-Hese, K. M., Wu, Y. P., Slootweg, P. J., Nieuwenhuis, H. K., de Groot, P. G., and Sixma, J. J. 1996. Platelet adhesion to collagen type IV under flow conditions. Blood 88:3862-3871.


33 Gahmberg, C. G., Nortamo, P., Zimmermann, D., and Ruoslahti, E. 1991. The human leukocyte-adhesion ligand, intercellular-adhesion molecule 2. Expression and characterization of the protein. Eur.J.Biochem. 195:177-182.

34 Diacovo, T. G., deFougerolles, A. R., Bainton, D. F., and Springer, T. A. 1994. A functional integrin ligand on the surface of platelets: intercellular adhesion molecule-2. J.Clin.Invest 94:1243-1251.

35 Bleijs, D. A., Geijtenbeek, T. B., Figdor, C. G., and van Kooyk, Y. 2001. DC-SIGN and LFA-1: a battle for ligand. Trends Immunol. 22:457-463.

36 Elbein, A. D., Tropea, J. E., Mitchell, M., and Kaushal, G. P. 1990. Kifunensine, a potent inhibitor of the glycoprotein processing mannosidase I. J.Biol.Chem. 265:15599-15605.

37 Lowe, J. B., Kukowska-Latallo, J. F., Nair, R. P., Larsen, R. D., Marks, R. M., Macher, B. A., Kelly, R. J., and Ernst, L. K. 1991. Molecular cloning of a human fucosyltransferase gene that determines expression of the Lewis x and VIM-2 epitopes but not ELAM-1-dependent cell adhesion. J.Biol.Chem. 266:17467-17477.


39 Goldstein, I., Hollerman, C., and Smith, E. 1965. Protein-carbohydrate interaction. II. Inhibition studies on the interaction of concanavalin A with polysaccharides. Biochemistry 41:876-883.

40 Goldstein, I., Hollerman, C., and Merrick, J. 1965. Protein-carbohydrate interaction. I. The interaction of polysaccharides with concanavalin A. Biochim.Biophys.Acta 97:68-76.


127


42 Lowe, J. B. 2002. Glycosylation in the control of selectin counter-receptor structure and function. Immunol.Rev. 186:19-36.

43 Larsen, R. D., Ernst, L. K., Nair, R. P., and Lowe, J. B. 1990. Molecular cloning, sequence, and expression of a human GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase cDNA that can form the H blood group antigen. Proc.Natl.Acad.Sci.U.S.A. 87:6674-6678.

44 Yanagidani, S., Uozumi, N., Ihara, Y., Miyoshi, E., Yamaguchi, N., and Taniguchi, N. 1997. Purification and cDNA cloning of GDP-L-Fuc:N-acetyl-beta-D-glucosaminide:alpha1-6 fucosyltransferase (alpha1-6 FucT) from human gastric cancer MKN45 cells. J.Biochem.(Tokyo) 121:626-632.

45 Camardella, L., Carratore, V., Ciardello, M. A., Damonte, G., Benatti, U., and De Flora, A. 1995. Primary structure of human erythrocyte nicotinamide adenine dinucleotide phosphate (NADP[H])-binding protein FX: Identification with the mouse tum-transplantation antigen P35B. Blood 85:264-267.

46 Tonetti, M., Sturla, L., Bisso, A., Benatti, U., and De Flora, A. 1996. Synthesis of GDP-L-Fucose by the human FX protein. J.Biol.Chem. 271:27274-27279.

47 Yurchenko, P. D. and Atkinson, P. H. 1977. Equilibration of fucosyl glycoprotein pools in HeLa cells. Biochemistry 16:944-953.

48 Smith, P. L., Myers, J. T., Rogers, C. E., Zhou, L., Petryniak, B., Becker, D. J., Homeister, J. W., and Lowe, J. B. 2002. Conditional control of selectin ligand expression and global fucosylation events in mice with a targeted mutation at the FX locus. J.Cell Biol. 158:801-815.

49 Jiménez, D., Roda, P., Springer, T. A., and Casasnovas, J. M. 2005. Contribution of N-linked glycans to the conformation and function of intercellular adhesion molecules (ICAMs). J.Biol.Chem. in press.

50 Wyss, D. F. and Wagner, G. 1996. The structural role of sugars in glycoproteins. Curr.Opin.Biotechnol. 7:409-416.

51 Elbein, A. D. 1991. The role of N-linked oligosaccharides in glycoprotein function. Trends Biotechnol. 9:346-352.

52 Fussenegger, M., Bailey, J. E., Hauser, H., and Mueller, P. P. 1999. Genetic optimization of recombinant glycoprotein production by mammalian cells. Trends Biotechnol. 17:35-42.

53 Van Liempt, E., Imberty, A., Bank, C. M., van Vliet, S. J., van Kooyk, Y., Geijtenbeek, T. B., and Van Die, I. 2004. Molecular basis of the differences in binding properties of the highly related C-type lectins DC-SIGN and L-SIGN to Lewis X trisaccharide and Schistosoma mansoni egg antigens. J.Biol.Chem. 279:33161-33167.

54 Leppanen, A., Mehta, P., Ouyang, Y. B., Ju, T., Helin, J., Moore, K. L., Van Die, I., Canfield, W. M., McEver, R. P., and Cummings, R. D. 1999. A novel glycosulfopeptide binds to P-selectin and inhibits leukocyte adhesion to P-selectin. J.Biol.Chem. 274:24838-24848.

DC-SIGN mediates binding of dendritic cells to authentic pseudo-Lewisy glycolipids of Schistosoma

mansoni cercariae, the first parasite-specific ligand of DC-SIGN

Sandra Meyer, Ellis van Liempt, Anne Imberty, Yvette van Kooyk,

Hildegard Geyer, Rudolf Geyer and Irma van Die

Journal of biological chemistry 2005; 280, 37349-37359

Chapter 6

Binding of DC-SIGN to pseudo-Lewisy

131

Abstract

During schistosomiasis, parasite-derived glycoconjugates play a key role in

manipulation of the host’s immune response, associated with persistence of the

parasite. Among the candidate host receptors that are triggered by glycoconjugates

are C-type lectins (CLRs) on dendritic cells (DCs), which in concerted action with

Toll-like receptors determine the balance in DCs between induction of immunity

versus tolerance. Here we report that the CLR DC-SIGN mediates adhesion of DCs to

authentic glycolipids derived from Schistosoma mansoni cercariae and their

excretory/secretory products. Structural characterization of the glycolipids, in

combination with solid-phase and cellular binding studies revealed that DC-SIGN

binds to the carbohydrate moieties of both glycosphingolipid species with Galβ1-

4(Fucα1-3)GlcNAc (Lewisx) and Fucα1-3Galβ1-4(Fucα1-3)GlcNAc (pseudo-Lewisy)

determinants. Importantly, these data indicate that surveying DCs in the skin may

encounter schistosome-derived glycolipids immediately after infection. Recent

analysis of crystals of the carbohydrate binding domain of DC-SIGN bound to Lewisx

provided insight into the ability of DC-SIGN to bind fucosylated ligands. Using

molecular modeling we showed that the observed binding of the schistosome-specific

pseudo-Lewisy to DC-SIGN is not directly compatible with the model described. To fit

pseudo-Lewisy into the model, the orientation of the side chain of Phe313 in the

secondary binding site of DC-SIGN was slightly changed, which results in a perfect

stacking of Phe313 with the hydrophobic side of the galactose-linked fucose of

pseudo- Lewisy. We propose that pathogens such as S. mansoni may use the observed

flexibility in the secondary binding site of DC-SIGN to target DCs, which may

contribute to immune escape.

Chapter 6 _

132

Introduction

Schistosomiasis is a human parasitic disease caused by helminths of the genus

Schistosoma that affect more than 200 million people worldwide (1). One of the most

striking features of schistosomiasis is that the worms are experts in modulation and

evasion of the host´s immune response, to enable their survival, migration and

development in different host tissues. Schistosomes have a complicated life cycle,

requiring both a vertebrate and a snail host. Infection starts when cercariae released

by the snail penetrate the host via the skin and transform into schistosomula.

Schistosomula migrate to the portal system and develop to mature adult worms that

mate and produce eggs. The eggs that become lodged within host tissues are

primarily responsible for the development of a strong anti-inflammatory TH2

response that enables parasite survival and induces granuloma formation around the

eggs, which is a major cause of pathology (1).

During infection the immune system is continuously challenged with an array of

molecules associated with parasite metabolism and reproduction. However, little is

known about the molecular mechanism behind this challenging of host immune

responses nor which cellular receptors are involved. Schistosomal glycoconjugates

(glycoproteins and glycolipids) are shown to play important roles in host-parasite

interactions (2), which may include evasion mechanisms exploited by the parasites.

These glycoconjugates are often developmentally regulated antigens that are

expressed during different life-cycle stages. Proteins of different schistosoma life-

cycle stages carry both N- and O-glycans (2;3). In addition, schistosomes synthesize

highly immunogenic glycosphingolipids, especially in the egg and cercarial stage

(4;5). The stage-associated synthesis of carbohydrate structures on these glycolipids

is paralleled by changes in the ceramide structures during the life cycle (6-8).

Schistosome glycosphingolipids have a typical core structure that differs from that in

vertebrates. Remarkably, the glucocerebroside is not galactosylated to make

lactosylceramide as in vertebrates, but is instead modified by addition of a GalNAc

residue to generate GalNAcβ1-4Glcβ1-ceramide, the so-called “schisto-core” (4). Both

protein-linked glycans and glycosphingolipids contain a variety of terminal glycan

epitopes, many of which are highly fucosylated and include glycan antigens such as

GalNAcβ1-4GlcNAc (LacdiNac, LDN), Fucα1-3GalNAcβ1-4GlcNAc (F-LDN),


133

GalNAcβ1-4(Fucα1-3)GlcNAc (LDN-F), GalNAcβ1-4(Fucα1-2Fucα1-3)GlcNAc (LDN-

DF) and Galβ1-4(Fucα1-3)GlcNAc (Lewisx, Lex) (2; 9-14).

Several findings indicate important roles for Lex antigens in host-schistosome

interactions. Lex antigens have been found in glycoconjugates of all life-cycle stages,

such as membrane-bound glycoproteins of adult schistosomes, secreted egg and gut

glycoproteins (15) and cercarial glycolipids (5). Interestingly, Lex containing

glycoconjugates are shown to induce proliferation of B-cells from infected animals,

which secrete interleukin-10 (IL-10) and prostaglandine E2 (PGE2), and to induce the

production of IL-10 by peripheral blood mononuclear cells from schistosome-infected

individuals (16;17). In a murine schistosome model, Lex is an effective adjuvant for

induction of a TH2 response (18).

Recognition of an invading pathogen by cells of the immune system is mediated by

receptors on antigen presenting cells. On dendritic cells (DCs) two receptor families

are involved in the recognition of pathogens, Toll-like receptors (TLRs) that recognize

common pathogen-associated molecular patterns, and C-type lectins (CLRs) that

bind to glycan antigens (19). DCs express several TLRs, depending on their

developmental stage and lineage (20). Several studies have shown that bacterial

products induce maturation of DCs via TLRs (21-23). Recently it was shown that the

schistosome-specific phosphatidyl-serine (PS) activates TLR2 and induces mature

DCs to activate IL-10-producing regulatory T cells (24). DCs also express a variety of

CLRs that recognize glycan antigens in a Ca2+ dependent manner using highly

conserved carbohydrate recognition domains (19;25). Several CLRs have been

implicated to play a role in the recognition of pathogens. An important question still

remaining is whether the principle function of CLRs is to capture pathogens, or to

recognize self-antigens and suppress immunity (26). Current views are that the

balance between triggering TLRs and CLRs may fine-tune the immune response

towards immune activation or tolerance. Recognition of glycans alone by DC-lectins

may favor immune suppression, whereas pathogen-recognition in a situation of

“danger” (when TLRs are triggered) induces immune activation (26;27).

As a first approach to understand the molecular basis of the role of Lex and other

schistosome glycan antigens in interactions with their host, we set out to investigate

Chapter 6 _

134

the receptors on antigen presenting cells that recognize the schistosome glycan

antigens. Recently we showed that the DC specific C-type lectin DC-SIGN (dendritic

cell- specific ICAM-3 grabbing non-integrin, CD209) binds to S. mansoni soluble egg

antigens (SEA) via Lex, but the actual ligands within SEA have not yet been identified

(28). DC-SIGN is a human type II transmembrane CLR that contains only one C-

terminal CRD and is abundantly expressed on immature DCs (iDCs). DC-SIGN has

affinity for glycoconjugates containing mannose, N-acetylglucosamine and fucose and

interacts with many pathogens. Multivalent binding of its ligands is thought to be

achieved by the formation of tetramers (29;30). Using site-directed mutagenesis,

molecular modeling, and docking of different Lewis antigens in the CRD of DC-SIGN

we could demonstrate that the amino acid Val351 in DC-SIGN is essential for binding

the Fucα1-3/4-GlcNAc moiety of the Lewis antigens Lex, Lea, Leb and Ley (28;31;32).

In this study we have demonstrated that DC-SIGN strongly binds to authentic

cercarial glycosphingolipids of S. mansoni, but not to egg glycolipids. Structural

characterization of the glycan moieties of the glycosphingolipid species revealed that

a pentasaccharide containing Lex is one of the main ligands recognized by DC-SIGN.

Unexpectedly, we found that DC-SIGN also binds to glycosphingolipid species

carrying a hexasaccharide terminating with Fucα1-3Gal(β1-4)(Fucα1-3)GlcNAc-R

(pseudo-Ley), a glycan antigen that so far only has been found within schistosomes.

Experimental procedures

Cells and antibodies. Immature DCs (iDCs) were obtained from human peripheral

blood mononuclear cells (PBMCs) by a CD14 magnetic microbeads isolation (MACS;

Miltenyibiotec, USA) (33). The obtained CD14+ monocytes were differentiated into

iDCs in the presence of IL-4 and granulocyte-macrophage colony stimulating factor

(500 and 800 U/ml, respectively; Schering-Plough, Belgium). At day 6, the

phenotype of the cultured DCs was confirmed by flow cytometric analysis. The DCs

expressed high levels of major histocompatibility complex class I and II, CD11b,

CD11c, and ICAM-1 and low levels of CD80 and CD86. Stable transfectants of K562

cells expressing DC-SIGN (34) were kindly provided by Dr. T. Geijtenbeek. The mAb

AZN-D1 is a blocking anti-DC-SIGN antibody described previously (35). DC-SIGN-Fc

consists of the extracellular portion of DC-SIGN (amino acid residues 64-404) fused

at the C-terminus to a human IgG1-Fc fragment into the Sig-pIgG1-Fc vector (32).

The peroxidase-labelled goat anti-human IgG-Fc or goat anti-mouse IgM were both


135

from Jackson, West Grove, PA. The goat anti- mouse Alexa Fluor 488 secondary anti-

body was obtained from Molecular Probes, Inc., Eugene, OR.

Glycolipid purification. Lyophilized S.mansoni cercariae and eggs were kindly

provided by Dr. Michael J. Doenhoff (School of Biological Science, University of

Wales, Bangor, UK). S. mansoni excretory/secretory (ES) products were kindly

provided by Dr. M. de Jong-Brink (FALW, VU University, Amsterdam, NL). The

cercarial and egg glycolipids were purified by organic solvent extraction,

saponification, desalting and anion-exchange chromatography as described

previously (5). Neutral glycolipids were separated by HPLC (latrobeads 6RS-8010,

10µm, 4,6 mm × 500mm; Macherey and Nagel, Düren, Germany) at a flow rate of 1

ml/min using a binary linear gradient from 100% solvent A

(chloroform:methanol:water 83:16:1, by volume) in 60 minutes to 60% solvent B

(chloroform:methanol:water 10:70:20, by volume) followed by a 20 minute elution

step with 100% solvent B.

Release and purification of Lex and pseudo-Ley oligosaccharides from the ceramide

moieties. Oligosaccharides were released from cercarial and ES glycolipids by

treatment with recombinant endoglycoceramidase II (from Rhodococcus spp., Takara

Shuzu Co., Otsu, Shiga, Japan). Released oligosaccharides were separated from

ceramide moieties by reversed-phase (RP-) chromatography as described previously

(45). Lex and pseudo-Ley glycans were fractionated and separated from remaining

glycolipid-derived oligosaccharide species by HPLC on a TSK-Amide 80 column (4

mm × 250 mm; Tosoh, Amsterdam, NL) using a linear gradient from 100% solvent A

(35% acetic acid, buffered with triethylamine to pH 7.3 and 65% acetonitrile) to 100%

solvent B (50% acetic acid, buffered with triethylamine to pH 7.3 and 50%

acetonitrile) at a flow rate of 1 ml/min. Fractions (500 μl) were analyzed by MALDI-

TOF-MS and MS/MS.

Neoglycolipid synthesis. Pure glycolipid-derived oligosaccharide fractions containing

either Lex or pseudo-Ley glycans (80 μg each) as well as lacto-N-fucopentaose III

(LNFPIII; 100 μg; Dextra Laboratories, Reading, UK) were used for synthesis of

neoglycolipids by coupling to 1,2-sn-dipalmitoylphosphatidylethanolamine via

reductive amination (36). Resulting products were analyzed by MALDI-TOF-MS.

Chapter 6 _

136

Enzyme-linked immunosorbent assay (ELISA). Total egg and cercarial glycolipids

were diluted in ethanol on NUNC maxisorb plates (Roskilde, Denmark), and

incubated for 60 min. at 37ºC to coat the glycolipids to the plate. Plates were blocked

with 1 % ELISA grade BSA (Fraction V, fatty acid free; Calbiochem, USA) and

incubated with DC-SIGN-Fc (3 μg/ml) (32). Binding was detected using a peroxidase

labelled goat anti-human IgG-Fc (Jackson, West Grove, PA). Separated glycolipid

fractions (8.5 ng) and neoglycolipids were coated on polysorb plates (Nunc,

Wiesbaden, Germany) and similarly analyzed by ELISA for reactivity with DC-SIGN-

Fc (3 μg/ml) using peroxidase-conjugated anti-human IgG (4.6 μg/ml; Sigma-

Aldrich, München, Germany). EDTA (10 mM, Roth, Karlsruhe, Germany) was added

when indicated to investigate whether the binding was calcium dependent.

MALDI-TOF-MS and MS/MS analysis. MALDI-TOF-MS analysis was performed on

an Ultraflex time-of-flight mass spectrometer (Bruker-Daltonik, Bremen, Germany)

equipped with a nitrogen laser and a LIFT-MS/MS facility as described previously

(Geyer et al, manuscript submitted). The instrument was operated in the positive-ion

reflector mode throughout using 6-aza-2-thiothymine (Sigma-Aldrich, München,

Germany) as matrix. About 100 to 500 spectra were summarized in each case.

Cellular adhesion assay. Ninety-six-well plates (NUNC maxisorb) were coated

overnight at room temperature with S. mansoni cercarial and egg glycolipids,

pseudo-Ley neoglycolipid, Lex neoglycolipid or globotriaosylceramide (Gb3) and

blocked with 1% BSA. Cells labelled with Calceine AM (Molecular Probes), were

added for 1.5 h at 37 ºC in the presence or absence of 20 μg/ml mAbs AZN-D1. Non-

adherent cells were removed by gently washing. Adherent cells were lysed and

fluorescence was quantified on a Fluostar spectrofluorimeter (BMG Labtech,

Offenburg, Germany). Results are expressed as the mean percentage of adhesion of

triplicate wells.

Isolation of Schistosoma mansoni cercarial ES products. Free cercariae were

obtained from S. mansoni parasitized Biomphalaria glabrata snails by inducing the

shedding process basically as described by Sluiters et al. (37). The free-swimming

cercariae obtained were transferred to 60 ml water. After 5 hrs the cercariae/


137

schistosomula were removed and the remaining water containing the ES products

was concentrated.

Molecular modeling. The coordinates of the crystal structure of human DC-SIGN

interacting with the Lex containing pentasaccharide LNFPIII (38) (code 1SL5) were

taken from the Protein Data Bank (39). The structure was edited using the Sybyl

software (Tripos Inc., St Louis), in order to contain only one protein monomer

together with calcium ions, the Lex trisaccharide, and the two water molecules that

play an important role in bridging O4 of galactose to the protein surface. Protein

hydrogen atoms were added, the peptide atoms partial charges were calculated using

the Pullman procedure and the calcium ions were given a charge of 2. Atom types and

charges for oligosaccharides were defined using the PIM parameters developed for

carbohydrates (40). Pseudo-Ley was built by adding one fucose on position 3 of the

terminal galactose residue. The systematic search procedure of Sybyl was used to vary

the two torsion angles at this glycosidic linkage together with the two torsion angles

of the Phe313 side chain. Only one conformational family was identified. Subsequent

energy minimization was performed using the Tripos force-field (41) with geometry

optimisation of the sugar and the side chains of amino acids in the binding sites. A

distance dependent dielectric constant was used in the calculations. Energy

minimizations were carried out using the Powell procedure until a gradient deviation

of 0.05 kcal·mol-1·Å-1 was attained.

Results

Recognition of Schistosoma mansoni cercarial glycolipids by DC-SIGN

To investigate their binding to DC-SIGN, authentic glycolipids from S. mansoni

cercariae and eggs were isolated by organic solvent extraction (5) and assayed by

ELISA using soluble DC-SIGN-Fc. In parallel, unrelated glycolipids, such as

globotriaosylceramide (Gb3), Forssman antigen (FA) and bovine gangliosides (BG)

were tested together with a synthetic lacto-N-fucopentaose III (LNFPIII)-

neoglycolipid in order to evaluate the binding specificity of DC-SIGN as well as the

potential influence of the structure of the lipid moiety in this assay. The results

revealed that DC-SIGN-Fc strongly binds cercarial glycosphingolipids and the

LNFPIII-neoglycolipid, whereas a weak binding was observed to egg-derived

glycolipids. The remaining types of glycolipids were not recognized at all (Fig. 1A and

Chapter 6 _

138

1B). Hence, it can be concluded that recognition by DC-SIGN is mediated by the

carbohydrate unit and independent of the lipid part of the respective molecules.

Figure 1. Binding of DC-SIGN to S. mansoni cercarial glycolipids and lacto-N-fucopentaose III (LNFPIII)-neoglycolipid. (A) ELISA was performed to determine the binding reactivity and specificity of DC-SIGN to egg glycolipids (Egg GL), total cercarial glycolipids (Cerc. GL), Forssman antigen (FA), globotriaosylceramide (Gb3), LNFPIII-neoglycolipid (LNFPIII NGL) and bovine gangliosides (BG). Similar amounts of glycolipids (3 ng/well) were applied in each case. Data represent a typical result out of three experiments performed in duplicate. (B) A titration of egg glycolipids (Egg GL), total cercarial glycolipids (Cerc. GL) and LNFPIII neoglycolipid (LNFPIII NGL) was performed, starting with 10 ng/well, to determine the binding affinity of DC-SIGN. Results are a typical representative of three independent experiments performed in triplicate.

Characterization and fractionation of total cercarial glycolipids

To allow the subsequent analysis of the glycolipid species that bind DC-SIGN, total

cercarial glycolipids were analyzed by MALDI-TOF MS (Fig. 2). In agreement with

previous studies (5), a complex pattern of different glycolipids was registered mainly

due to the high heterogeneity of the present ceramide moieties. Prevailing species

exhibited monosaccharide compositions of Hex2HexNAc2dHex1, Hex2HexNAc3dHex1

and Hex2HexNAc2dHex2, thus reflecting ceramide pentahexoside and hexahexoside

species with the Lex or pseudo-Ley determinants as described (5). In addition, a

number of major and minor signals was registered which reflected the presence of

additional glycolipids with diverging ceramide and carbohydrate compositions. Based

on previous studies on the ceramide composition of cercarial glycolipids (7) the

cluster of ions at m/z 1978.9 can be concluded to comprise species with

monosaccharide compositions of Hex1HexNAc3dHex4 and Hex2HexNAc3dHex3 which

is corroborated by the detection of the respective free oligosaccharides after

endoglycoceramidase treatment (Table 1).


139

Figure 2 MALDI-TOF-MS analysis of isolated glycolipids from S. mansoni cercariae. Deduced monosaccharide compositions are assigned to major pseudomolecular ions ([M+Na]+) comprising Lex (H2N2F1 at m/z 1593.7 or H2N3F1 at m/z 1796.8) and pseudo-Ley epitopes (H2N2F2 at m/z 1739.8). The cluster of ions culminating in a signal at m/z 1978.9 reflects glycolipids with divergent ceramide and carbohydrate moieties including species with monosaccharide compositions of H1N3F4 and H2N3F3.The complex pattern of registered signals is due to ceramide heterogeneity. H, hexose; N, N-acetylhexosamine; F, deoxyhexose (fucose); Cer, ceramide.

To obtain individual glycolipid fractions, cercarial glycolipids were subjected to HPLC

separation and the isolated fractions were analyzed by ELISA for their capacity to

bind DC-SIGN (Fig. 3A). The results revealed that DC-SIGN mainly recognized

glycolipids that occurred in HPLC fractions 40-50, whereas species with elongated

carbohydrate units did not react. Subsequent analysis of fractions 40-50 by MALDI-

TOF-MS demonstrated that each fraction comprised a mixture of glycolipids carrying

Lex or pseudo-Ley moieties (Fig. 3B-3E). Due to the observed ceramide heterogeneity,

a clear separation into fractions containing solely Lex or pseudo-Ley determinants

was not possible. To determine which of these glycan moieties are recognized by DC-

SIGN, we decided to synthesize neoglycolipids, using purified carbohydrate moieties

that were released from the cercarial glycosphingolipids.

Chapter 6 _

140

Table 1. Compilation of total glycans obtained from glycosphingolipids of S. mansoni cercariae and excretory/secretory (ES) products by endoglycoceramidase treatment. Compositions are assigned in terms of hexose (H), N-acetylhexosamine (N) and deoxyhexose (fucose; F). Relative occurrence of individual compositional species is roughly estimated from the respective signal intensities registered by MALDI-TOF-MS. Oligosaccharides representing LeX-pentasaccharides, LeX-hexasaccharides or pseudo-LeY-hexasaccharides are marked in bold type.

a Relative amounts were estimated as follows: +: 0-2.2 ×104; ++: 2.21-4.6×104; +++: 4.61-

6.6×104 intensity counts.

Calculated mass [M+Na]+ (m/z)

Observed mass [M+Na]+ (m/z)

Composition Obtained from a

Glycolipids E/S-products

917.32 917.3 H2N2F1 +++ +++

933.32 933.2 H3N2 ++ -

958.35 958.2 H1N3F1 + +

1063.38 1063.6 H2N2F2 ++ +

1079.2 1079.2 H3N2F1 + -

1104.41 1104.2 H1N3F2 + +

1120.41 1120.3 H2N3F1 +++ ++

1136.39 1136.2 H3N3 + -

1161.43 1161.3 H1N4F1 + -

1241.43 1241.6 H4N2F1 - +

1250.46 1250.3 H1N3F3 + -

1266.46 1266.3 H2N3F2 ++ +

1282.45 1282.3 H3N3F1 + -

1307.46 1307.3 H1N4F2 ++ +

1323.48 1323.3 H2N4F1 + -

1396.52 1396.3 H1N3F4 ++ ++

1412.51 1412.3 H2N3F3 + -

1428.51 1428.3 H3N3F2 + -

1453.55 1453.3 H1N4F3 + +

1469.54 1469.3 H2N4F2 ++ -

1485.54 1485.3 H3N4F1 + -

1510.57 1511.0 H1N5F2 - +

1599.6 1599.4 H1N4F4 + +

1615.59 1615.4 H2N4F3 + -

1631.59 1631.4 H3N4F2 + -

1656.62 1656.4 H1N5F3 + +

1672.62 1672.4 H2N5F2 + -

1713.65 1714.3 H1N6F2 - +

1745.66 1745.4 H1N4F5 + -

1802.68 1803.4 H1N5F4 - +

1818.68 1818.4 H2N5F3 + -

1834.67 1835.4 H3N5F2 + -

1859.70 1860.4 H1N6F3 - ++

2005.76 2006.4 H1N6F4 - +++

2062.78 2063.4 H1N7F3 - +

2151.82 2152.4 H1N6F5 - +

2208.84 2210.4 H1N7F4 - ++

2354.89 2355.4 H1N7F5 - ++

2500.95 2502.3 H1N7F6 - +


141

Figure 3. Binding of DC-SIGN to fractionated glycolipids of S. mansoni cercariae. Binding of DC-SIGN to S.mansoni cercarial glycolipids was determined by ELISA using soluble DC-SIGN-Fc (A). Recognized species occurring in fractions 40-50 are dominated by glycolipids carrying Lex and pseudo-Ley epitopes as confirmed by MALDI-TOF-MS. (B-E), MALDI-TOF-MS analysis of HPLC-fractions 40, 42, 47 and 51 respectively. Major pseudomolecular ions ([M+Na]+) comprising Lex-pentasaccharide (*), pseudo-Ley-hexasaccharide (+) and pseudo-Ley-octasaccharide (++) units are marked.

Chapter 6 _

142

Purification of the glycan moieties of cercarial glycolipids

Glycans were released from total cercarial glycolipids by endoglycoceramidase

treatment, separated from remaining (glyco)lipids by reversed-phase

chromatography and analyzed by MALDI-TOF-MS (Fig. 4). In agreement with the

spectrum obtained in the case of total cercarial glycolipids (Fig. 2), the results

confirmed the preponderant occurrence of oligosaccharides with monosaccharide

compositions consistent with the presence of a Lex or a pseudo-Ley determinant. In

addition, several minor oligosaccharides with divergent compositions have been

registered (Table 1). In order to obtain individual glycan species, the total mixture of

oligosaccharides was subjected to HPLC separation using a TSK-amide column.

Collected fractions were screened by MALDI-TOF-MS. Fractions containing the Lex

pentasaccharide (m/z 917.3 [M+Na]+) plus additional pseudo-Ley (m/z 1063.6

[M+Na]+) and/or Lex hexasaccharide species (m/z 1120.3 [M+Na]+) were re-applied

to HPLC, in order to reduce peak heterogeneity and to obtain pure compounds as

monitored by MALDI-TOF-MS (see insets in Fig. 5A and 5B).

Figure 4. MALDI-TOF-MS analysis of released oligosaccharides. Oligosaccharides were released from cercarial glycolipids by treatment with endoglycoceramidase and analyzed by MALDI-TOF-MS. Monoisotopic masses of pseudomolecular ions ([M+Na]+) and deduced monosaccharide compositions are assigned. Signals representing free Lex pentasaccharide (m/z 917.3), Lex hexasaccharide (m/z 1120.3) as well as pseudo-Ley hexasaccharide (m/z 1063.6) are marked in bold type. H, hexose; N, N-acetylhexosamine; F, deoxyhexose (fucose).


143

Characterization of Lex and pseudo-Le y glycans by MALDI-TOF-MS/MS

The identity of the isolated glycans was established by tandem mass spectrometry.

MS/MS analysis verified that the parent ion with the mass of m/z 917.3 [M+Na]+

consisted of a pentasaccharide with a composition of Hex2HexNAc2dHex1 (Fig. 5A).

In addition to the sequential release of the five monosaccharide units, two

characteristic fragment ions, B2 and C2 at m/z 534.2 and m/z 552.2, could be

observed in agreement with the presence of a Lex trisaccharide unit. The linkage of

fucose to the subterminal HexNAc residue is confirmed by a Y3α fragment ion at m/z

755.5. By the same line of evidence, the glycan with the mass of m/z 1063.3 [M+Na]+

(inset in Fig. 5B) could be shown to comprise a dHex-Hex-(dHex-)HexNAc unit due

the observed B3 and C3 fragment ions at m/z 680.1 and m/z 698.1, respectively (Fig.

5B). Hence, the obtained MS/MS spectra displayed all diagnostically relevant

fragment ions to be expected for the cercarial glycolipid-derived Lex pentasaccharide

and pseudo-Ley hexasaccharide units described previously (5). Furthermore, mass

spectrometry revealed a high purity of the Lex and pseudo-Ley glycan fractions

obtained.

Figure 5. MALDI-TOF-MS and MS/MS analysis of purified glycans with Lex or pseudo-Ley units. (A) MALDI-TOF-MS/MS spectrum of the Lex pentasaccharide (m/z 917.3 [M+Na]+). Characteristic Lex

trisaccharide fragment ions (B2 and C2) and the diagnostically relevant Y3α fragment are marked by asterisks (*). (B) MALDI-TOF-MS/MS spectrum of the pseudo-Ley hexasaccharide (m/z 1063.6 [M+Na]+). Characteristic pseudo-Ley tetrasaccharide fragment ions (B3 and C3) are again marked by asterisks (*). The signal at m/z 764.2 is assumed to arise from ring fragmentation accompanied by the loss of two water molecules (0,2A4-2H2O). Insets: corresponding MS1 spectra. Assignment of fragment ions is performed according to Domon and Costello (57).

Chapter 6 _

144

Binding of DC-SIGN to Lex and pseudo-Ley neoglycolipids

Purified Lex and pseudo-Ley glycans were converted into neoglycolipids by coupling

to 1,2-sn-dipalmitoylphosphatidyl-ethanolamine (DPPE) via reductive amination.

Resulting products were analyzed by MALDI-TOF-MS (Fig. 6). Lex neoglycolipid led

to a signal of m/z 1615.0 [M-H+2Na]+ (Fig. 6A) in agreement with the calculated

mass of the Lex pentasaccharide (m/z 917.3) and the mass increment of DPPE (m/z

692), taking into consideration that one oxygen is lost during reductive amination

and the acidic proton of DPPE is replaced by a sodium ion. Likewise, pseudo-Ley

neoglycolipid was registered with masses of m/z 1739.4 [M+Na]+ and m/z 1761.1 [M-

H+2Na]+ (Fig. 6B). Both neoglycolipid samples were quantified by compositional

analysis with regard to their carbohydrate content in order to ensure the application

of defined amounts of neoglycolipids in subsequent experiments.

Figure 6. MALDI-TOF-MS analysis of neoglycolipids containing Lex or pseudo-Ley epitopes. (A and B), MALDI-TOF-MS spectra of Lex (m/z 1615.0 [M-H+2Na]+) and pseudo-Ley (m/z 1739.4 [M+Na]+ and 1761.1 [M-H+2Na]+) neoglycolipids, respectively.

Figure 7. DC-SIGN-Fc binds to Lex and pseudo-Ley neoglycolipids. Binding of DC-SIGN-Fc to schistosomal neoglycolipids was tested in ELISA. 10 ng of lacto-N-fucopentaose III neoglycolipid (LNFPIII) was coated as positive control. In parallel, 8 ng of Lex neoglycolipid (Lex) and 8 ng of pseudo-Ley neoglycolipid (pseudo Ley) were applied to each well. Binding of DC-SIGN-Fc to all neoglycolipids was completely inhibited by addition of EDTA (Control, only one example shown). Indicated standard deviations are based on 9 independent determinations.

The binding of DC-SIGN-Fc to Lex and


145

pseudo-Ley neoglycolipids was studied by ELISA (Fig. 7). The results revealed an

almost equivalent recognition of the two neoglycolipids by DC-SIGN-Fc when

compared to the LNFPIII-neoglycolipid used as a positive control. This finding is

remarkable as the pseudo-Ley epitope represents, in contrast to Lex, a parasite-

specific carbohydrate structure. To establish whether natural cell-surface expressed

DC-SIGN binds authentic cercarial glycolipids and neoglycolipids, we performed a

cellular adhesion assay. K562 cells stably transfected with DC-SIGN express high

levels of DC-SIGN on their cell surface as was determined by flow cytometry (Fig.

8A). Cercarial glycolipids as well as neoglycolipids containing pseudo-Ley or Lex

showed binding to K-562 transfected with DC-SIGN, but not to the parental K562 cell

line. There was no binding of cellular DC-SIGN to egg glycolipids and Gb3. The

binding could be blocked by AZN-D1, a DC-SIGN blocking antibody, and EGTA (Fig.

8B). Human iDCs naturally express DC-SIGN on their cell surface (Fig 8A). Cercarial

glycolipids and the neoglycolipids containing Lex or pseudo-Ley are bound by DC-

SIGN on iDCs (Fig. 8C). Despite the fact that iDCs express multiple CLRs on their cell

surface, adhesion is completely inhibited by the Ca2+-chelator EGTA or a DC-SIGN

blocking antibody (Fig. 8C), indicating that binding of the cells to the glycolipids is

mediated via the CRD of DC-SIGN. Hence, these studies demonstrate that DC-SIGN

mediates the binding of iDCs to authentic carbohydrate structures uniquely

expressed by S. mansoni cercarial glycolipids.

Docking of pseudo-Le y oligosaccharide into DC-SIGN

The docking of pseudo-Ley in the DC-SIGN binding site was based on the crystal

structure of the DC-SIGN complexed with Lex containing oligosaccharide (38).

Inclusion of hydrogen atoms (not located by x-ray diffraction) and optimisation of the

binding site of the DC-SIGN/Lex complex did not yield any significant change

compared to the crystal structure. It allows us to propose the hydrogen bond network

displayed in Fig. 9A, with involvement of two water molecules that bridge the

galactose residue to Ser360 and Glu358 side chains. Pseudo-Ley was built from this

complex by adding a fucose in position 3 of the galactose. All possible conformations

were tested but all of them resulted in a steric conflict with the side chain of Phe313.

After a systematic search involving both Phe313 side chain and the fucose orientation,

one possible mode of interaction was identified. The proposed docking mode is

represented in Fig 9B. The Phe313 side chain would adopt an orientation different

Chapter 6 _

146

from the one observed in the crystal structure of DC-SIGN complexed with Lex. The

new orientation allows for a strong “stacking” of the aromatic ring of Phe313 with the

most hydrophobic face of fucose. Such interaction between sugar and planar side

chains are commonly observed in protein – carbohydrate interactions.

Figure 8. DC-SIGN on human dendritic cells interacts with authentic S. mansoni cercarial glycolipids and Lex and pseudo-Ley neoglycolipids. The expression of DC-SIGN on transfectants and immature DCs (iDCs) was determined by flow cytometry (A). Binding of DC-SIGN expressed on K562 transfectants (B) or iDCs (C) to glycolipids (GL) and neoglycolipids (NGL) was determined by plate adhesion assay in the presence or absence of EGTA, or a blocking mAb to DC-SIGN (AZN-D1). All results are representative of three independent experiments, performed in triplicate.


147

The reorientation of the Phe313 side chain does not cost significant energy. This side

chain adopts a different orientation when compared to DC-SIGN complexed with Lex

or with mannose oligosaccharide (59;60). Furthermore, a recent crystallographic

work demonstrated a large conformational change in an arginine residue side chain

for stacking to a sugar derivative in a galectin structure (61).

S. mansoni ES products comprise glycolipids with Lex and pseudo-Ley epitopes

It remains to be investigated whether the cercarial glycosphingolipids that have been

shown to bind to DC-SIGN in vitro are in a position that allows an interaction with

DCs in vivo as well. However, DCs are expected to encounter excretory/secretory

(ES) products, a mixture of glycoproteins and glycolipids that is secreted when the

cercariae transform to schistosomula. To determine whether the Lex and pseudo-Ley

containing glycosphingolipids are found within ES products, glycolipids were isolated

from ES products collected in vitro from freshly transformed cercariae. Following

treatment with endoglycoceramidase the released oligo-saccharides were analyzed by

MALDI-TOF-MS. The results revealed that ES product-derived glycolipids comprise

species with Lex and pseudo-Ley determinants together with a wide panel of extended

oligofucosylated glycan species, many of which were also recovered in the cercarial

glycolipid fractions (Table 1).

Figure 9. Interaction of DC-SIGN with Lex and pseudo-Ley. Models of the interaction of DC-SIGN with Lex trisaccharide (A) and pseudo-Ley tetrasaccharide (B). Calcium ions are represented by grey spheres. Only the amino acids interacting directly with the sugars have been displayed.

Chapter 6 _

148

Discussion

In this study the interaction of DC-SIGN with S. mansoni glycolipids was

investigated. In contrast to glycosphingolipids derived from eggs, glyco-sphingolipids

of S. mansoni cercariae are bound by both recombinant and dendritic cell expressed

DC-SIGN. Structural characterization of the glycolipids revealed that DC-SIGN binds

two dominant cercarial glycosphingolipids, being Lex containing species and pseudo-

Ley species (5). In contrast to Lex that is found in both mammals and several

pathogens, pseudo-Ley is an oligosaccharide determinant that may be unique for

schistosomes (5). These are the first natural ligands identified for DC-SIGN in

schistosomes, enabling follow-up studies to elucidate the function of the interaction

between DC-SIGN and schistosome glycolipids in host immunity. The observation

that egg glycolipids interacted poorly with DC-SIGN is in agreement with previous

studies demonstrating that species with pseudo-Ley determinants are predominantly

found in cercarial glycosphingolipids, whereas Lex containing glycosphingolipids

represent only a very small fraction of total egg stage glycosphingolipids (5).

Recently more insight was obtained into the ability of DC-SIGN to bind fucosylated

ligands (31;38). Analysis of crystals of the CRD of DC-SIGN bound to lacto-N-

fucopentaose III (that comprises the Lex trisaccharide) showed that the 3- and 4-OH

groups of the α1-3-linked fucose form coordination bonds with Ca2+ in the primary

binding site. In this position the fucose is close to Val351, which forms tight van der

Waals contacts with the 2-OH group, whereas the terminal galactose residue contacts

the protein via Phe313 in a secondary binding site. From the proposed models it

appears that Val351 in DC-SIGN is close to the fucose binding site and makes a strong

hydrophobic contact with CH at position 1 and 2 of fucose (38). By molecular

modeling, in combination with binding studies of cell-surface expressed recombinant

wild-type and mutant forms of DC-SIGN and its homologue L-SIGN we found very

similar results for the binding mode of Lex in DC-SIGN (31). Both models predict that

a substituent on the 3-OH group of galactose would give a steric conflict with the side

chain of Phe313, which is line with the results of binding studies that showed that 3’

sialylation or sulfation of Lex abrogates binding (43). However, in the studies

described here, we observed binding of soluble DC-SIGN-Fc, as well as cellular

expressed DC-SIGN, to pseudo-Ley that does carry a fucose α1-3 linked to galactose

(5). To fit a fucose on position 3 of galactose into the model, it appeared necessary to


149

slightly change the orientation of the side chain of Phe313, a movement that does not

cost significant energy. Furthermore, in this docking mode a perfect stacking with

the hydrophobic side of the galactose-linked fucose is created. We propose that the

secondary binding site of DC-SIGN is flexible due to the capacity of the side chain of

Phe313 to change orientation, and that pathogens such as S. mansoni may use this

property to target DC-SIGN. Recently, a similar change in orientation has been

demonstrated for the side chain of Arg144 in the CRD of galectin-3 upon ligand

binding (42). The high-resolution X-ray crystal structures of the CRD of human

galectin-3 were solved in complex with N-acetyllactosamine (LacNAc) and a high-

affinity inhibitor. The structures showed that the side chain of Arg144 stacks against

the aromatic moiety of the inhibitor, which was possible by a reorientation of the side

chain relative to that seen in the complex with LacNAc.

Antigen presenting cells, such as DCs and macrophages are the first immune cells

that encounter invading pathogens and are crucially involved in the initiation and

control of innate and adaptive immune responses (44). They often recognize

pathogens through a wide array of molecules such as (glyco)lipids and acylated

proteins or peptides. Interestingly, several studies indicate that glycolipids are

capable to modulate the human immune system (45-47). The presence of lipid

moieties within pathogen-derived products is essential for activation of specific

pattern-recognition receptors, in particular TLR2 (48). It was recently shown that

schistosomal egg glycolipids induce production of pro- and anti-inflammatory

cytokines in monocytes (24). By fractionating and purification of the lipids, the

authors showed that mono-acetylated lysophosphatidylserine (lyso-PS) promotes the

development of T regulatory cells via interaction with TLR2 on DCs. By contrast, di-

acetylated phosphatidylserine promotes maturation of DC into a phenotype, termed

DC2, which induces the development of TH2 responses (24).

Here we report that DCs interact with authentic cercarial glycosphingolipids

comprising Lex and pseudo-Ley via the CLR DC-SIGN. This indicates that DCs may

likely interact with schistosomes early in infection. Schistosomes enter the human

host in the cercarial stage, and these cercariae transform into schistosomula directly

after penetration of the skin by shedding their glycocalyx and secretion of

excretory/secretory (ES) products. Analysis of the glycolipids derived from ES

Chapter 6 _

150

products showed that they comprise species with Lex and pseudo-Ley determinants.

These ES products that enter the surrounding tissue are good candidate antigens to

be encountered by surveying DCs, such as the DC-SIGN positive CD1a negative

dermal DCs, which are found mostly in the upper dermis (35; 49; 50).

A remarkable finding is that human DCs recognize Lex and LDN-F glycan antigens

within schistosomes (28), which can be considered as “self-glycan” antigens since

they are also found on human glycoconjugates. It has been proposed that DC-SIGN,

which also interacts with several “self-ligands” such as ICAM-2 and ICAM-3, may

principally function in normal homeostasis, rather than being a true pattern

recognition receptor (26). Current views are that pathogens target DC-SIGN or other

CLRs to promote immune escape (51). For example, Mycobacterium tuberculosis

secretes glycoconjugates that are recognized by DC-SIGN to down regulate TLR

induced immune activation (52). Pathogens like HIV-1 have many strategies to evade

immune recognition or to modulate immune responses to survive in their hosts. In

HIV-1 infection, DC-SIGN plays a role in internalization of the virus into DCs, but

instead of being routed to the lysosomal compartment for degradation, part of the

infectious virus remains hidden in the DC, to subsequently infect target cells (51).

Schistosomes survive for many years in the host despite a pronounced immune

response, indicating that these helminths have effective strategies to escape or

suppress the host immune system. In a mouse model system, SEA and its major

glycan antigen Lex can induce a TH2-mediated immune response, which is associated

with persistence of the pathogen (53). Our data here show that DC-SIGN does not

only recognize the self-glycan ligand Lex within cercarial glycolipids, but also

glycolipids carrying pseudo-Ley, a non-self structure that so far is only found within

schistosome cercarial glycolipids (5) and ES products (this study). Pseudo-Ley may be

regarded as a glycan antigen that mimics a self-glycan to fit within the CRD of DC-

SIGN. The abundant expression of such self-glycans or glycan antigens that mimic

self-glycans, may allow schistosomes to mislead the host immune system by down

regulating DC function in all stages of infection. However, DC-SIGN has been shown

to internalize schistosome glycoconjugates (unpublished) and could also play a role in

processing of these glycoconjugates and antigen presentation. Since currently more

than 200 million people have schistosomiasis, it is challenging to understand the

central role of DCs in both the strong immune response that is evoked upon infection,


151

as well as in the immune evasion and suppression mechanisms that are exploited by

the schistosomes.

References 1. Pearce, E. J. and MacDonald, A. S. (2002) Nat.Rev.Immunol. 2, 499-511 2. Cummings, R. D. and Nyame, A. K. (1999) Biochim.Biophys.Acta 1455, 363-374 3. Hokke, C. H. and Deelder, A. M. (2001) Glycoconj.J. 18, 573-587 4. Makaaru, C. K., Damian, R. T., Smith, D. F., and Cummings, R. D. (1992) J.Biol.Chem. 267,

2251-2257 5. Wuhrer, M., Dennis, R. D., Doenhoff, M. J., Lochnit, G., and Geyer, R. (2000) Glycobiology

10, 89-101 6. Wuhrer, M., Dennis, R. D., Doenhoff, M. J., Bickle, Q., Lochnit, G., and Geyer, R. (1999)

Mol.Biochem.Parasitol. 103, 155-169 7. Wuhrer, M., Dennis, R. D., Doenhoff, M. J., and Geyer, R. (2000) Biochim.Biophys.Acta

1524, 155-161 8. Weiss, J. B., Magnani, J. L., and Strand, M. (1986) J.Immunol. 136, 4275-4282 9. Khoo, K. H., Chatterjee, D., Caulfield, J. P., Morris, H. R., and Dell, A. (1997) Glycobiology 7,

653-661 10. Khoo, K. H., Sarda, S., Xu, X., Caulfield, J. P., McNeil, M. R., Homans, S. W., Morris, H. R.,

and Dell, A. (1995) J.Biol.Chem. 270, 17114-17123 11. Srivatsan, J., Smith, D. F., and Cummings, R. D. (1992) J.Biol.Chem. 267, 20196-20203 12. Nyame, K., Smith, D. F., Damian, R. T., and Cummings, R. D. (1989) J.Biol.Chem. 264, 3235-

3243 13. Van Remoortere, A., Hokke, C. H., Van Dam, G. J., Van Die, I., Deelder, A. M., and Van den

Eijnden, D. H. (2000) Glycobiology 10, 601-609 14. Wuhrer, M., Kantelhardt, S. R., Dennis, R. D., Doenhoff, M. J., Lochnit, G., and Geyer, R.

(2002) Eur.J.Biochem. 269, 481-493 15. Van Dam, G. J., Bergwerff, A. A., Thomas-Oates, J. E., Rotmans, J. P., Kamerling, J. P.,

Vliegenthart, J. F., and Deelder, A. M. (1994) Eur.J.Biochem. 225, 467-482 16. Velupillai, P. and Harn, D. A. (1994) Proc.Natl.Acad.Sci.U.S.A 91, 18-22 17. Velupillai, P., dos Reis, E. A., dos Reis, M. G., and Harn, D. A. (2000) Hum.Immunol. 61, 225-

232 18. Okano, M., Satoskar, A. R., Nishizaki, K., and Harn, D. A., Jr. (2001) J.Immunol. 167, 442-

450 19. Figdor, C. G., Van Kooyk, Y., and Adema, G. J. (2002) Nat.Rev.Immunol. 2, 77-84 20. Kadowaki, N., Ho, S., Antonenko, S., Malefyt, R. W., Kastelein, R. A., Bazan, F., and Liu, Y. J.

(2001) J.Exp.Med. 194, 863-869 21. Michelsen, K. S., Aicher, A., Mohaupt, M., Hartung, T., Dimmeler, S., Kirschning, C. J., and

Schumann, R. R. (2001) J.Biol.Chem. 276, 25680-25686 22. Visintin, A., Mazzoni, A., Spitzer, J. H., Wyllie, D. H., Dower, S. K., and Segal, D. M. (2001)

J.Immunol. 166, 249-255 23. Hertz, C. J., Kiertscher, S. M., Godowski, P. J., Bouis, D. A., Norgard, M. V., Roth, M. D., and

Modlin, R. L. (2001) J.Immunol. 166, 2444-2450 24. Van der Kleij, D., Latz, E., Brouwers, J. F., Kruize, Y. C., Schmitz, M., Kurt-Jones, E. A.,

Espevik, T., de Jong, E. C., Kapsenberg, M. L., Golenbock, D. T., Tielens, A. G., and Yazdanbakhsh, M. (2002) J.Biol.Chem. 277, 48122-48129

25. Weis, W. I., Taylor, M. E., and Drickamer, K. (1998) Immunol.Rev. 163, 19-34 26. Geijtenbeek, T. B., Van Vliet, S. J., Engering, A., 't Hart, B. A., and Van Kooyk, Y. (2004)

Annu.Rev.Immunol. 22, 33-54 27. Van Kooyk, Y. and Geijtenbeek, T. B. (2003) Nat.Rev.Immunol. 3, 697-709 28. Van Die, I., Van Vliet, S. J., Nyame, A. K., Cummings, R. D., Bank, C. M., Appelmelk, B.,

Geijtenbeek, T. B., and Van Kooyk, Y. (2003) Glycobiology 13, 471-478 29. Feinberg, H., Guo, Y., Mitchell, D. A., Drickamer, K., and Weis, W. I. (2005) J.Biol.Chem.

280, 1327-1335 30. Feinberg, H., Mitchell, D. A., Drickamer, K., and Weis, W. I. (2001) Science 294, 2163-2166 31. Van Liempt, E., Imberty, A., Bank, C. M., Van Vliet, S. J., Van Kooyk, Y., Geijtenbeek, T. B.,

and Van Die, I. (2004) J.Biol.Chem. 279, 33161-33167

Chapter 6 _

152

32. Geijtenbeek, T. B., Van Duijnhoven, G. C., Van Vliet, S. J., Krieger, E., Vriend, G., Figdor, C. G., and Van Kooyk, Y. (2002) J.Biol.Chem. 277, 11314-11320

33. Sallusto, F. and Lanzavecchia, A. (1994) J.Exp.Med. 179, 1109-1118 34. Geijtenbeek, T. B., Kwon, D. S., Torensma, R., Van Vliet, S. J., Van Duijnhoven, G. C., Middel,

J., Cornelissen, I. L., Nottet, H. S., KewalRamani, V. N., Littman, D. R., Figdor, C. G., and Van Kooyk, Y. (2000) Cell 100, 587-597

35. Geijtenbeek, T. B., Torensma, R., Van Vliet, S. J., Van Duijnhoven, G. C., Adema, G. J., Van Kooyk, Y., and Figdor, C. G. (2000) Cell 100, 575-585

36. Stoll, M. S., Mizuochi, T., Childs, R. A., and Feizi, T. (1988) Biochem.J. 256, 661-664 37. Sluiters, J. F., Brussaard-Wust, C. M., and Meuleman, E. A. (1980) Z.Parasitenkd. 63, 13-26 38. Guo, Y., Feinberg, H., Conroy, E., Mitchell, D. A., Alvarez, R., Blixt, O., Taylor, M. E., Weis, W.

I., and Drickamer, K. (2004) Nat.Struct.Mol.Biol. 11, 591-598 39. Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H., Shindyalov, I.

N., and Bourne, P. E. (2000) Nucleic Acids Res. 28, 235-242 40. Imberty, A., Mikros, E., Koca, J., Mollicone, R., Oriol, R., and Perez, S. (1995) Glycoconj.J. 12,

331-349 41. Clark, M., Cramer, R. D. I., and Van den Opdenbosch, N. J. (1989) J. Comput. Chem. 10, 982-

1012. 42. Sorme, P., Arnoux, P., Kahl-Knutsson, B., Leffler, H., Rini, J. M., and Nilsson, U. J. (2005)

J.Am.Chem.Soc. 127, 1737-1743 43. Appelmelk, B. J., Van Die, I., Van Vliet, S. J., Vandenbroucke-Grauls, C. M., Geijtenbeek, T. B.,

and Van Kooyk, Y. (2003) J.Immunol. 170, 1635-1639 44. Janeway, C. A., Jr. and Medzhitov, R. (2002) Annu.Rev.Immunol. 20, 197-216 45. Dyatlovitskaya, E. V. and Bergelson, L. D. (1987) Biochim.Biophys.Acta 907, 125-143 46. Ziegler-Heitbrock, H. W., Kafferlein, E., Haas, J. G., Meyer, N., Strobel, M., Weber, C., and

Flieger, D. (1992) J.Immunol. 148, 1753-1758 47. Lochnit, G., Dennis, R. D., Ulmer, A. J., and Geyer, R. (1998) J.Biol.Chem. 273, 466-474 48. Lee, H. K., Lee, J., and Tobias, P. S. (2002) J.Immunol. 168, 4012-4017 49. Ebner, S., Ehammer, Z., Holzmann, S., Schwingshackl, P., Forstner, M., Stoitzner, P., Huemer,

G. M., Fritsch, P., and Romani, N. (2004) Int.Immunol. 16, 877-887 50. Soilleux, E. J., Morris, L. S., Leslie, G., Chehimi, J., Luo, Q., Levroney, E., Trowsdale, J.,

Montaner, L. J., Doms, R. W., Weissman, D., Coleman, N., and Lee, B. (2002) J.Leukoc.Biol. 71, 445-457

51. Van Kooyk, Y., Engering, A., Lekkerkerker, A. N., Ludwig, I. S., and Geijtenbeek, T. B. (2004) Curr.Opin.Immunol. 16, 488-493

52. Geijtenbeek T.B., Van Vliet, S. J., Koppel E.A., Sanchez-Hernandez M., Vandenbroucke-Grauls C.M., Appelmelk, B., and Van Kooyk, Y. (2002). J Exp Med. 197, 7-17.

53. Okano, M., Satoskar, A. R., Nishizaki, K., Abe, M., and Harn, D. A., Jr. (1999) J.Immunol. 163, 6712-6717

54. Domon, B. and Costello, C. E. (1988) Biochemistry 27, 1534-1543

Schistosoma mansoni soluble egg antigens are internalized by human dendritic cells through multiple C-type lectins and suppress TLR-induced dendritic cell

activation

Ellis van Liempt, Sandra J. van Vliet, Anneke Engering, Juan Jesús

García Vallejo, Christine M.C. Bank, Marta Sanchez-Hernandez, Yvette

van Kooyk and Irma van Die

Molecular Immunology, in press

Chapter 7

SEA is internalized by multiple C-type lectins

155

Abstract

In Schistosomiasis, a parasitic disease caused by helminths, the parasite eggs induce

a T helper 2 cell (TH2) response in the host. Here, the specific role of human

monocyte-derived dendritic cells (DCs) in initiation and polarization of the egg-

specific T cell responses was examined. We demonstrate that immature DCs (iDCs)

pulsed with schistosome soluble egg antigens (SEA) do not show an increase in

expression of co-stimulatory molecules or cytokines, indicating that no conventional

maturation was induced. The ability of SEA to affect the Toll-like receptor (TLR)

induced maturation of iDCs was examined by copulsing the DCs with SEA and TLR-

ligands. SEA suppressed both the maturation of iDCs induced by poly I:C and LPS, as

indicated by a decrease in co-stimulatory molecule expression and production of IL-

12, IL-6 and TNF-α. In addition, SEA suppressed TH1 responses induced by the poly

I:C-pulsed DCs, and skewed the LPS-induced mixed response towards a TH2

response. Immature DCs rapidly internalized SEA through the C-type lectins DC-

SIGN, MGL and the mannose receptor and the antigens were targeted to MHC class

II-positive lysosomal compartments. The internalization of SEA by multiple C-type

lectins may be important to regulate the response of the iDCs to TLR-induced signals.

Chapter 7 _

156

Introduction

The parasitic helminth Schistosoma mansoni is the causative agent of the chronic

disease schistosomiasis, which affects ~ 300 million people worldwide, particularly in

tropical countries (1). The disease is characterized by granulomatous reactions

around viable eggs entrapped in host tissues (2). Schistosomes are multicellular

organisms, which present a wide variety of antigens to the host. Increasing evidence

indicates that glycoconjugated antigens expressed by the schistosomes play a critical

role in the immunobiology of schistosomiasis (3). Among these are soluble egg

antigens (SEA), a complex mixture of diverse glycoconjugates such as glycoproteins

and glycolipids, which are secreted by Schistosoma mansoni eggs entrapped in the

liver of the host. The early stage of infection with S. mansoni leads to a TH1 response.

As the infection progresses and eggs are released by the adult worms, the TH1

response declines and switches towards a TH2 response, driven by the egg antigens.

Dendritic cells (DCs) are antigen-presenting cells that perform an essential role in the

generation and regulation of adaptive immune responses. Precursor DCs migrate

from the blood into the peripheral tissues and immature DC function as a continuous

surveillance patrol for incoming foreign antigens. DCs capture and internalize such

antigens/pathogens for presentation to T cells in lymph nodes. In addition, DCs

provide signals that direct naïve TH cells to proliferate and differentiate into TH1, TH2

or T regulatory cells (4). To become licensed to activate naïve TH cells, DCs must

undergo a maturation process (5). Maturation can be induced by immune system

intrinsic signals, such as IFN-α, TNF-α and CD40L (6) or by pathogen-derived

signals (7).

DCs express a wide range of receptors for the recognition of microbes or microbial

products, including C-type lectins (CLRs) and Toll-like receptors (TLRs). CLRs

recognize carbohydrates on self or non-self glycoproteins. SEA is highly glycosylated

enabling its recognition by CLRs. We have previously reported that DC-SIGN (8) and

MGL (9) strongly bind SEA, but it is unclear whether other CLRs expressed by DC are

involved in the recognition of SEA and whether they recognition by CLRs leads to

internalization of the antigens and induction of TH2 polarizing signals.


157

Recent reports indicate that schistosome components interact with TLRs.

Schistosome egg-derived dsRNA has been reported as a ligand for TLR3 (10) and in

mice TLR4 has been implicated in TH2 cell development (11). Lysophosphatidylserine

a lipid from either S. mansoni adult worms or eggs, is able to polarize allogenic T cells

towards a TH2 development through a TLR2 dependent mechanism (12). There is

increasing evidence that glycans play an important role in the induction of a TH2

response. In mice, Lacto-N-fucopentaose III, containing the trisaccharide Lewis x

(Lex), promotes a TH2 cell response in a TLR4 dependent manner (11;13;14). Also

glycoconjugates carrying complex-type N-glycans with amongst others core α1,3-

fucose and core β1,2-xylose determinants, have the capacity to generate a strong TH2-

biased cellular response in mice (15). Such TH2 skewing is seen in many parasitic

helminth infections and in general is parasite permissive (16-18), but the TH2 cells

also provide the host with protective mechanisms to survive the infection (1). The

mechanisms by which parasite-derived carbohydrates modulate host immune

responses remain largely unknown. Certain pathogens that target CLRs through their

carbohydrate moieties induce inhibitory or stimulatory signals in DCs that result in

modulation of DC function (19-22). These examples show that CLRs can act in

synergy with other receptors, in particular through cross talk with TLRs, which may

also play a role in schistosome infection.

To increase our understanding of the role of human DCs in the egg-induced TH2

responses in schistosome infection, we examined in this study the ability of

monocyte-derived iDCs, pulsed with SEA or copulsed with SEA and TLR-ligands, to

mature and induce polarized T cell responses, and focused on the interaction of SEA

with DC-expressed CLRs. Our results show that DC-SIGN, MGL as well as the

mannose receptor play a role in binding and subsequent internalization of SEA. Co-

localization of SEA with MHC II in the lysosomal compartments suggests that Ag

processing and presentation can occur. Although SEA by itself did not induce DC

activation, copulsing iDCs with SEA and TLR ligands resulted in suppression of the

TLR-induced maturation and modulation of the T cell polarizing capacity of DCs.

Chapter 7 _

158

Material and Methods

Cells Immature DCs were obtained from buffycoats of healthy donors (Sanquin,

Amsterdam) as previously described (23). In short, human PBMCs were isolated by a

Ficoll gradient. Monocytes were isolated by CD14 magnetic microbeads isolation

(MACS; Miltenyibiotec, USA) and differentiated into immature DCs in the presence

of IL-4 and GM-CSF (500 and 800 U/ml, respectively; Biosource, Nivelles, Belgium).

DCs expressed high levels of major histocompatibility complex class I and II, CD11b,

CD11c, and ICAM-1 and low levels of CD80 and CD86, as was confirmed by flow

cytometry

Antibodies and reagents The following antibodies were used: AZN-D1 (anti-DC-

SIGN) (24;25), 1G6.6 (anti-MGL (26)), 3.29.B1(IgG1, anti-MR, (27)), anti-DEC-205

(28), anti-DCIR (R&D systems), anti-LAMP-1 (H4A3, BD Pharmingen), EEA-1

(Abcam, Cambridge, UK), Q5/13 (anti-MHC II;(29)), PE-conjugated antibodies

against CD80, CD86 and HLA-DR (BD Pharmingen) and CD83 (Immunotech). Goat

anti-mouse and goat anti-rabbit conjugated with Alexa Fluor 594 (Molecular Probes),

goat anti-mouse and goat anti-human conjugated with peroxidase (Jackson

Immunoresearch, West Grove, Pa). Carbohydrate components mannan,

mannosylated biotinylated BSA, GalNAc and laminarin were all from Sigma Aldrich.

Crude Schistosoma mansoni soluble egg antigens (SEA) extract was prepared as

described previously (30) and was provided by F. Lewis (Biomedical Research

Institute, Rockville, MD). SEA does not contain detectable levels of LPS, as was

shown by the inability of SEA to induce IL-8 production by TLR2 and TLR4

transfected cell-lines (kind gift of Douglas Gohlenbock) (data not shown).

DC maturation Immature monocyte derived DCs (day 4) were stimulated with SEA

(5 or 50 μg/ml) in the presence or absence of LPS (10 ng/ml; Salmonella typhosa,

Sigma-Aldrich, St Louise, MO) or poly I:C (10 μg/ml; Sigma-Aldrich) for 24 hrs at

37ºC. Cell-surface expression of MHC class II (HLA-DR) and co-stimulatory

molecules CD80, CD83, and CD86 using PE-conjugated antibodies was used to

determine maturation.

Cytokines measurements For the detection of cytokines, culture supernatants were

harvested 24 hrs after DC activation and frozen at -80°C until analysis. Cytokines


159

were measured by enzyme-linked immunosorbant assay (ELISA) with CytoSetsTM

ELISA kits (Biosource) for human IL-6, IL-10, TNF-α and IL-12p40 according to the

manufacturer’s instructions. Human IL-12p70 detection was determined as described

before (31).

Dendritic cell-driven TH1/TH2 differentiation Immature DCs were cultured from

monocytes of healthy donors in Iscove’s Modified Dulbecco’s Medium (Gibco),

supplemented with 10% FCS (BioWithaker, Verviers, Belgium), 500 U/ml IL-4 and

800 U/ml GM-CSF (Biosource) (23). At day 6, DC-maturation was induced with SEA

in combination with LPS or poly I:C. The following positive controls were included in

the assay: (i) 10 ng/ml E. coli LPS, (mixed TH1/ TH2 response); (ii) 20 μg/ml poly I:C

(TH1); and (iii) 10 μg/ml PGE2 and 10ng/ml LPS (TH2). After 2 days, DCs were

washed and incubated with autologous CD45RA+/CD4+ T cells (5.103 DC / 20.103 T

cells). In parallel, DCs were analyzed for maturation markers (CD83 and CD86) by

flowcytometry. At day 5, rIL-2 (10 U/ml) was added, and the cultures were expanded

for the next 7 days. To determine cytokine production by TH cells, at day 12-15

quiescent T cells were re-stimulated with 10 ng/ml PMA and 1 μg/ml ionomycin

(both Sigma-Aldrich) for 6 h. After 1 h 10 μg/ml Brefeldin A (Sigma-Aldrich) was

added to the T cells. Single cell production of IL-4 and IFN-γ was determined by

intracellular flowcytometric analysis. Cells were fixed in 2% PFA, permeabilized with

0.5% saponin (Sigma-Aldrich) and stained with anti-human IFN-γ-FITC and anti-

human IL-4-PE (BD Pharmingen).

mRNA isolation and cDNA synthesis mRNA was isolated by poly (A+) RNA capture

in streptavidin-coated tubes with an mRNA Capture kit (Roche, Switzerland) and

cDNA was synthesized with the Reverse Transcription System kit (Promega, USA)

following manufacturer’s guidelines. In brief, cells were washed twice with ice-cold

PBS and harvested with 100 μl lysis-buffer. Lysates were incubated with biotin-

labeled oligo(dT)20 for 5 min at 37 °C. The mix was transferred to streptavidin-coated

tubes and incubated for 5 min at 37°C. After washing 3 times with 200 μl washing

buffer, 30 μl of the reverse transcription mix (5mM MgCl2, 1x reverse transcription

buffer, 1 mM dNTP, 0.4 U recombinant RNasin ribonuclease inhibitor, 0.4 U AMV

reverse transcriptase, 0.5 μg random hexamers in nuclease-free water) were added to

Chapter 7 _

160

the tubes and incubated for 10 min at room temperature followed by 45 min at 42°C.

To inactivate AMV reverse transcriptase and separate mRNA from the streptavidin-

biotin complex, samples were heated at 99°C for 5 min, transferred to

microcentrifuge tubes and incubated on ice for 5 min, diluted 1:2 in nuclease-free

water, and stored at -20°C.

Quantitative Real-Time PCR Oligonucleotides were designed by using computer

software Primer Express 2.0 (Applied Biosystems, USA) and synthesized by Isogen

lifescience (IJsselstein, the Netherlands). Primer specificity was computer tested

(BLAST, National center for Biotechnology Information) by homology search with the

human genome and later confirmed by dissociation curve analysis. PCR reactions

were performed with SYBR green method in an ABI 7900HT sequence detection

system (Applied Biosystems). The reactions were set on a 96 well-plate by mixing 4 μl

of the 2 times concentrated SYBR Green Master Mix (Applied Biosystems) with 2 μl

of the primer solution containing 5 nmol/μl of both primers and 2 μl of a cDNA

solution. The thermal profile for all the reactions was 2 min at 50°C, followed by 10

min at 95°C and then 40 cycles of 15 sec at 95°C and 1 min 60°C. The fluorescence

monitoring occurred at the end of each cycle. The Ct value is defined as the number of

PCR cycles where the fluorescence signal exceeds the threshold value, which is fixed

above 10 times the standard deviation of the fluorescence during the first 15 cycles

and typically corresponds to 0.2 relative fluorescence units. This threshold is set

constant throughout the study and corresponds to the log linear range of the

amplification curve. The normalized amount of target, or relative abundance, reflects

the relative amount of target transcripts with respect to the expression of the

endogenous reference gene. GAPDH served as an endogenous reference gene (32).

Fluorescent bead adhesion assay SEA binding to whole cells was measured by bead

adhesion assay as described previously (33). In short, streptavidin was covalently

coupled onto carboxylate-modified TransFluorSpheres (488/654 nm, 1.0 μm,

Molecular Probes Inc, Eugene, OR). SEA was biotinylated with EZ-linkTM NHS-LC-

LC-Biotin, according to the manufacturer’s protocol (Pierce, Rockford, IL).

Biotinylated SEA was coupled to streptavidin coated fluorescent beads (34). Cells

were resuspended in TSM (20 mM Tris-HCl [pH 8.0], 150 mM NaCl, 1mM CaCl2, 2


161

mM MgCl2) and 0.5% BSA. After pre-incubation with blocking antibodies against C-

type lectins (20 μg/ml), mannan (50 μg/ml), GalNAc (50 mM), mannosylated

biotinylated BSA (50 μg/ml), laminarin (100 μg/ml) or EGTA (10 mM) for 10 min at

room temperature in TSM-0.5% BSA, cells were incubated with ligand-coated

fluorescent beads (20 beads/cell) for 45 min at 37ºC. Bead adhesion to the cells was

determined using flow cytometry (FACScan, Becton Dickinson, Oxnard, CA).

Internalization assay Immature DCs were incubated with biotinylated SEA (10

μg/ml) in TSA for 1 h on ice and were subsequently washed. Where indicated cells

were pre-incubated with Abs directed against C-type lectins for 30 min at 37ºC. Cells

were incubated at 37°C for various times, placed on ice and incubated with

streptavidin Alexa Fluor 488. To control for off-rate of SEA at 37°C, cells were fixed

(2% PFA) before SEA binding to prevent membrane transport. Cells were analyzed

using flow cytometry, and the relative difference in mean fluorescence intensity

compared with fixed cells was calculated.

Confocal laser scanning microscopy SEA was labeled with Alexa Fluor 488 according

to the manufacturer’s protocol (Molecular Probes, Eugene, OR). Dendritic cells were

incubated for 2 hrs at 37ºC with Alexa Fluor 488-conjugated SEA (10 μg/ml).

Labeled cells were fixed and permeabilized for 20 min at 4ºC (BD cytofix/cytoperm

TM, BD). Cells were stained in phosphate-buffered saline containing 0.5 % bovine

serum albumin and 0.1% saponin, with antibodies against LAMP-1, EEA-1, DC-SIGN,

MGL or MR and subsequently with Alexa Fluor 594-conjugated secondary

antibodies. Cells were allowed to adhere to poly-L-lysine-coated glass slides, mounted

with anti-bleach reagent and analyzed by confocal microscopy. Leica AOBS SP2

confocal laser scanning microscope (CLSM) system was used, containing a DM-IRE2

microscope with glycerol objective lens (PL APO 63x/NA1.30) and images were

acquired using Leica confocal software (version 2.61).

Chapter 7 _

162

Results

SEA inhibits DC activation induced by TLR3 and TLR2/4 ligands

To examine the capacity of SEA to induce maturation of human DCs, we pulsed

monocyte-derived immature DCs (iDCs) with SEA in different concentrations. SEA

alone did not induce DC maturation, as none of the activation markers CD80, CD83,

CD86 or HLA-DR were up regulated, not even at high concentrations of SEA (up to

100 μg/ml, Fig. 1A and data not shown). Furthermore iDCs incubated for 24h with

SEA do not secrete any IL-10, IL-6, IL-12p40, IL-12p70 or TNF-α, as is shown for 5

and 50 μg/ml SEA in Fig. 1B. Next, we investigated whether SEA could inhibit the

maturation of DCs induced by the TLR3 and TLR2/4 ligands, poly I:C and LPS

respectively, to mimic the situation in schistosome infection where TLR2, TLR3 and

TLR4 have been implicated to play a role (10-12). The results show that both the LPS

and the poly I:C induced maturation was inhibited in the presence of SEA in a dose

dependent manner as 50 μg/ml SEA induces more inhibition than 5 μg/ml SEA.

CD80, CD83 and CD86 up-regulation is inhibited (30 to 45%) compared to LPS- or

poly I:C-activated DCs (Fig. 1C). Furthermore in the presence of SEA, DCs produced

reduced levels of all cytokines tested, TNF-α, IL-6, IL-10, IL-12p40 and IL-12p70, in

a dose dependent manner (Fig 1D). For IL-10 we observed that although most donors

tested (19 out of 30) displayed a reduction in IL-10 production in the presence of

SEA, some donors did not produce IL-10 at all (n=3), or produce equal amounts of

IL-10 in the presence or absence of SEA (n=8). In conclusion, SEA does not induce

maturation of human iDCs, but inhibits both the TLR3 and TLR2/4 ligand induced

activation of DCs. Such inhibition is not a generally observed; as for example E/S

products secreted from schistosomula do not have this effect on DC activation (van

Liempt et al., unpublished).


163

Figure 1. SEA inhibits the poly I:C or LPS induced DC activation and cytokine production. A. SEA does not induce maturation of immature DCs. Immature DCs were incubated with LPS or different concentrations of SEA for 18h, and activation was determined by measuring the expression of CD80, CD83 and CD86. Dotted line represents isotype controls; dark line represents immature DCs treated with either LPS (10 ng/ml) or SEA (5 or 50 μg/ml). One representative experiment out of three is shown. Numbers reflect mean fluorescence intensity values. B.SEA does not induce production of IL-10, IL-6, IL-12p40, IL-12p70 and TNF-α. Supernatants were harvested after 18h and cytokine production was determined by ELISA. C. SEA inhibits the LPS or poly I:C induced maturation. Immature DCs were treated with LPS (10 ng/ml) or poly I:C (10 μg/ml) in the presence or absence of SEA (5 or 50 μg/ml). Activation was determined as in A. D. SEA inhibits the LPS or poly I:C induced cytokine production for IL-10, IL-6, IL-12p40, IL-12p70 and TNF-α, in a dose dependent manner. Supernatants were harvested after 18h and cytokine production was measured by ELISA.

Chapter 7 _

164

Modulation of polarized T cell responses by SEA

In schistosomiasis, the early phase of infection is characterized by TH1 immune

responses that are modulated to TH2 upon egg laying, driven by the egg antigens (1).

To asses the DC-driven T cell responses, DCs were pulsed with SEA in combination

with LPS or poly I:C and cocultured with naïve T cells . As described previously (35),

DCs incubated with LPS induce naïve T cell differentiation into a mixed TH1/TH2

response, whereas poly I:C induces a dominant TH1 response and PGE2 a TH2

response (Fig. 2). Our data show that SEA alone could not support T cell

differentiation (Fig. 1 and data not shown). Interestingly, coculture of iDCs with a

mixture of SEA and TLR ligands resulted in a down modulation of the TH1 responses

induced by poly I:C and skewing of the mixed TH1/TH2 response induced by LPS

towards a TH2 response. SEA could not skew the T H1 response of poly I:C towards a

T H2, possibly because the T H1 response induced by poly I:C is too strong.

Figure 2. Poly I:C and SEA co-stimulation results in down modulated TH1 response. DCs were incubated with SEA, LPS, poly I:C or PGE2 for 48 h, washed and co-cultured with highly purified CD45RA+CD4+ T cells. Naïve T cells were restimulated with PMA and ionomycin, and intracellular IL-4 (TH2) and IFN-γ (TH1) was analyzed on a single cell basis by flow cytometry. Two out of five donors are shown.

SEA binds to both immature and mature dendritic cells.

To assess the capacity of different immune cells to bind SEA, a bead adhesion assay

was performed. SEA was biotinylated, coupled to streptavidin coated fluorescent

beads [34] and incubated with different immune cells. As shown in Figure 3, SEA

does not bind to monocytes, PBMCs or PBLs isolated from blood of healthy donors.

In contrast, SEA bind strongly to iDCs, and displays a reduced binding to DCs

matured with LPS or poly I:C (Fig. 3). The binding of iDCs to SEA could be

completely blocked by preincubation with EGTA, indicating that the binding is Ca2+-


165

dependent. Both findings suggest that DC-expressed CLRs are involved in the

recognition of SEA.

Figure 3. SEA-beads bind to immature and mature DCs. SEA was biotinylated and coupled to streptavidin-coated fluorescent beads (SEA-beads). Binding of the beads to the cells was measured by FACScan analysis using Cellquest (Becton Dickinson, Oxnard, CA). SEA-beads show binding to immature and mature DCs. The binding was completely blocked by the calcium chelator EGTA.

Expression of pathogen receptors on DCs

We have previously reported that SEA is recognized by iDCs through the CLRs DC-

SIGN (8) and MGL (9). Because SEA contains many different glycan antigens it is

likely that also other CLRs than DC-SIGN and MGL are involved in the binding of

SEA. To identify possible candidate lectins, we determined the expression levels of

CLRs by RT-PCR for both immature and mature DCs. DCs express high levels of DC-

SIGN, MR and MGL as is indicated by a relative abundance of 1 or higher, moderate

levels of Dectin and DCIR (relative abundance of 0.84 and 0.41, respectively) and low

levels of DEC-205 (Table 1A). Upon maturation with either LPS or poly I:C, down- or

up regulation is indicated as a percentage of the expression on iDCs, which was set a

100%. Our data show that DC-SIGN is down regulated on mDCs to 2% (LPS) and 15%

(poly I:C) of the expression level of iDCs, and also MGL, MR, DCIR and Dectin are

down regulated on mDCs (Table 1A). In contrast, DEC-205 is up regulated on mDCs

(1175% and 784%). We also analyzed the expression levels of TLRs, as these are

known to play a role in S. mansoni induced immune responses. Monocyte-derived

DCs express all TLRs tested except TLR9. Upon maturation by LPS and poly I:C

TLR1, TLR2, TLR4, TLR6, CD14 and MD2 are down regulated, whereas TLR3, TLR7

and TLR10 are up regulated. In DCs incubated with poly I:C, the TLR-8 expression

levels are up regulated.TLR5 expression levels remain unchanged upon maturation,

as well asTLR8 in DCs stimulated with LPS (Table 1B). In table 1C we show that

interaction of SEA with iDCs does not influence the expression of DC-SIGN, MGL

and MR in the absence, nor in the presence, of the TLR ligands LPS or poly I:C on

either immature or mature DCs. Thus, DCs express a variety of receptors that could

Chapter 7 _

166

be involved in SEA recognition and in particular TLR-induced maturation regulates

the expression level of these receptors.

Table 1. Expression levels of TLRs and CLRs on immature DCs or DCs stimulated with LPS or poly I:C. A and B). The relative abundance is shown for iDCs which reflects the relative amount of target transcript with respect to the expression of the endogenous reference gene GAPDH (including standard error). For LPS or poly IC stimulated DCs, the percentage of up- or down regulation is given, with standard error. The primers used were tested on positive controls prior to use. The values for TLR9 are indicated with bd, which means that the values were below detection limits. C). The expression levels of DC-SIGN, MGL and MR are shown on iDCs and DCs stimulated with LPS and poly I:C in the presence of SEA. The relative abundance is shown for iDCs. For the other conditions the percentage of up- or down regulation is given, with standard error, similar as described in A and B. Data represent mean values out of 6 donors.


167

C-type lectins interact with SEA

Next, the role of DC-expressed C-type lectins in the binding of SEA was analyzed. As

is shown in Figure 4a, DCs express DCIR, DEC-205 and MR on the cell surface, in

addition to DC-SIGN and MGL (filled histograms). On mature DCs, the expression of

DC-SIGN, MGL, MR and DCIR is reduced compared to iDCs, whereas higher

amounts of DEC-205 protein was observed (Fig. 4A, thick grey lines), as is in

agreement with mRNA levels (Table 1A). Specific antibodies to DC-SIGN and MGL

could reduce binding of iDCs to SEA with 40%, indicating that DC-associated DC-

SIGN and MGL bind to SEA (Fig. 4B). In addition, blocking antibodies to the

Mannose receptor (MR) could partially block binding, indicating that the MR is

involved in the binding of iDCs to SEA. Addition of sugar inhibitors that are known to

block interactions with these three CLRs (GalNAc (MGL), BSA-mannose (MR) and

mannan (DC-SIGN/MR)), resulted in a comparable reduction in binding as found by

using the anti-CLR antibodies as inhibitors. Remarkably, the binding of iDCs to SEA

could be completely inhibited by a combination of antibodies against DC-SIGN, MGL

and MR (Fig. 4B). By contrast, we could not observe inhibition of DC-binding to SEA

using blocking antibodies against DEC-205 (28) or DCIR (Fig. 4B), suggesting that

these CLRs are not involved in binding. The lack of inhibition by laminarin, which

inhibits binding to Dectin-1, suggests that Dectin-1 is not involved in binding of iDCs

to SEA (Fig. 4B). Together these data indicate that iDCs recognize SEA through the

CLRs DC-SIGN, MGL and the MR. The reduction of SEA binding to mature DCs (Fig.

3) corresponds to the observed lower expression of DC-SIGN, MGL and MR on

mature DCs compared to immature DCs (Fig. 4A/Table 1A).

SEA is internalized by DCs and targeted to the MHC class II+ LAMP+

compartments

C-type lectins function as endocytic receptors on DCs and are either constitutively

internalized from the cell surface, like the MR or internalized upon ligand binding, as

we have previously shown for DC-SIGN (27). We investigated whether SEA, upon

binding by C-type lectins, is internalized from the cell surface. Indeed, we found that

50% of the SEA is internalized from the cell surface, within 15-30 min (Fig. 5A). Next,

we investigated which CLRs on iDCs facilitate this rapid internalization of SEA. Our

results show that pre-incubation of DCs with blocking antibodies against DC-SIGN,

MR or MGL, could partially block the internalization of SEA up to 25%, 30% and 35%

Chapter 7 _

168

Figure 4. C-type lectins DC-SIGN, MGL and MR bind SEA on iDCs. A. C-type lectin expression on immature and mature DCs. Open histograms represent the isotype control and filled histograms represent the anti-C-type lectin mAb staining on iDCs. The thick grey line shows C-type lectin expression on LPS matured DCs. The CLR expression on poly I:C matured DCs are comparable to those on LPS matured DCs (not shown). B. Immature DCs strongly bind SEA through DC-SIGN, MGL and MR. A bead adhesion assay was performed in the presence or absence of blocking mAbs directed against C-type lectins or the polysaccharide mannan (DC-SIGN and MR), BSA-mannose (MR), Laminarin (Dectin), GalNAc (MGL) or EGTA (blocking all CLRs). Experiments were performed in duplicates and one representative experiment out of three is shown.

respectively (Fig. 5B). However, the combination of antibodies against all three CLRs

could block internalization of SEA completely, confirming that DC-SIGN, MGL as

well as the MR are all involved in capture and subsequent internalization of SEA into

DCs. In addition, co-localization of SEA with all three CLRs could be observed, using

confocal laser scanning microscopy (CLSM) (Fig. 5C). The subcellular localization of

SEA upon internalization was examined by staining with the lysosomal marker

LAMP-1 or early endosomal marker EEA-1 (Fig. 5D). After 30 min, SEA was localized

in EEA-1 positive compartments, whereas after 2h all SEA was localized within

LAMP-1 positive compartments, indicating that SEA captured by DC-SIGN, MGL and

MR traveled within 2h through endosomal compartments into lysosomes. At these

later time points, SEA co-localized with MHC class II molecules (Fig. 5E). Thus, we

conclude that upon capture, SEA is rapidly internalized by DCs through the CLRs DC-

SIGN, MGL and MR and targeted to the MHC class II+ lysosomes, suggesting that

SEA might be processed and presented.

Chapter 7 _

170

Discussion

In schistosomiasis, eggs released by the adult worms are entrapped in host tissues

and secrete soluble egg antigens (SEA), which results in the induction of a TH2

response (36-40). The mechanism by which DCs induce SEA-specific TH2 responses

during infection is not clearly understood. We show here that human monocyte-

derived iDCs pulsed with SEA, do not undergo a conventional maturation process in

vitro. However, SEA is rapidly internalized through multiple C-type lectins (CLRs)

and targeted into the MHC II+ lysosomal compartments. Furthermore, SEA can

inhibit the LPS- or poly I:C induced DC activation and subsequent production of IL-

12, TNFα, IL-6 and IL-10, resulting in modulation of the T cell polarizing capacity of

the DC. From these data we hypothesize that internalization of SEA through CLRs on

DCs leads to processing and presentation of SEA to T cells and may contribute to the

outcome of the TH1/TH2 balance by providing a TH2 polarizing signal to the DCs. In

addition, we propose that these CLRs may play a role in the SEA-induced down

modulation of LPS- or poly I:C induced maturation and subsequent cytokine

production.

Our data show that the C-type lectins DC-SIGN, MGL and the MR contribute to the

internalization and targeting of SEA to MHC II+ lysosomal compartments, where the

SEA can be processed and subsequently presented to T cells leading to a specific

immune response. Lectin-mediated uptake pathways have been shown to be highly

efficient to elicit immune responses (27,41).

Previously, we showed that DC-SIGN binds to SEA through the glycan antigens

Galβ1,4(Fucα1,3)GlcNAc (Lex) and GalNAcβ1,4(Fucα1,3)GlcNAc (LDNF) (8), whereas

MGL recognizes both LDNF and GalNAcβ1,4GlcNAc (LDN) moieties within SEA (9).

The actual glycan ligands for the MR within SEA have not been identified yet. The

MR preferentially targets mannose containing structures and differs from DC-SIGN

as it does not interact with Lex, despite having affinity for fucose (42). At this point it

remains unclear whether all schistosome antigens that are captured and internalized

by DCs will be presented to T cells, or that there is a more selective form of

presentation in which CLRs determine which antigens are presented and which are

not.


171

The immuno-regulatory role of DCs is believed to be determined by ligation of

pathogen-recognition receptors such as TLRs and CLRs, and signaling pathways

induced by these receptors, which can interconnect through a so-called cross talk.

Interestingly, a recent study shows that targeting the MR could prime a regulatory

program in DC, leading to the production of anti-inflammatory cytokines and

induction of TH2 cells with regulatory capacity (43). In addition, the production of

inflammatory cytokines by the TLR4-ligand LPS was prevented implying cross talk

between the MR and TLR4. Several examples illustrate that pathogen-induced

signaling through DC-SIGN results in a shift in TH1/TH2 balance. Signaling through

DC-SIGN by Lewis positive Helicobacter pylori results in a shift in the TH1/TH2

balance towards TH2, whereas Lewis negative H. pylori do not bind DC-SIGN and

trigger TH1 responses (19). Lactobacillus species L. reuteri and L. casei instruct DCs

to induce IL-10 producing regulatory T cells that suppress T cell responses through

engagement of DC-SIGN (35). Mycobacterium tuberculosis interacts with DCs

through its cell wall component ManLAM with DC-SIGN, which inhibits the TLR-

induced maturation and induces the immunosuppressive cytokine IL-10 (21).

Neisseria meningitidis expressing IgtB LPS targets DC-SIGN and skewed T cell

responses driven by DC towards TH1 activity (22). These reports suggest that CLRs

could play an important role in determining the outcome of the TH1/TH2 balance.

More insight in the signaling capacities of DC-SIGN was recently provided by studies

of Caparros et al. (44), which showed that ligation of DC-SIGN results in the

phosphorylation of ERK1/2 and Akt. Interestingly, DC-SIGN ligation synergizes with

TNF-α receptor-initiated signals for enhanced IL-10 release (45). Our observation

that copulsing of DC with SEA and LPS inhibits the capacity of LPS to activate DCs to

produce IL-10, despite the binding of SEA to DC-SIGN, indicates that SEA in addition

triggers other receptors that participate in the integration of the intracellular signals

to generate the SEA specific immune responses. Such receptors may include the MR

and/or MGL, but other unidentified TLRs or CLRs cannot be excluded. Our data

show that DC, pulsed with SEA, do not mature and cannot induce a T cell response in

vitro. In addition, coculture of SEA with cell-lines transfected with TLR2 or TLR4,

respectively, did not lead to induction of IL-8 (results not shown). Although these

data do not exclude the presence of TLR ligands in the SEA preparation, their

concentrations apparently are too low to induce maturation signals that support the

differentiation of naïve T cells in vitro. However, TLR agonists may in vivo be

Chapter 7 _

172

provided via other components of the eggs or worms. Aksoy and coworkers showed

that S. mansoni living eggs activate murine bone marrow-derived DCs through TLR2

and TLR3 engagement (10). Egg-derived RNA possessed RN-ase A-resistant and RN-

ase III-sensitive structures, suggesting the presence of double-stranded (ds)

structures, which are capable of triggering TLR3 activation. In addition, the

schistosome-specific lysophosphatidyl-serine was shown to activate human monocyte

derived DCs through TLR2, which results in the ability of DCs to induce the

development of IL-10 producing regulatory T cells as well as the induction of a TH2

response (12). Thus, since TLR2, TLR3 and TLR4 ligands have been implicated in

schistosomiasis (10-12), our data showing that SEA inhibits the poly I:C (TLR3) and

LPS(TLR2/TLR4)-induced maturation may have in vivo functional relevance.

Experimental infection of mice with S. mansoni has provided an extensively used

model for examining the development and role of TH2 responses driven by egg

antigens. Whereas SEA in the human system similarly as in mice has a TH2 polarizing

capacity, some differences in the mechanism are observed between the murine and

human system (36-40). Kane and coworkers reported that in BM-DCs of C57BL/6

mice SEA is able to down modulate LPS induced maturation, IL-12 production and to

up regulate IL-10 production (39). By contrast, we observed down regulation of both

IL-12 and IL-10 using human monocyte-derived DC upon copulsing with SEA and

LPS, or poly I:C, respectively. In addition, whereas we observed a rapid

internalization and targeting of SEA to MHC II positive lysosomal compartments by

human DC. Cervi et al., reported that murine bone-marrow-derived DCs internalized

SEA, but the SEA stayed in LAMP-2 negative compartments unless a maturation

stimulus was supplied (37). The observed differences between the mouse and human

system may reflect differences in DC receptors that are triggered by SEA. In

particular the expression in the type and specificity of C-type lectins may be different

between the mouse and human system.

Thomas et al. showed that HSA-conjugated Lacto-N-fucopentaose III, which contains

Lex, can activate murine bone marrow-derived DCs into a TH2 inducing phenotype

through a TLR4 dependent mechanism (11). LNFP III – TLR4 interaction in mice

induces signaling through the ERK pathway, and differs from the LPS-induced TLR4

activation that leads to intracellular signaling through three MAP-kinase signaling

pathways: ERK, p38 and JNK (11). Remarkably, signaling through DC-SIGN also


173

leads to ERK signaling without p38 stimulation, and thus resembles the LNFP III-

TLR4 signaling in that respect. Although many receptors will participate in the

integration of the intracellular signals to generate SEA specific responses in

schistosomiasis, it is tempting to speculate that the Lex - DC-SIGN interaction in

humans has a similar function as the Lex –TLR4 interaction in the murine system,

leading to ERK-signaling and contributing to a TH2-inducing DC maturation. It

would be interesting to investigate whether bone-marrow derived murine DCs show

next to TLR4-Lex interaction, also a (C-type) lectin-mediated binding of Lex or other

carbohydrate determinants. Clearly, the dissection of the receptors that interact with

Schistosome egg antigens, as well as the intracellular signals triggered upon binding,

need to be further investigated both in the human and murine system to clarify the

role of the different pathogen-recognition receptors in the generation of the egg-

specific TH2 responses.

References

1 Pearce, E. J. and MacDonald, A. S. 2002. The immunobiology of schistosomiasis.

Nat.Rev.Immunol 2:499-511. 2 Boros, E. E., Bigham, E. C., Boswell, G. E., Mook, R. A., Jr., Patel, S. S., Savarese, J. J., Ray, J.

A., Thompson, J. B., Hashim, M. A., Wisowaty, J. C., Feldman, P. L., and Samano, V., V 1999. Bis- and mixed-tetrahydroisoquinolinium chlorofumarates: new ultra-short-acting nondepolarizing neuromuscular blockers. J.Med.Chem. 42:1114.

3 Hokke, C. H. and Yazdanbakhsh, M. 2005. Schistosome glycans and innate immunity. Parasite Immunol. 27:257-264.

4 Kapsenberg, M. L. 2003. Dendritic-cell control of pathogen-driven T-cell polarization. Nat.Rev.Immunol. 3:984-993.

5 Mellman, I. and Steinman, R. M. 2001. Dendritic cells: specialized and regulated antigen processing machines. Cell 106:255-258.

6 Gallucci, S. and Matzinger, P. 2001. Danger signals: SOS to the immune system. Curr.Opin.Immunol. 13:114-119.

7 Akira, S. and Takeda, K. 2004. Toll-like receptor signalling. Nat.Rev.Immunol. 4:499-511. 8 van Die, I., van Vliet, S. J., Nyame, A. K., Cummings, R. D., Bank, C. M., Appelmelk, B.,

Geijtenbeek, T. B., and Van Kooyk, Y. 2003. The dendritic cell-specific C-type lectin DC-SIGN is a receptor for Schistosoma mansoni egg antigens and recognizes the glycan antigen Lewis x. Glycobiology 13:471-478.




12 van der Kleij, D., Latz, E., Brouwers, J. F., Kruize, Y. C., Schmitz, M., Kurt-Jones, E. A., Espevik, T., de Jong, E. C., Kapsenberg, M. L., Golenbock, D. T., Tielens, A. G., and

Chapter 7 _

174

Yazdanbakhsh, M. 2002. A novel host-parasite lipid cross-talk. Schistosomal lyso-phosphatidylserine activates toll-like receptor 2 and affects immune polarization. J Biol.Chem. 277:48122-48129.

13 Okano, M., Satoskar, A. R., Nishizaki, K., Abe, M., and Harn, D. A., Jr. 1999. Induction of Th2 responses and IgE is largely due to carbohydrates functioning as adjuvants on Schistosoma mansoni egg antigens. J.Immunol. 163:6712-6717.

14 Okano, M., Satoskar, A. R., Nishizaki, K., and Harn, D. A., Jr. 2001. Lacto-N-fucopentaose III found on Schistosoma mansoni egg antigens functions as adjuvant for proteins by inducing Th2-type response. J.Immunol. 167:442-450.

15 Faveeuw, C., Mallevaey, T., Paschinger, K., Wilson, I. B., Fontaine, J., Mollicone, R., Oriol, R., Altmann, F., Lerouge, P., Capron, M., and Trottein, F. 2003. Schistosome N-glycans containing core alpha 3-fucose and core beta 2-xylose epitopes are strong inducers of Th2 responses in mice. Eur.J Immunol 33:1271-1281.

16 Chensue, S. W., Terebuh, P. D., Warmington, K. S., Hershey, S. D., Evanoff, H. L., Kunkel, S. L., and Higashi, G. I. 1992. Role of IL-4 and IFN-gamma in Schistosoma mansoni egg-induced hypersensitivity granuloma formation. Orchestration, relative contribution, and relationship to macrophage function. J.Immunol. 148:900-906.

17 Pearce, E. J., Caspar, P., Grzych, J. M., Lewis, F. A., and Sher, A. 1991. Downregulation of Th1 cytokine production accompanies induction of Th2 responses by a parasitic helminth, Schistosoma mansoni. J.Exp.Med. 173:159-166.

18 Wynn, T. A., Eltoum, I., Cheever, A. W., Lewis, F. A., Gause, W. C., and Sher, A. 1993. Analysis of cytokine mRNA expression during primary granuloma formation induced by eggs of Schistosoma mansoni. J.Immunol. 151:1430-1440.


20 Engering, A., Geijtenbeek, T. B., and Van Kooyk, Y. 2002. Immune escape through C-type lectins on dendritic cells. Trends Immunol 23:480-485.


22 Steeghs, L., van Vliet, S. J., Uronen-Hansson, H., van Mourik, A., Engering, A., Sanchez-Hernandez, M., Klein, N., Callard, R., van Putten, J. P., van der, L. P., Van Kooyk, Y., and van de Winkel, J. G. 2006. Neisseria meningitidis expressing lgtB lipopolysaccharide targets DC-SIGN and modulates dendritic cell function. Cell Microbiol. 8:316-325.

23 Sallusto, F. and Lanzavecchia, A. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J.Exp.Med. 179:1109-1118.

24 Geijtenbeek, T. B., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Adema, G. J., Van Kooyk, Y., and Figdor, C. G. 2000. Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell 100:575-585.

25 Geijtenbeek, T. B., Krooshoop, D. J., Bleijs, D. A., van Vliet, S. J., van Duijnhoven, G. C., Grabovsky, V., Alon, R., Figdor, C. G., and Van Kooyk, Y. 2000. DC-SIGN-ICAM-2 interaction mediates dendritic cell trafficking. Nat.Immunol. 1:353-357.

26 van Vliet, S. J., van Liempt, E., Geijtenbeek, T. B., and Van Kooyk, Y. 2006. Differential regulation of C-type lectin expression on tolerogenic DC subsets. Immunobiology 211: 577-585

27 Engering, A., Geijtenbeek, T. B., van Vliet, S. J., Wijers, M., van Liempt, E., Demaurex, N., Lanzavecchia, A., Fransen, J., Figdor, C. G., Piguet, V., and Van Kooyk, Y. 2002. The dendritic cell-specific adhesion receptor DC-SIGN internalizes antigen for presentation to T cells. J Immunol 168:2118-2126.

28 Guo M., S.Gong, S.Maric, Z.Misulovin, M.Pack, K.Mahnke, M.C.Nussenzweig, and and R.Steinman 2000. A monoclonal antibody to the DEC-205 endocytosis receptor on human dendritic cells. Hum.Immunol. 61:729.

29 Quaranta, V., Walker, L. E., Pellegrino, M. A., and Ferrone, S. 1980. Purification of immunologically functional subsets of human Ia-like antigens on a monoclonal antibody (Q5/13) immunoadsorbent. J Immunol 125:1421-1425.

30 Nyame, A. K., Lewis, F. A., Doughty, B. L., Correa-Oliveira, R., and Cummings, R. D. 2003. Immunity to schistosomiasis: glycans are potential antigenic targets for immune intervention. Exp.Parasitol. 104:1-13.


175

31 Snijders, A., Hilkens, C. M., van der Pouw Kraan TC, Engel, M., Aarden, L. A., and Kapsenberg, M. L. 1996. Regulation of bioactive IL-12 production in lipopolysaccharide-stimulated human monocytes is determined by the expression of the p35 subunit. J.Immunol. 156:1207-1212.

32 Garcia-Vallejo, J. J., Van het Hof. B., Robben, J., Van Wijk, J. A., van Die, I, Joziasse, D. H., and Van Dijk, W. 2004. Approach for defining endogenous reference genes in gene expression experiments. Anal.Biochem. 329:293-299.

33 Geijtenbeek, T. B., Van Kooyk, Y., van Vliet, S. J., Renes, M. H., Raymakers, R. A., and Figdor, C. G. 1999. High frequency of adhesion defects in B-lineage acute lymphoblastic leukemia. Blood 94:754-764.

34 van Liempt, E., Imberty, A., Bank, C. M., van Vliet, S. J., Van Kooyk, Y., Geijtenbeek, T. B., and van Die, I. 2004. Molecular basis of the differences in binding properties of the highly related C-type lectins DC-SIGN and L-SIGN to Lewis X trisaccharide and Schistosoma mansoni egg antigens. J.Biol.Chem. 279:33161-33167.

35 Smits, H. H., Engering, A., van der Kleij, D., de Jong, E. C., Schipper, K., van Capel, T. M., Zaat, B. A., Yazdanbakhsh, M., Wierenga, E. A., Van Kooyk, Y., and Kapsenberg, M. L. 2005. Selective probiotic bacteria induce IL-10-producing regulatory T cells in vitro by modulating dendritic cell function through dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin. J.Allergy Clin.Immunol. 115:1260-1267.

36 Agrawal, S., Agrawal, A., Doughty, B., Gerwitz, A., Blenis, J., Van Dyke, T., and Pulendran, B. 2003. Cutting edge: different Toll-like receptor agonists instruct dendritic cells to induce distinct Th responses via differential modulation of extracellular signal-regulated kinase-mitogen-activated protein kinase and c-Fos. J Immunol 171:4984-4989.

37 Cervi, L., MacDonald, A. S., Kane, C., Dzierszinski, F., and Pearce, E. J. 2004. Cutting edge: dendritic cells copulsed with microbial and helminth antigens undergo modified maturation, segregate the antigens to distinct intracellular compartments, and concurrently induce microbe-specific Th1 and helminth-specific Th2 responses. J Immunol 172:2016-2020.

38 de Jong, E. C., Vieira, P. L., Kalinski, P., Schuitemaker, J. H., Tanaka, Y., Wierenga, E. A., Yazdanbakhsh, M., and Kapsenberg, M. L. 2002. Microbial compounds selectively induce Th1 cell-promoting or Th2 cell-promoting dendritic cells in vitro with diverse th cell-polarizing signals. J Immunol 168:1704-1709.

39 Kane, C. M., Cervi, L., Sun, J., McKee, A. S., Masek, K. S., Shapira, S., Hunter, C. A., and Pearce, E. J. 2004. Helminth antigens modulate TLR-initiated dendritic cell activation. J Immunol 173:7454-7461. 40 MacDonald, A. S., Straw, A. D., Bauman, B., and Pearce, E. J. 2001. CD8- dendritic cell

activation status plays an integral role in influencing Th2 response development. J.Immunol. 167:1982-1988.

41 Mahnke K.; Guo M.; Lee S.; Sepulveda H.; Swain S.L.; Nussenzweig M.; and Steinman R.M. 2000. The dendritic cell receptor for endocytosis, DEC-205, can recycle and enhance antigen presentation via major histocompatibility complex class II-positive Lysosomal compartments. J.Cell.Biol. 151:673-684.

42 Frison, N., Taylor, M. E., Soilleux, E., Bousser, M. T., Mayer, R., Monsigny, M., Drickamer, K., and Roche, A. C. 2003. Oligolysine-based oligosaccharide clusters: selective recognition and endocytosis by the mannose receptor and dendritic cell-specific intercellular adhesion molecule 3 (ICAM-3)-grabbing nonintegrin. J.Biol.Chem. 278:23922-23929.

43 Chieppa, M., Bianchi, G., Doni, A., Del Prete, A., Sironi, M., Laskarin, G., Monti, P., Piemonti, L., Biondi, A., Mantovani, A., Introna, M., and Allavena, P. 2003. Cross-linking of the mannose receptor on monocyte-derived dendritic cells activates an anti-inflammatory immunosuppressive program. J.Immunol. 171:4552-4560.


General Discussion

Chapter 8

General discussion

179

Human dendritic cell expressed CLRs play an important role in the recognition of

pathogens, but they also play an important role in the recognition of self-

glycoproteins as the interaction of DCs with the endothelium is mediated by DC-

SIGN and ICAM-2 and appeared to be dependent on the carbohydrate Lewis y

(chapter 5). In this discussion we will focus on the interactions of CLRs with

Schistosoma mansoni derived antigens.

Schistosomes appear to have evolved several strategies to down-regulate the host

immune response in order to promote their own survival. It is widely accepted that

schistosomes modulate the immune response during the chronic phase of infection

after the deposition of eggs, which is characterized by a TH2 response. Dendritic cells

are important key players in the immune response against schistosomes since they

are able to stimulate naïve T cells. In this thesis we show that DCs and especially

CLRs play an important role in the recognition of Schistosoma mansoni or its

secretion products. How this interaction relates to the induction of the schistosome

specific TH2 response remains to be elucidated.

TH1-TH2 response during Schistosoma mansoni infection

Schistosoma mansoni infection expresses both faces of the TH-balance. During the

first 3-5 weeks after infection the host is exposed to migrating immature parasites.

During this so-called acute schistosomiasis, the immune response is primarily TH1 in

nature. Although a lot of detailed understanding of this phase of the immune

response is missing, as the response is mainly directed against worm antigens (1;2).

After parasite maturation, sexual reproduction can occur and egg production is

initiated. The production of eggs results in inflammation of the liver and intestine as

the host responds to parasite eggs in these tissues. A marked TH2 response develops

against these novel egg antigens. During this chronic phase of infection, the egg stage

of the schistosome is responsible for inducing the TH2 response. By contrast the

worms themselves were shown to be poor inducers of a TH2 response (3).

The underlying mechanism by which egg production and egg secretion products

induce a TH2 response is not clear. A role for DCs has been suggested; since SEA

pulsed DCs are able to elicit a TH2 response (4). How DCs recognize SEA is unclear,

Chapter 8 _

180

nor has it been established whether DCs are able to initiate an egg-specific response

during infection.

Dendritic cells and schistosome infections

Parasites and their products are clearly able to activate DCs and this interaction is

believed to play a crucial role in initial T cell priming (5). The response of murine DCs

to Schistosoma mansoni provided surprising results. DCs that were exposed to SEA

failed to upregulate costimulatory molecules and MHC II. SEA-pulsed DCs did not

produce cytokines. We reported that human monocyte-derived DCs exposed to SEA

failed to respond in a conventional way (6; chapter 7 of this thesis), while others

indicate that these DCs display a level of phenotypic activation (7-9). Although these

DCs pulsed with SEA failed to mature, they are able to induce a TH2 response. These

findings suggest that besides DC activation other DC-linked mechanisms might play a

role in the initiation of a T cell response. Since DCs express a wide array of pattern

recognition receptors, which can interact with diverse pathogens or their products,

they are the potential candidates that may play a role in TH2 priming.

Is there a role for TLRs in the SEA-induced TH2 response?

Among the PRRs expressed on DCs are the Toll-like receptors. Recent reports

indicate that Schistosoma mansoni derived (glycan-) products interact with this

family of receptors. Living eggs of Schistosoma mansoni activate murine bone

marrow-derived DCs through TLR engagement. Living eggs selectively activate TLR2

and TLR3. Further investigation revealed that dsRNA structures that are present in

the egg are able to activate TLR3 (10). Lacto-N-fucopentaose III (LNFP III) contains

a Lewis x trisaccharide and can directly activate murine bone marrow derived-DCs

through a TLR4 dependent mechanism. These DCs are able to drive naïve T cells

towards a TH2 response (11). Also schistosome glycolipids are able to interact with

TLRs. The lyso-phosphatidyl-serine was shown to activate human monocyte-derived

DCs through TLR2, which results in the development of IL-10 producing regulatory T

cells and the induction of a TH2 response (9). Further investigation of the interactions

of Schistosoma mansoni and its products with TLRs is necessary.

The past years a lot of work has been done on TLR signaling. Intracellular signaling

from the distinct TLRs exhibit the common property of NF-κB activation, but their

General discussion

181

differential coupling to adaptor molecules, their differential activation of MAPKs and

modulation of their signals by other PAMP receptors contribute to the generation of

pathogen-specific dendritic cell maturation and pathogen-tailored immune responses

(12). The signaling pathways induced by the TLRs might influence the DC in its naïve

T cell polarizing capacities.

Initial studies established the importance of TLRs in inducing TH1 responses, since

TLR4 ligands induce the production of IL-12p70 and IFN-α and stimulate TH1

responses (13). However certain TLR ligands may also mediate a TH2 response. The

TLR4 ligand, LPS from E. coli induces a TH1 response, while LPS from P. gingivalis, a

TLR2 ligand, induces a TH2 response (14). Several studies suggest that TLR2

signaling results in TH2 or T regulatory responses. Comparison of the intracellular

signals from TLR2 and TLR4 has recently suggested that TLR agonists differentially

instruct DCs to initiate TH responses via modulation of intracellular signaling

pathways (7). TLR4 ligation favors pro-TH1 dendritic cell maturation through

p38MAPK-dependent synthesis of IL-12p70, whereas TLR2 ligands stimulate TH2

responses via preferential activation of ERK1/2 and c-fos resulting in increased IL-10

release and reduced IL-12p70 synthesis (15). Signaling through TLR3, 7 and 9

induces cross presentation and the expression of type 1 IFNs, generating cytotoxic T-

lymphocytes (CTLs). These studies show that T cell response can be influenced by

TLR signaling. Therefore interactions of Schistosoma mansoni eggs and SEA with

TLRs could play an important role in skewing the T cell response towards a TH2.

Is there a role for CLRs in the SEA-induced TH2 response?

Within the last few years several C-type lectins have been identified on both DCs and

macrophages. These CLRs recognize specific carbohydrate structures in a Ca2+-

dependent manner (16). The carbohydrate specificity of these C-type lectins have

been poorly characterized, but due to advances in microarray technology more tools

become available to characterize or identify, the carbohydrate specificity of these

receptors. The carbohydrate specificity of DC-SIGN and MGL has been described in

this thesis (17;18). Knowledge on the exact carbohydrate recognition is essential to

understand their importance in immune-related functions and to predict the

pathogens that they might recognize and interact with.

Chapter 8 _

182

CLRs are able to recognize incoming foreign antigens, which they can process and

present to naïve T cells. Due to the ability to activate naïve T cells, CLRs could play an

important role in T cell priming. It remains unclear whether all antigens that are

captured and internalized by DCs can be presented to T cells, or that there is a more

selective form of presentation in which CLRs determine which antigens are presented

and which are not. The carbohydrate recognition capacity of CLRs might play a key

role in this process.

Schistosoma mansoni derived glycans can be recognized by multiple CLRs. We have

shown that in the human body four CLRs are involved in the recognition of SEA (19),

and three of these CLRs are present on DCs. We have shown that LDN and LDNF

glycan moieties are recognized by MGL (17). DC-SIGN interacts with Lewis x and

LDNF glycans present in SEA (18;20;20). For the mannose receptor the specific

glycan ligands in SEA have not been characterized, but these might be mannose

containing glycan structures (21). The other CRL that interacts with SEA is the

human homologue of DC-SIGN, L-SIGN that is found on LSECs the APCs of the liver.

The exact ligands within SEA for L-SIGN have not been characterized yet, but Lewis x

can be excluded (19). Since eggs entrapped in the liver secrete SEA, L-SIGN is an

important candidate receptor to investigate schistosomiasis, especially granuloma

formation and T cell responses, in more detail. In chapter 7 we showed that there is

co-localization of SEA with MHC II suggesting that SEA might be presented on MHC

II. Furthermore we showed that CLRs on DCs are able to capture and internalize SEA

to the lysosomal, MHC II positive compartments. Here SEA might be processed and

loaded on to MHC II, which can present these antigens to T cells. We therefore

speculate that CLRs play an important role in generating a T cell response during

schistosomiasis. The CLRs and/or the antigens that are presented by MHC II, could

play a critical role in the SEA-specific TH2 response. Furthermore, Faveeuw et al.,

reported that SEA would be presented on CD1d, which is a molecule implicated in

glycolipid presentation (22). Ag presentation of parasitic glycoconjugates to CD1d-

restricted T cells may be important in the early events leading to the induction of TH2

responses and to egg- induced pathology during murine schistosomiasis. It would be

interesting to investigate whether the glycolipids of cercariae that are recognized by

DC-SIGN containing Lewis x and pseudo Lewis y, are presented by CD1 molecules.

General discussion

183

Since pseudo Lewis y is a glycolipid specific for cercariae it could play a role in the

induction of the early TH1 response.

Besides playing a role in the presentation of SEA antigens on MHC II to naïve T cells,

CLRs are also able to induce intracellular signaling pathways. CLRs contain signaling

motives in their cytoplasmic tail, which might be able to induce intracellular signaling

upon ligand recognition (16). The signal transduction pathways induced by each CLR

remain to be elucidated, but for some individual signaling motifs their function has

been identified. DC-SIGN, MGL and MR, all contain a tyrosine-based motif. It has

been reported that this motif is involved in rapid internalization from the cell surface.

Some tyrosine-based motifs can additionally mediate lysosomal targeting,

localization to specialized endosomal-lysosomal organelles such as antigen-

processing compartments (23). DC-SIGN, L-SIGN and MGL also have a di-leucine

motif in their cytoplasmic tail. This di-leucine motif is involved in targeting to the

lysosomal/endosomal compartment and can promote receptor-mediated endocytosis

(24). DC-SIGN and L-SIGN also contain a tri-acidic cluster in their cytoplasmic tail.

This cluster plays a role in recycling beyond early endosomes, through deeper MHC II

positive, late endosomes and lysosomes (25). The presence of these signaling motifs

in the cytoplasmic tail, could explain the targeting of SEA to MHC II positive,

lysosomal compartment. Taken together these findings indicate that SEA captured by

CLRs might be processed and presented on MHC II, leading to the induction of the

SEA specific TH2 response.

Signal transduction pathways induced by CLRs could also have other roles than

targeting to specific compartments within the cell. Upon ligand binding signaling

cascades can be induced like phosphorylation and activation of signaling molecules.

At present there is hardly any information on the induced signaling cascades by CLR-

ligand recognition. A recent report of Caparros and coworkers, revealed the first clues

on signaling transduction pathways upon DC-SIGN-ligation (26). They showed that

DC-SIGN induces the phosphorylation of ERK and Akt, without the concomitant

p38MAPK activation. DC-SIGN ligation also triggers the PLCγ phosphorylation and

calcium fluxes. The activation of ERK has been proposed to favor TH2 responses (15).

The ERK signaling events result in an increased IL-10 release and reduced IL-12p70

Chapter 8 _

184

synthesis. These cytokines could play a role in T cell polarization by functioning as

the so-called third signal.

Agrawal and colleagues (7), investigated the role of MAP kinase signaling pathways in

the TH2 response induction by SEA. They showed that SEA is a weak inducer of p38,

but results in an enhanced duration or magnitude of ERK1/2 phosphorylation, which

suppresses IL-12p70 production. Blocking ERK1/2 does not result in a consistent

increase in IL-12p70, suggesting that additional mechanism regulate the suppression

of IL-12p70 by SEA. Since SEA by itself does not result in the production of IL-12p70,

the suppression of IL-12p70 could play an important role in the generation of a TH2

response (7). The additional mechanism described by Agrawal and coworkers (7),

could be induced by signaling through DC-SIGN, as intracellular signaling reduces

IL-12p70 synthesis through ERK activation (26). However this hypothesis needs to be

further investigated.

The findings described above, are in agreement with the observation, that most DC-

SIGN interacting microbes elicit TH2 –type responses which result in impaired

pathogen clearance and the establishment of chronic infections. This has led to the

proposal that pathogens subvert DC-SIGN function as a mean to avoid immuno-

surveillance and the generation of effective immune responses (27). Besides

Schistosoma mansoni also other pathogens express Lewis x like Helicobacter pylori.

Signaling through DC-SIGN by Lewis antigen expressing Helicobacter pylori results

in immune regulation, but is not accompanied by inhibition of DC maturation or the

induction of regulatory T cells. Lewis negative Helicobacter pylori do not bind DC-

SIGN and trigger TH1 responses, whereas the Lewis positive Helicobacter pylori

induce a shift in the TH1/TH2 balance towards TH2 (28). Lactobacillus species L.

reuteri and L. casei instruct DCs to induce IL-10 producing regulatory T cells that

suppress T cell responses through engagement of DC-SIGN (29). Mycobacterium

tuberculosis interacts with DCs through its cell wall component ManLAM with DC-

SIGN. ManLAM inhibits the TLR-induced maturation and induces the

immunosuppressive cytokine IL-10 (30). Taken together these data indicate that the

interaction of different pathogens with DC-SIGN influences the fate of naïve T cells,

which might be a more common mechanism among CLRs.

General discussion

185

Model of DCs interacting with Schistosoma mansoni SEA

SEA are captured and internalized by APCs. On dendritic cells DC-SIGN, MGL and

MR interact with SEA and in the liver on LSECs L-SIGN is able to interact with SEA.

The SEA is internalized towards the MHC II positive, lysosomal compartments. Here

the SEA are processed and loaded onto MHC II and subsequently presented to naïve

T cells (signal 1). In combination with the co-stimulatory signal and the polarizing

signal a T cell response is elicited (Figure 1a). When stimulated simultaneously with

SEA and TLR-ligands LPS or poly I:C, DC maturation and cytokine production are

suppressed (Figure 1b). The exact signaling pathway resulting in this inhibition needs

to be further analyzed in more detail.

Figure 1 Models of DC interactions with SEA. A) SEA is captured and internalized by three C-type lectin receptors on iDCs; DC-SIGN, MGL and MR respectively. SEA is internalized to the MHC II positive lysosomal compartments. After processing the antigen can be loaded on MHC II and be presented to naïve T cells. B) Toll like receptor - ligand interactions result in the up regulation of both maturation markers and cytokine production. When a DC simultaneously encounters SEA and a TLR-ligand (LPS or poly I:C), SEA inhibits the maturation and cytokine production induced by the TLR-ligand. The T cell response is skewed towards a TH2 response.

Concluding remarks

The T cell polarizing capacities of DCs during schistosomiasis has been focusing on

the interactions of the T cell receptor with MHC II associated peptides and on the co-

stimulatory signal. The possible role of TLRs and CLRs has not been taken into

account in these studies. TLRs and CLRs are both pattern recognition receptors that

are able to elicit a proper immune response against the pathogenic parasitic intruder.

Reports on the signaling of CLRs and mainly TLRs, make it plausible to ascribe a role

for CLRs and TLRs in determining the outcome of the immune response balance,

Chapter 8 _

186

suggesting that signaling via distinct PRRs triggers qualitatively different responses

from the innate immune system. Modulating TLR or CLR signaling, could lead to a

better understanding in TH1/TH2 balance in general and could result in novel

therapeutic opportunities to manipulate adaptive immunity in the immune therapy of

allergy, chronic infections, autoimmunity, transplantation and cancer.

References

1 Pearce, E. J., Caspar, P., Grzych, J. M., Lewis, F. A., and Sher, A. 1991. Downregulation of Th1

cytokine production accompanies induction of Th2 responses by a parasitic helminth, Schistosoma mansoni. J.Exp.Med. 173:159-166.

2 Wilson, R. A. and Coulson, P. S. 1999. Strategies for a schistosome vaccine: can we manipulate the immune response effectively? Microbes.Infect. 1:535-543.

3 Pearce, E. J., Kane, M., Sun, J., Taylor, J., McKee, A. S., and Cervi, L. 2004. Th2 response polarization during infection with the helminth parasite Schistosoma mansoni. Immunol.Rev. 201:117-126.

4 MacDonald, A. S., Straw, A. D., Bauman, B., and Pearce, E. J. 2001. CD8- dendritic cell activation status plays an integral role in influencing Th2 response development. J.Immunol. 167:1982-1988.

5 Maizels, R. M., Balic, A., Gomez-Escobar, N., Nair, M., Taylor, M. D., and Allen, J. E. 2004. Helminth parasites--masters of regulation. Immunol.Rev. 201:89-116.

6 van Liempt, E., van Vliet, S. J., Engering, A., Garcia Vallejo, J. J., Bank, C. M., Sanchez-Hernandez, M., Van Kooyk, Y., and van Die, I. 2006. Schistosoma mansoni soluble egg antigens are internalized by human dendritic cells through multiple C-type lectins and suppress TLR-induced dendritic cell activation . submitted 1.

7 Agrawal, S., Agrawal, A., Doughty, B., Gerwitz, A., Blenis, J., Van Dyke, T., and Pulendran, B. 2003. Cutting edge: different Toll-like receptor agonists instruct dendritic cells to induce distinct Th responses via differential modulation of extracellular signal-regulated kinase-mitogen-activated protein kinase and c-Fos. J.Immunol. 171:4984-4989.

8 de Jong, E. C., Vieira, P. L., Kalinski, P., Schuitemaker, J. H., Tanaka, Y., Wierenga, E. A., Yazdanbakhsh, M., and Kapsenberg, M. L. 2002. Microbial compounds selectively induce Th1 cell-promoting or Th2 cell-promoting dendritic cells in vitro with diverse th cell-polarizing signals. J Immunol 168:1704-1709.

9 van der, K. D., Latz, E., Brouwers, J. F., Kruize, Y. C., Schmitz, M., Kurt-Jones, E. A., Espevik, T., de Jong, E. C., Kapsenberg, M. L., Golenbock, D. T., Tielens, A. G., and Yazdanbakhsh, M. 2002. A novel host-parasite lipid cross-talk. Schistosomal lyso-phosphatidylserine activates toll-like receptor 2 and affects immune polarization. J Biol.Chem. 277:48122-48129.



12 Pulendran, B. 2004. Modulating vaccine responses with dendritic cells and Toll-like receptors. Immunol.Rev. 199:227-250.

13 Poltorak, A., He, X., Smirnova, I., Liu, M. Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085-2088.

14 Pulendran, B., Kumar, P., Cutler, C. W., Mohamadzadeh, M., Van Dyke, T., and Banchereau, J. 2001. Lipopolysaccharides from distinct pathogens induce different classes of immune responses in vivo. J.Immunol. 167:5067-5076.

General discussion

187

15 Dillon, S., Agrawal, A., Van Dyke, T., Landreth, G., McCauley, L., Koh, A., Maliszewski, C., Akira, S., and Pulendran, B. 2004. A Toll-like receptor 2 ligand stimulates Th2 responses in vivo, via induction of extracellular signal-regulated kinase mitogen-activated protein kinase and c-Fos in dendritic cells. J.Immunol. 172:4733-4743.

16 Figdor, C. G., Van Kooyk, Y., and Adema, G. J. 2002. C-type lectin receptors on dendritic cells and Langerhans cells. Nat.Rev.Immunol. 2:77-84.


18 van Liempt, E., Bank, C. M., Metha P, Garcia Vallejo, J. J., Kawar ZS, Geyer, R., Alvarez, R., Cummings, R. D., Van Kooyk, Y., and van Die, I. 2006. Specificity of DC-SIGN for mannose- and fucose-containing glycans. submitted 2.

19 van Liempt, E., Imberty, A., Bank, C. M., van Vliet, S. J., Van Kooyk, Y., Geijtenbeek, T. B., and van, D., I 2004. Molecular basis of the differences in binding properties of the highly related C-type lectins DC-SIGN and L-SIGN to Lewis X trisaccharide and Schistosoma mansoni egg antigens. J.Biol.Chem. 279:33161-33167.

20 van Die, I., van Vliet, S. J., Nyame, A. K., Cummings, R. D., Bank, C. M., Appelmelk, B., Geijtenbeek, T. B., and Van Kooyk, Y. 2003. The dendritic cell-specific C-type lectin DC-SIGN is a receptor for Schistosoma mansoni egg antigens and recognizes the glycan antigen Lewis x. Glycobiology 13:471-478.

21 Linehan, S. A., Coulson, P. S., Wilson, R. A., Mountford, A. P., Brombacher, F., Martinez-Pomares, L., and Gordon, S. 2003. IL-4 receptor signaling is required for mannose receptor expression by macrophages recruited to granulomata but not resident cells in mice infected with Schistosoma mansoni. Lab Invest 83:1223-1231.

22 Faveeuw, C., Angeli, V., Fontaine, J., Maliszewski, C., Capron, A., Van Kaer, L., Moser, M., Capron, M., and Trottein, F. 2002. Antigen presentation by CD1d contributes to the amplification of Th2 responses to Schistosoma mansoni glycoconjugates in mice. J.Immunol. 169:906-912.

23 Bonifacino, J. S. and Dell'Angelica, E. C. 1999. Molecular bases for the recognition of tyrosine-based sorting signals. J.Cell Biol. 145:923-926.

24 Marks, M. S., Woodruff, L., Ohno, H., and Bonifacino, J. S. 1996. Protein targeting by tyrosine- and di-leucine-based signals: evidence for distinct saturable components. J.Cell Biol. 135:341-354.

25 Bonifacino, J. S. and Traub, L. M. 2003. Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu.Rev.Biochem. 72:395-447.


27 Van Kooyk, Y., Engering, A., Lekkerkerker, A. N., Ludwig, I. S., and Geijtenbeek, T. B. 2004. Pathogens use carbohydrates to escape immunity induced by dendritic cells. Curr.Opin.Immunol. 16:488-493.


29 Smits, H. H., Engering, A., van der, K. D., de Jong, E. C., Schipper, K., van Capel, T. M., Zaat, B. A., Yazdanbakhsh, M., Wierenga, E. A., Van Kooyk, Y., and Kapsenberg, M. L. 2005. Selective probiotic bacteria induce IL-10-producing regulatory T cells in vitro by modulating dendritic cell function through dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin. J.Allergy Clin.Immunol. 115:1260-1267.


Summary

189

Summary Schistosomiasis is the major parasitic worm infection in the world. Schistosomes have a complex life-cycle, in which every stage interacts with the host either directly or indirectly through the secretion of highly glycosylated proteins and lipids. Increasing evidence indicates that glycoconjugates play an important role in the manipulation of the immune system for the parasites benefit and to escape the immune response of the host. The first cells to come in contact with invading pathogens are dendritic cells (DCs). DCs recognize pathogens and through cell-cell interactions with T cells, an immune response is elicited. DCs express receptors that recognize glycans expressed by pathogens, these receptors are called C-type lectin receptors. Schistosomiasis is characterized by a strong TH2 response, induced by soluble egg antigens (SEA) secreted by eggs of the parasite. The mechanism of how SEA induces a TH2 response is unknown. To be able to understand the induction of this TH2 response, it is important to investigate which receptors on DCs are able to interact with SEA. To gain more insight in the recognition of Schistosoma mansoni glycans by C-type lectins and the consequences for dendritic cell mediated immune responses, the studies described in this thesis were performed. As a first approach to understand the molecular interactions of schistosome glycans and dendritic cells that lead to TH2 cell polarization, the recognition of schistosome glycan antigens by DCs were investigated. In the general introduction (Chapter 1) the parasite Schistosoma mansoni is introduced. A general overview of glycoconjugates, their biosynthesis and examples in Schistosoma mansoni are discussed. The immune system with a focus on dendritic cells and the pattern recognition receptors they express, proceed the immune response to Schistosoma mansoni. The parasite Schistosoma mansoni is the major parasitic worm infection in the world. The larvae of the parasite live in fresh water and when humans come in contact with this water they become infected with Schistosoma mansoni. During infection the host is sequentially exposed to different sets of specific antigens present on different life-cylce stages and in secreted/excreted products. Increasing evidence indicates that the highly glycosylated antigens play an important role in the immunobiology of schistosomiasis. The parasite can survive many years in the hostile environment of the host. Thus, the parasite must have evolved mechanisms to escape the immune response of the host. The first immune cells that come in contact with invading pathogens are dendritic cells, the sentinels of the immune system. Dendritic cells express receptors which are able to recognize glycoconjugates through their carbohydrate recognition domain. These receptors are the C-type lectin family receptors. These receptors are able to capture and present antigens to T cells and an immune response is elicited. In this thesis we made a first approach to investigate how the molecular interactions of schistosome glycans and dendritic cells, lead to TH2 cell polarization, characteristic for Schistosoma mansoni infections. In chapter 2 we started to investigate the carbohydrate specificity of DC-SIGN to be able to predict which carbohydrates of Schistosoma mansoni could be recognized by DC-SIGN. We found that DC-SIGN recognizes at least two classes of glycans, mannose rich and fucosylated glycans. DC-SIGN binds to N-linked oligomannose with the highest apparent affinity for the structure Man9GlcNAc2, and decreasing binding affinity as the number of mannoses decreases. DC-SIGN binds Lewisx and LDNF, however diantennary N-glycans containing these epitopes show a 4-fold

Summary _

190

increase in binding of DC-SIGN-Fc over the terminal trisaccharides alone. Multivalenly expressed Lewisx show an even more increased binding of DC-SIGN-Fc, indicating that DC-SIGN prefers multivalently expressed glycans, which is in agreement with the capacity of DC-SIGN to bind many pathogens through there multivalently expressed glycans. Another C-type lectin expressed on dendritic cells is Macrophage galactose-type lectin, MGL. In chapter 3 we used carbohydrate profiling to gain more insight in the function and carbohydrate specificity of MGL. We identified oligosaccharides containing terminal α- and β-linked GalNAc residues as high affinity ligands for MGL. Identification of the carbohydrate specificity of MGL, led to discovery that MGL is able to bind to glycan antigens within egg glycoproteins of the pathogenic helminth Schistosoma mansoni. In addition MGL strongly interacted with tumor cells in a GalNAc specific manner. These data strongly implicate a role for MGL in recognition of self-gangliosides, tumor antigens and pathogenic helminthes by DCs. In chapter 4 we investigated whether L-SIGN, a human homologue of DC-SIGN, like DC-SIGN is able to bind fucosylated oligosaccharides, since increasing evidence indicates that the major ligands for DC-SIGN are α3/α4 fucosylated glycans. Here we demonstrate that like DC-SIGN, L-SIGN is able to bind to Lewis a, Lewis b and Lewis y. In contrast to DC-SIGN, L-SIGN does not bind Lewis x containing oligosaccharides. L-SIGN is able to bind SEA of the parasite Schistosoma mansoni, however this binding is not through the Lewis x epitope. A specific mutation in the carbohydrate recognition domain of DC-SIGN (V351G) abrogates binding to all Lewis antigens. In L-SIGN Ser363 is present at the corresponding position of Val351 in DC-SIGN. Replacement of this Serine into valine resulted in a “gain of function” L-SIGN mutant that binds Lewis x and shows increased binding to other Lewis antigens. Molecular docking and modeling demonstrates that the valine amino acid in DC-SIGN creates a hydrophobic pocket that strongly interacts with the Fucα1,3/4-GlcNAc moiety of the Lewis antigens. The Serine in L-SIGN creates a hydrophilic pocket, which prevents interaction with the Fucα1,3-GlcNAc of Lewis x. These data demonstrate for the first time that DC-SIGN and L-SIGN differ in their carbohydrate binding profiles, and will contribute to our understanding of the functional roles of these C-type lectins, both in recognition of pathogen and self-glycan antigens. One of the first roles described for DC-SIGN, is that DC-SIGN is able to mediate rolling and adhesion of precursor DCs over the endothelium, which suggested to be mediated through interactions with ICAM-2. In chapter 5, we investigated the DC-SIGN ligands present on endothelial cells that are crucial for the adhesion and rolling of DCs. In this study we showed that ICAM-2 expressed on endothelial cells constitutes the major scaffold protein ligand for DC-SIGN. We identified Lewis y as the major carbohydrate ligand for DC-SIGN on endothelial cell-expressed ICAM-2. Furthermore we demonstrate that fucosylation is essential for the rolling and adhesion of monocyte-derived DCs. Silencing of Fucosyltransferase 1 (FUT-1), resulted in a reduction of rolling and adhesion. The discovery of FUT-1 as a key enzyme in the synthesis of the endothelial DC-SIGN-ligands opens new possibilities in the manipulation of DC migration. During the human parasitic disease schistosomiasis, the immune system is continuously challenged with an array of molecules associated with parasite metabolism and reproduction. These glycoconjugates, consisting of both

Summary

191

glycoproteins and glycolipids are shown to play important roles in host-parasite interactions. In chapter 6 we investigated whether DC-SIGN recognizes glycolipids of the parasite Schistosoma mansoni. DC-SIGN is able to bind to cercarial glycolipids, but not egg glycolipids. Structural characterization of the glycan moieties of the glycosphingolipid species revealed that a pentasaccharide containing Lewis x is one of the main ligands recognized by DC-SIGN. Furthermore we found that DC-SIGN binds to pseudo-Lewis y, a hexasaccharide found so far only on glycolipids of cercaraie of schistosomes. Pseudo Lewis y is the first parasite specific ligand identified for DC-SIGN. Molecular modeling showed that binding of pseudo-Lewis y could fit in the model, if the orientation of the side chain of Phe313 in the secondary binding site of DC-SIGN was slightly changed. This flexibility in the secondary binding site of DC-SIGN might be used by pathogens to target DCs, which may contribute to immune escape. To understand the mechanism of how SEA induces a TH2 response, it is important to investigate which receptors on DCs are able to recognize SEA. As SEA is highly glycosylated, we focused in chapter 7 on the interaction of SEA with DC-expressed C-type lectins (CLRs). We showed that DC-SIGN, MGL as well as the mannose receptor play a role in binding and subsequent internalization of SEA. Co-localization of SEA with MHC II in the lysosomal compartments suggests that Ag processing and presentation can occur. Although SEA by itself did not induce DC activation, addition of SEA suppressed the TLR-induced activation and cytokine production of DCs. Moreover, SEA induced a down modulation of TH1 responses and even skewing towards TH2 responses induced by poly I:C and LPS respectively. These data show that multiple C-type lectin receptors on DCs can capture and internalize the complex mixture of antigens secreted by Schistosoma mansoni eggs, and subsequently regulates the ability of iDCs to respond to TLR ligands. In this thesis we showed that C-type lectins on DCs play an important role in the recognition of Schistosoma mansoni and its secretion products. How these interactions relate to the induction of the schistosome specific TH2 response remains to be elucidated. In chapter 8, we discuss the role of DCs in the schistosome specific TH2 response and which DC-expressed receptors could play an important role in this immune response. Moreover, cross talk between receptors and signal transduction pathways make things even more complicated. Modulating TLR and CLR signaling, could lead to a better understanding of the TH1/TH2 balance in general and could result in novel therapeutic opportunities to manipulate adaptive immunity in the immune therapy of allergy, chronic infections, autoimmunity, transplantation and cancer.

Nederlandse samenvatting _

193

Nederlandse samenvatting voor niet (glyco)immunologen Schistosoma mansoni is een parasiet die mensen infecteert met name in de derde wereld landen. Mensen kunnen de infectie oplopen als ze in aanraking komen met zoetwater waarin de larven van de Schistosome-parasiet leven. Schistosome-parasieten zijn zuigwormen en hebben een ingewikkelde levenscyclus. Ze gebruiken bepaalde zoetwaterslakken als tussengastheer. Uit deze slakken komen grote aantallen minuscule larven vrij, die vervolgens in het water rondzwemmen en binnen een paar seconden de huid van mensen kunnen binnen dringen. Een kortstondige aanraking met besmet water is dus al voldoende om de infectie op te lopen. In de aderen ontwikkelen de larven zich binnen vijf weken tot volwassen wormen. De vrouwtjes leggen gemiddeld vijf jaar lang 200 –2000 eitjes per dag. Het zijn de eitjes en niet de volwassen wormen die de organen zoals de lever, darmen en blaas aantasten. Strandwachters staan voortdurend op de uitkijk om strandgasten te beschermen tegen de gevaren van de zee en de gevaren veroorzaakt door mensen zelf. Wanneer er zich op het strand een gevaarlijke situatie voordoet, verzamelen de strandwachters zich om tot een gezamenlijke reddingsactie over te gaan. De strandwachters van ons lichaam zijn gespecialiseerde cellen, die vanwege hun uitlopers dendritische cellen worden genoemd. Deze dendritische cellen beschermen ons lichaam tegen indringers als bacteriën, virussen en parasieten. De dendritische cellen bevinden zich in onrijpe vorm in alle weefsels, waar zij op de uitkijk staan voor indringers. Wanneer er gevaar, bijvoorbeeld in de vorm van een infectie in het menselijk lichaam optreedt, verzamelen de dendritische cellen informatie in de vorm van kleine eiwitdeeltjes die uniek zijn voor de bacterie, virus of parasiet, om uiteindelijk een reactie van je afweersysteem (immuun systeem) opgang te brengen. De kleine eiwitdeeltjes, ook wel antigenen genoemd kunnen door de dendritische cellen worden opgenomen, waarna de dendritische cel met deze informatie van de infectieplaats via de lymfevaten naar de lymfeklieren gaat. Hier worden de antigenen gepresenteerd aan T cellen, die een rol spelen bij de vernietiging van de indringers. De T cellen die het antigeen herkennen vermenigvuldigen zich en gaan naar de infectieplaats om de geïnfecteerde cellen te doden. Dendritische cellen hebben eiwitten (receptoren) op hun oppervlak, die specifieke eiwitten van indringers herkennen. Tot deze receptoren behoren de zogenaamde C-type lectins, die een speciaal domein hebben waarmee ze specifieke suikers kunnen herkennen. Eén van deze receptoren is DC-SIGN, die alleen op DCs voorkomt. DC-SIGN herkent bacteriën, virussen, parasieten en hun uitscheidingsproducten aan de aanwezige suikerketens. Daarnaast kan DC-SIGN interacties aangaan met andere moleculen op endotheel cellen of T cellen. Het doel van dit proefschrift is de suikerherkenning van DC-SIGN meer gedetailleerd te bestuderen, om vervolgens de interactie met Schistosoma mansoni met DC-SIGN op dendritische cellen beter te kunnen bestuderen. Daarnaast werd ook de herkenning van Schistosoma mansoni door andere C-type lectins onderzocht. Tenslotte werd de rol van DCs (en C-type lectins) in de aanzet van een immune reactie tegen Schistosoma mansoni onderzocht. Om in staat te zijn te voorspellen welke suikers van Schistosoma mansoni herkend kunnen worden door DC-SIGN, werd de suikerspecificiteit van DC-SIGN nauwkeurig onderzocht (hoofdstuk 2). We hebben gevonden dat DC-SIGN twee klassen suikers herkend, namelijk hoog-mannose suikers en bepaalde fucose-houdende suikers.

Nederlandse samenvatting

194

Zowel DC-SIGN in oplossing als DC-SIGN op het oppervlak van cellen, kunnen beide klassen van suikers binden. De mate van binding neemt toe met het aantal beschikbare suikers. Een ander C-type lectine is MGL. MGL komt voor op dendritische cellen en macrofagen. In hoofdstuk 3 is de suikerspecificiteit van MGL bepaald door de binding aan diverse suikerstructuren te testen. MGL herkent andere suikers dan DC-SIGN, namelijk de galactosebevattende suikers. Deze suikers komen voor op onder andere stadia van de parasiet Schistosoma mansoni en zijn uitscheidingsproducten, maar ook op tumoren. Deze bevinden geven aan dat MGL een functie kan spelen in de herkenning van pathogenen en de interactie met tumoren. In het menselijk lichaam komt een op DC-SIGN gelijkende receptor voor namelijk L-SIGN. L-SIGN komt voor op bepaalde cellen van de lever en de lymfeklier. DC-SIGN en L-SIGN delen bepaalde eigenschappen zoals de interactie met endotheel cellen en T cellen. L-SIGN herkent ook hoog mannose suikers, maar het is echter niet bekend of L-SIGN ook fucose-houdende suikers herkend, dit is onderzocht in hoofdstuk 4. L-SIGN kan net als DC-SIGN bepaalde fucose houdende suikers binden, die behoren tot de Lewis-familie. L-SIGN verschilt echter van DC-SIGN omdat L-SIGN geen Lewis x herkent, terwijl DC-SIGN dat wel doet. De moleculaire achtergrond van dit verschil werd onderzocht door veranderingen in L-SIGN of DC-SIGN aan te brengen en met behulp van de analyse van de binding met de computer. DC-SIGN op dendritische cellen kan een interactie aangaan met ICAM-2 op endotheel cellen. Echter hoe deze interactie tot stand komt is niet bekend. In hoofdstuk 5 wordt deze interactie nader bestudeerd. We laten zien dat deze interacties afhankelijk zijn van de aanwezigheid van de suikerstructuur Lewis y op ICAM-2. De verschillende levensstadia van de parasiet Schistosoma mansoni hebben diverse suikers op hun oppervlak of uitscheidingsproducten. Een deel van deze suikers zit op vetten (lipiden). In hoofdstuk 6 is onderzocht of DC-SIGN suikers op de lipiden van Schistosoma mansoni kan herkennen. We hebben aangetoond dat DC-SIGN wel suiker-lipiden van cercariae herkent, maar niet de suiker-lipiden van de eieren. Nadere analyse van deze suiker-lipiden laat zien, dat Lewis x en pseudo-Lewis y de suikerstructuren zijn op suiker-lipiden van cercariae die door DC-SIGN herkent worden. Dendritische cellen staan continue op de uitkijk naar indringers. De parasiet Schistosoma mansoni is zo’n indringer. De eieren van Schistosoma mansoni scheiden een sterk besuikerd product uit, dat SEA wordt genoemd. Hoewel er een afweer reactie tot stand komt die specifiek is voor SEA, is de rol die dendritische cellen daarin spelen nog niet duidelijk. In hoofdstuk 7 wordt beschreven dat drie C-type lectins, DC-SIGN, MGL en de mannose receptor, SEA kunnen binden en betrokken zijn bij de opname ervan. Daarnaast heeft SEA een onderdrukkend effect op de maturatie en cytokine productie van dendritische cellen. Hier laten we zien dat dendritische cellen een rol spelen bij het opstarten van een reactie van het immuun systeem op Schistosoma mansoni infecties. De bevindingen in dit hoofdstuk geven bovendien aanwijzingen voor de antigeen presentatie van SEA door DCs, wat een rol speelt in de T cel gereguleerde afweerreactie.

Nederlandse samenvatting _

195

Tenslotte wordt er in hoofdstuk 8 beschreven wat de resultaten betekenen voor de inzichten van de immuun reactie tegen SEA van de parasiet Schistosoma mansoni. De SEA specifieke reactie kan mogelijk door meerdere factoren beïnvloed worden dan tot nu toe werd gedacht.

Dankwoord _

197

Dankwoord

Nu het boekje af is, is het moment gekomen om iedereen te bedanken die op enige wijze heeft bijgedragen aan het tot stand komen van dit proefschrift. Zonder de hulp van velen was het me nooit gelukt om mijn promotieonderzoek tot een goed eind te brengen. Ik wil iedereen die een bijdrage heeft geleverd hartelijk bedanken, en een aantal mensen met name noemen. Yvette, ik wil je bedanken voor je vertrouwen, optimisme en goede suggesties met betrekking tot mijn onderzoek. Bedankt voor alle steun en wijze raad die ik de afgelopen jaren van je gekregen heb. Ik heb heel veel van je geleerd zowel op wetenschappelijk als persoonlijk niveau! Irma, bedankt voor de financiële ondersteuning van mijn project.

Anneke, door jou ben ik enthousiast geworden voor het immunologisch onderzoek. Tijdens mijn promotie kon ik altijd bij je aankloppen voor advies. Zelfs vanuit Thailand nam je de tijd en moeite om mijn emails te beantwoorden en mijn papers te lezen. Ik heb grote bewondering voor je! Sandra, als mede AIO begreep je maar al te goed wat “AIO-zijn” allemaal met zich meebracht. Ik vond het dan ook erg leuk om met je samen te werken en jouw onuitputtelijke kennis, adviezen en peptalks zijn onmisbaar geweest voor dit proefschrift, ik vind het dan ook erg fijn dat je ook de laatste stap van mijn promotie naast me wil staan. Sandra bedankt voor alles en veel succes met de laatste loodjes van jouw promotie onderzoek!!! Christine, samen hebben we dik en dun gedeeld op het lab. Jij was echt mijn lab-maatje met veel gevoel voor humor, zelfs in minder rozige tijden. Ik ben dan ook erg blij dat je mijn paranimf wil zijn! Bedankt voor alles!! Wietske, het “suikervrouwtje” zoals Christine en ik jou wel eens plagend noemde. Je bent een fijne collega! Bedankt voor al je adviezen met betrekking tot het suikerwerk, je bent groots!! Juan, thanks for all your advice, help and friendship. Thanks for teaching me how to do Real-Time experiments, they were of great help for my research, muchas gracias! Sonja, bedankt voor je luisterend oor en adviezen, omtrent de soms ‘wilde’ ideeën die ik had voor experimenten met TLRs, CLRs en SEA. Helaas had ik te weinig tijd om een en ander goed tot uitvoering te kunnen brengen. Venice, jij werd opgescheept met mijn yeast-two-hybrid constructen. Samen zijn we er uiteindelijk toch in geslaagd om blauwe kolonies te verkrijgen. Op jouw schouders rust nu de taak om het DNA te isoleren en te sequencen. Ik heb erg fijn met je samengewerkt, bedankt voor alles! Berrrrt, jij zorgde altijd voor de vrolijke noot op het lab, bedankt voor de gezelligheid! Satwinder, allebei zijn we student van Anneke geweest en dat schepte een band. Al snel bleek dat we het bijzonder goed met elkaar konden vinden. Veel succes met de rest van je promotie onderzoek! Manja en Marta bedankt voor het doen van de tijdrovende TH1/TH2 experimenten! Manja, jouw komst op de BC vleugel herinnerde me aan mijn eigen enthousiasme voor onderzoek. Je bent een fijne collega! Corlien, jouw realistische kijk op onderzoek en wat daarbij komt kijken, heeft me doen realiseren waarvoor ik het allemaal doe. Bedankt voor alles! Hakan, helaas is het met de kolom zuiveringen van SEA nooit iets geworden en toen het er wel veelbelovend uit zag, ging de kolom stuk. Eén ding is zeker het heeft niet aan jouw inzet gelegen! Serge, bedankt voor je hulp met de CLSM, het heeft uiteindelijk de mooie plaatjes opgeleverd die ik voor ogen had. Sonia, thanks for providing the final pictures for the SEA-DC paper. I really enjoyed our talks. Good luck with your research project! Corlien, Juan, Sandra en Sonja, ik wil jullie bedanken voor het lezen van de manuscripten en het delen van jullie ideeën, mede dankzij jullie is het een mooi boekje geworden. Ook de leden van de promotie commissie wil ik bedanken voor het kritisch doorlezen van mijn proefschrift.

_ Dankwoord

198

Ik wil iedereen van de afdeling Moleculaire Celbiologie en Immunologie bedanken. In het bijzonder de rode groep, bedankt voor alle gezelligheid, de etentjes en adviezen. Daarnaast wil ik de miepen van de miepenkamer bedanken; Ellen, Jeroen, Pia, Lisa, Nicolette en Trieneke, bedankt voor alle gezelligheid, het thee-leuten, snoepjes en onze etentjes. Kristel, jij bent iemand op wie ik al sinds de Havo kan rekenen. Ik wil je bedanken voor alle steun, vertrouwen en vriendschap. Jij bent een echte vriendin!!! Henk, tijdens de biologie lessen op het Rodenborch college wist u mijn interesse voor de biologie verder aan te wakkeren. Dit heeft zich ontaard in een passie voor wetenschap en het doel om daar iets aan bij te dragen. U heeft uiteindelijk meer voor me betekend, dan u zich waarschijnlijk ooit zal realiseren. Mijn dank is groot!!! Beste brigade vrienden (Gouda, Texel en Rosmalen), bedankt voor de broodnodige afleiding in het zwembad en op het strand. Ondanks dat de meeste van jullie er geen chocola van konden maken, bleef jullie interesse in mijn promotie onderzoek oprecht. Ook wil ik de wintertour-gangers bedanken voor de altijd weer gezellige en ontspannende weekjes wintersport. Daarnaast wil ik de dames van “Cantara” bedanken voor de vrolijke noot op vrijdagavond. Aline, Delphine en Arianne, wij als “die-hards” van het bestuur, hebben erg veel lol gehad samen. Onze ‘vergaderingen’ in onze stamkroeg waren altijd erg gezellig. En dan mijn familie….. Ik wil iedereen bedanken voor het getoonde interesse de afgelopen jaren. Ons Pap en ons Mam, wil ik hierbij in het bijzonder bedanken. Jullie hebben mij de kans gegeven om me te ontwikkelen en te studeren. Daarnaast kan ik altijd rekenen op jullie onvoorwaardelijke steun, liefde en vertrouwen. Ik heb veel bewondering en waardering voor jullie! Lieve Arianne, mijn grote zus en dito voorbeeld. Ik bof dat je naast mijn zus ook mijn beste vriendin bent. Ik wil je bedanken voor al je hulp, adviezen, emails, SMS-jes en kaartjes die ik van je gekregen heb, zelfs toen jij wel wat anders aan je hoofd had! Ik heb nu weer wat meer tijd om leuke dingen te gaan ondernemen, dus binnenkort gaan we weer eens ouderwets gezellig op pad! Bas en Lodi, Jochem, bedankt voor de gezelligheid en afleiding in Rosmalen. Mijn Oma’s; Oma van Liempt, dat ik naar de juiste Oma vernoemd ben, is voor iedereen ondertussen wel duidelijk. Helaas ligt Gouda niet naast de deur en is ‘ons zondagmiddag thee uurtje’ daardoor minder frequent dan voorheen. Graag wil ik van de gelegenheid gebruik maken om u te bedanken voor alle gezelligheid en bemoedigende telefoontjes, ze kwamen altijd op het juiste moment! Oma Hanegraaf, ik heb veel bewondering voor u! Ondanks dat u vond dat het allemaal veel te geleerd was wat ik deed, bleef u vol belangstelling vragen hoe het ging met mijn promotie onderzoek. Lieve Oma’s, heel erg bedankt, ik hou van jullie! Beste Janny en Leen, ouders van Mark, ik weet niet waar ik moet beginnen om jullie te bedanken. Jullie zijn staan altijd voor ons klaar. Bedankt voor alles!! Lieve Mark, mijn promotie onderzoek is niet echt gemakkelijk geweest. Maar iedere keer weer kon ik op je rekenen en stond je voor me klaar. Dankzij jouw steun en liefde kan ik nu een dankwoord voor ons proefschrift schrijven. Zonder jou was dit echt nooit gelukt!! Samen kunnen we echt alles aan! DKOJVH!!

Ellis

Curriculum Vitae _

Curriculum Vitae Petronella Adriana Gerarda van Liempt, roepnaam Ellis, werd op 2 april 1977 geboren te ’s-Hertogenbosch. In 1989 begon zij op het Rodenborch college te Rosmalen, waar achtereenvolgens de volgende diploma’s behaald werden; Mavo (1993), Havo (1995) en Atheneum (1997). In 1997 werd tevens het staatsexamen Scheikunde behaald. In datzelfde jaar begon zij met haar studie biologie, medische richting, aan de Katholieke Universiteit van Nijmegen. Tijdens haar studie liep zij een onderzoeksstage op de afdeling Celbiologie bij Prof.dr. E.J.J. van Zoelen en Drs. C. Stortelers, waar zij onderzoek deed naar de vereisten van EGF-achtige groeifactoren om met hoge affiniteit aan erbB2/ErbB3 receptoren te binden die een belangrijke rol spelen in borstkanker. Daarna, deed zij een onderzoeksstage bij Dr. A. Engering, Dr. Y. van Kooyk en Prof.dr. C. Figdor op de afdeling Tumorimmunologie van het Universitair medisch centrum St. Radboud te Nijmegen, waar de internalisatie van DC-SIGN en L-SIGN na ligand binding bestudeerd werd. Haar derde stage vond plaats in het GenZentrum, verbonden aan de Ludwig-Maximilians-Universität te München, in het laboratorium van Prof.dr. W. Kolanus. Tijdens deze stage werd de yeast-two-hybrid techniek opgezet voor de cytoplasmatische staart van DC-SIGN en L-SIGN. Na het behalen van het doctoraaldiploma eind 2002, begon zij als AIO op de afdeling Moleculaire Celbiologie en Immunologie van het VUmc te Amsterdam, onder begeleiding van Prof.dr. Y. van Kooyk en Dr. I.M. van Die. Het promotie onderzoek werd verricht naar de interacties van C-type lectins op dendritische cellen met glycanen van de parasiet Schistosoma mansoni, zoals beschreven in dit proefschrift. Momenteel is zij werkzaam als research-analiste binnen de afdeling Experimentele Hematologie van Prof.dr. J.H.F. Falkenburg in het LUMC te Leiden.

199

List of publications

201

List of publications E. van Liempt, S.J. van Vliet, A. Engering, J.J. García-Vallejo, C.M.C. Bank, M. Sanchez-Hernandez, Y. van Kooyk and I.M. van Die (2007). Schistosoma mansoni soluble egg antigens are internalized by human dendritic cells through multiple C-type lectins and suppress TLR-induced dendritic cell activation. Mol. Immunol. In press E. van Liempt, C.M.C. Bank, P. Mehta, J.J. García-Vallejo, Z.S. Kawar, R. Geyer, R.A. Alvarez, R.D. Cummings, Y. van Kooyk and I.M. van Die (2006). Specificity of DC-SIGN for mannose- and fucose-containing glycans. FEBS Lett., 580, 6123-6131. S.J. van Vliet, E. van Liempt, T.B.H. Geijtenbeek and Y. van Kooyk (2006). Differential regulation of C-type lectin expression on tolerogenic dendritic cell subsets. Immunobiology, 211, 577-585. I.M. van Die, E. van Liempt, C.M.C. Bank and W.E.C.M. Schiphorst (2005). Interaction of Schistosome glycans with the host immune system. Adv. Exp. Med. Biol., 564, 9-19 S. Meyer, E. van Liempt, A. Imberty, Y. van Kooyk, H. Geyer, R. Geyer and I.M. van Die (2005), DC-SIGN mediates binding to dendritic cells to authentic pseudo-Lewis Y glycolipids of Schistosoma mansoni cercariae, the first parasite-specific ligand of DC-SIGN. J. Biol. Chem., 280, 37349-37359. S.J. van Vliet, E. van Liempt, E. Saeland, C.A. Aarnoudse, B. Appelmelk, T. Irimura, T.B.H. Geijtenbeek, O. Blixt, R. Alvarez, I.M. van Die and Y. van Kooyk (2005). Carbohydrate profiling reveals a distinctive role for the C-type lectin MGL in the recognition of helminth parasites and tumor antigens by dendritic cells. Int. Immunol., 17, 661-669. E. van Liempt, A. Imberty, C.M.C. Bank, S.J. van Vliet, Y. van Kooyk, T.B.H. Geijtenbeek and I.M. van Die (2004). Molecular basis of the differences in binding properties of the highly related C-type lectins DC-SIGN and L-SIGN to Lewis X trisaccharide and Schistosoma mansoni egg antigens. J. Biol. Chem., 279, 33161-33167. C. Stortelers, C. Souriau, E. van Liempt, M.L.M. van de Poll and E.J.J. van Zoelen (2002). Role of the N-terminus of Epidermal Growth Factor in ErbB-2/ErbB-3 Binding studied by Phage Display. Biochem., 41, 8732-8741. A. Engering, T.B.H. Geijtenbeek, S.J. van Vliet, M. Wijers, E. van Liempt, N. Demaurex, A. Lanzavecchia, J. Fransen, C.G. Figdor, V. Piguet and Y. van Kooyk (2002). The dendritic cell specific C-type lectin DC-SIGN internalizes antigen for presentation to T cells. J. Immunol., 168, 2118-2126.

C-type lectin interactions with SEA › files › 42199030 › proefschrift... · VRIJE...

Documents

Transcript of C-type lectin interactions with SEA › files › 42199030 › proefschrift... · VRIJE...