By YUAN LU

ENGINEERING THE AAV VECTOR FOR ENHANCED TUMOR TARGETING

By

YUAN LU

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2016

To my family and friends

4

ACKNOWLEDGMENTS

I would like to express my sincere gratitude to Dr. Steven C. Ghivizzani, for his

support, guidance in both science and life. Dr. Ghivizzani gave me a project that fits my

research interests perfectly. It is this interest that continuously kept me passionate and

excited about my project all through my Ph.D. studies. I enjoyed sharing all those

exciting data and have intriguing discussions with Dr. Ghivizzani who appreciated my

efforts and provided encouragement. Dr. Ghivizzani gave full understanding of my

status as a mother. Actually, he was the person, who encouraged me to take of my

family and myself. It is this freedom that helped me to go through these difficult years as

a Ph.D. mother.

I would like to thank the members of my committee, Drs. Arun Srivastava, Sergei

Zolotukhin and Dietmar W. Siemann for their encouragement and suggestions.

Especially, I am very grateful for Dr. Arun Srivastava who introduced me to Adeno-

associated virual vector (AAV)-mediated gene therapy and encouraged me to apply for

the Ph.D. program in UF. In addition, I would like to thank Dr. Zolotukhin for providing

me the AAV capsid library and for his thoughtful guidance and support. I would also like

to thank Dr. Mavis Agbandje-Mckenna for her supervision in AAV capsid structure.

I would like to thank Dr. Damien Marsic in Dr. Zolotukhin’s lab for his expertise,

guidance and assistance with AAV technology that made possible this collaborative

project.

My doctoral study has been very rewarding, due in a large part to the support

and friendship with all the members in Drs. Steven C. Ghivizzani, C. Parker Gibbs and

Glyn D. Palmer’s lab. Thanks to Drs. Padraic P. levings and Rachael Watson Levings,

they helped me to adjust to the new lab, the new project and the new techniques. I

5

learned a lot about cancer through our cancer discussion group including, Dr. Elham

Nasri and Dr. Ali Zarezadeh, Dr. Viktoria Hyddmark, Margaret White, Dr. Maria Del

Valle Guijarro Barrigo, Dr. Alfonso Martin-Pena and Dr. Glyn D. Palmer. They all have

shaped my project in so many ways and have left me with beautiful memories. In

particular, I would like give special thanks to Dr. Guijarro who has dedicated so much

time for me and pointed out my shortcomings. I am very fortunate to know her and have

this friendship.

Importantly, I would like to thank my husband, Dr. Chen ling, for those years of

unconditional companion and support. In the years in the United States, we met each

other, knew each other, and married each other. He played a critical role in leading me

to the area of AAV-mediated gene therapy and in my decision to pursue this area for my

doctoral research. I have enjoyed every moment that Chen and I have discussed

science.

What’s more rewarding is that our love continues with the birth of our two kids,

Zhenye Ling and Zhenxin Olivia Ling. Zhenye was born several months before I started

my Ph.D. training. Zhenxin was born during my second year of Ph.D. study. They kept

us so happy and busy in these years. I must admit that it was very challenging to

complete my Ph.D. while they are so young.

I feel very fortunate to have experienced these milestones in my life during my

doctoral studies, and I believe that family will always be my priority.

Apart from these, I wish to acknowledge my mother, Xiuping Mu and my father

Fang Lu for everything they have done for me. During my doctoral study, my mother

has come many times to the United States to help take care of Zhenye and Zhenxin,

6

and my father has been very supportive of this. Chen and I really appreciate all the

sacrifices you have made.

Finally, I would like to thank the funding support from Alex’s Lemonade Strand to

SCG, the NIH/NCATS to SCG as well as Clinical and Translational Science Award to

the University of Florida UL1 TR000064 to YL.

7

TABLE OF CONTENTS page

ACKNOWLEDGMENTS .................................................................................................. 4

LIST OF TABLES ............................................................................................................ 9

LIST OF FIGURES ........................................................................................................ 10

ABSTRACT ................................................................................................................... 12

CHAPTER

1 INTRODUCTION .................................................................................................... 14

Adeno-associated Virus .......................................................................................... 15 AAV Capsid Structure and Variable Regions .......................................................... 16

Viral-based Gene Therapy ...................................................................................... 17 Cancer Gene Therapy ............................................................................................ 18 Recombinant Adeno-associated Viral Vector and Gene Therapy ........................... 19

AAV Vector for Cancer............................................................................................ 20 AAV Library Based Directed Evolution.................................................................... 22

Osteosarcoma ........................................................................................................ 24 Osteosarcoma Mouse Model Generated by Transplantation of Osteosarcoma

Tumor Initiating Cells ........................................................................................... 26

Conclusion of the Dissertation ................................................................................ 27

2 MATERIAL AND METHODS .................................................................................. 29

Cell Culture ............................................................................................................. 29 In Vivo Selection for Targeting OS TICs ................................................................. 29

In Vivo Selection for Mouse Lung ........................................................................... 31

Sanger Sequencing and Analyzing of the Directed Evolution Derived AAV Variants ............................................................................................................... 32

Next Generation Sequencing of the Directed Evolution Derived AAV Variants ...... 32 Recombinant AAV Packaging ................................................................................. 33 Construction of pAAV-OSLM-HD4 and pAAV-OSLM-HD15 ................................... 34 In Vitro Transduction ............................................................................................... 35

In Vivo Transduction ............................................................................................... 35 In Vivo Imaging ....................................................................................................... 36 In Vivo Viral Genome Copy Number ....................................................................... 36

Statistical Analysis .................................................................................................. 37

3 DIRECTED EVOLUTION IN OS USING A COMPLEX AAV CAPSID LIBRARY .... 39

Positive Selection Following Intratumoral Directed Evolution in OS ....................... 39

8

Negative Selection Following Intravenous Directed Evolution in OS Tumors and Control Selection in Mouse Lung ......................................................................... 40

Next Generation Sequencing of the Directed Evolution-derived AAV Genome Confirmed the Motif Patterns ............................................................................... 42

4 CHARACTERIZATION FOR DIRECTED EVOLUTION DERIVED MOTIFS FOR OS TARGETING ..................................................................................................... 54

AAVs with Tumor-specific Motifs Mediate Efficient OS Transduction In Vitro but not In Vivo Following Systemic Administration .................................................... 54

Increased Systemic Trafficking in OSLM Variants Led to Specific and Efficient OS Transduction In Vivo ...................................................................................... 55

Elimination of WT HSPG Binding Domain Played a Critical Role in Altering the Endogenous Tropism and Increasing the AAV Genome Accessibility to OS ....... 56

Both Selected Motifs and Permissive Tumor Biology Facilitated Higher AAV Transduction ........................................................................................................ 58

5 DISCUSSION ......................................................................................................... 65

How to Engineer the AAV Vector for Tumor Targeting ........................................... 65

What Have We Learned from our Directed Evolution Experiments ........................ 66 Tumor Targeting In Vivo is Different from that In Vitro ............................................ 68

OSLM-HD4 vs OSLM-HD15 ................................................................................... 68

Potential Factors That Contribute to the Higher Permissiveness in OS521 TICs ... 69

6 FUTURE WORKS ................................................................................................... 76

AAV Mediated Transduction of Canine OS Cells In Vivo ........................................ 76 AAV-OSLM-HD4 Showed Rapid and Efficient Transduction for Huh7 Tumor In

Vivo ..................................................................................................................... 76

The Immune Response against AAV-OSLM Variants ............................................ 78 The Humoral Response against AAV-OSLM Variants ..................................... 78

The Cell-mediated Immunity against AAV-OSLM Variants............................... 81 Gene Therapy for Osteosarcoma ........................................................................... 83

Background ...................................................................................................... 83 AAV-mediated OS gene therapy to activate the immune response against

OS ................................................................................................................. 83

AAV-mediated expression of bone morphogenetic protein to treat OS ............ 84

Conclusion .............................................................................................................. 85

LIST OF REFERENCES ............................................................................................... 89

BIOGRAPHICAL SKETCH .......................................................................................... 104

9

LIST OF TABLES

Table page 2-1 The representative titers of AAV vectors that were used in the study. ................ 38

10

LIST OF FIGURES

Figure page 1-1 Genomic organization of the WT AAV2. ............................................................. 28

3-1 Graphic representation of the directed evolution screening process.. ................ 43

3-2 The selection of AAV capsid variants for OS targeting and the resulting AAV variants identified by Sanger sequencing. .......................................................... 44

3-3 Capsid sequences of AAV variants isolated from round I OS156 primary tumor following i.t. injection of AAV library.. ........................................................ 45

3-4 Capsid sequences of AAV variants isolated from round II OS156 primary tumor following i.t. injection................................................................................. 46

3-5 Capsid sequences of AAV variants isolated from round II OS156 lung metastases following i.v. injection. ...................................................................... 47

3-6 The enriched motifs in VR I, V and VII and the differences in probability of mutation after i.t. based screenings in OS156 model. ........................................ 48

3-7 Capsid sequences of AAV variants isolated from round I OS156 primary tumor following i.v. injection of AAV library.. ....................................................... 49

3-8 Capsid sequences of AAV variants isolated from round II OS156 primary tumor following i.v. injection. ............................................................................... 50

3-9 The VR VIII sequence alignment and the changes of probability of mutation after i.v. based screenings in OS156 model. ...................................................... 51

3-10 Capsid sequences of AAV variants isolated from mouse lung following i.v. injection. ............................................................................................................. 52

3-11 The selection of AAV capsid variants for OS targeting and the resulting AAV variants identified by next generation sequencing. ............................................. 53

4-1 AAV capsid variants with tumor specific motifs (VR I, V and VII) mediate efficient OS transduction in vitro but not in vivo following systemic delivery. ...... 60

4-2 The combination of tumor-specific and systemic trafficking motifs lead to efficient and specific OS transduction.. ............................................................... 61

4-3 The tumor-specific and systemic trafficking motifs contribute to reduced native AAV tropism and increased GCN in the tumor. ........................................ 63

4-4 OS521 is more permissive for AAV infection than OS156 both in vitro and in vivo.. ................................................................................................................... 64

11

5-1 Schematic model of AAV-mediated systemic OS targeting. ............................... 71

5-2 Comparison of heparan sulfate proteoglycan pathway between OS156 TICs and OS156 non-TICs. ......................................................................................... 72

5-3 Expression profile of AAV2’s receptor and co-receptor on the cell surface of OS521 and OS156 TIC. ..................................................................................... 73

5-4 Analysis of endocytosis pathway in the OS521 and OS156 TICs. ...................... 74

5-5 Analysis of lysosomal pathway in the OS521 and OS156 TICs. ........................ 75

6-1 OSLM-HD4 shows rapid and efficient transduction for targeting Huh7 tumor in vivo.. ............................................................................................................... 86

6-2 Neutralizing antibody titers of AAV-OSLM variants. ........................................... 87

6-3 OSLM-HD4 showed a dose-dependent expression in OS156 tumor in vivo. ..... 88

12

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

ENGINEERING THE AAV VECTOR FOR ENHANCED TUMOR TARGETING

By

Yuan Lu

December 2016

Chair: Steven C. Ghivizzani Major: Medical Science – Genetics

Adding tumor-specific recognition and binding domains to enhance the

interaction with cancer cells is the traditional concept used in tumor targeting for adeno-

associated virus vectors (AAVs) and other drug delivery platforms. However, the theory

that enhanced specificity for tumor antigens contributes to improved gene delivery to

tumors remains unconfirmed. We used a complex AAV library, which contains AAV

variants with combinatorial mutations introduced in the variable regions (VRs) of the

viral capsid. We hypothesized that, with this library, we could use in vivo selection to

identify capsid variants with enhanced tumor targeting and to understand the pressures

involved in AAV-mediated gene transfer in tumor. A patient-derived osteosarcoma

murine xenograft model was used for the in vivo selection. Uniquely, we compared the

selective pressures of intratumoral (i.t.) library injection with these of intravenous (i.v.)

library injection for systemic circulating and infecting the tumor cell. Intratumoral

screening positively selected for mutated motifs in VR I and V, but not VR VIII, which is

known as the AAV primary receptor binding region, and determines the AAV native

tropism. Intravenous screening negatively selected against the wild type VR VIII and

only enriched for AAV variants with mutated VR VIII. Further characterization showed

13

that the AAVs with i.t. motifs demonstrated increased AAV transduction in vitro, but not

in vivo. The utilization of a motif in VR VIII derived from i.v. screening achieved

hundreds of folds higher transgene expression in vivo. The combination of both

systemic and intra-tumoral motifs further increased the selectivity, but not the efficiency,

of transgene expression in the tumor. Profiling the genome biodistribution of the above

vectors showed that diminishing the native AAV tropism and thereby enabling AAV

accessibility to the tumor were critical for effective tumor targeting. By enabling the AAV

to freely circulate, the biology of tumor and tumor cells out-competes normal cells and

tissues for AAV transduction. Furthermore, the AAV vectors armed with novel motifs

demonstrated high accessibility and transgene expression in two different patient cells

derived xenografts in vivo. Therefore, only accounting for vector-cell interaction is not

enough for AAV-mediated systemic tumor targeting. It appears that tumors are uniquely

suited for high AAV uptake and transduction. Future tumor-directed AAV vector design

should consider systemically reaching the tumor cells before vector tumor cell

interaction.

14

CHAPTER 1 INTRODUCTION

The aims of this study were: i) To understand the complex processes during

adeno-associated viral vector (AAV)-mediated systemic gene delivery to the tumor; ii)

To develop a novel AAV based targeting platform for metastatic disease.

Specifically, we asked the research questions: i) What are the barriers that AAV

needs to overcome for selective tumor gene transfer following systemic delivery? ii)

What amino acids and motifs on the AAV capsid that are involved to overcome these

barriers?

To do that, we utilized a high-throughput in vivo selection strategy called directed

evolution, which empowered us to study the complex processes involved in tumor

targeting without detailed prior knowledge. Using a complex AAV capsid library of more

than 108 combinatorial variants, directed evolution was conducted in a clinically relevant

tumor model based on xenotransplantation of patient-derived osteosarcoma cells into

immune-deficient mice. By interpreting the sequences of selected AAV capsid variants

after tumor orienting selections, we were able to identify amino acids and motifs that are

responsible for overcoming the various barriers in tumor-directed gene transfer. The

knowledge gained in this study may help to guide the future vector design and possibly

gene based treatments for osteosarcoma.

In this chapter, the following background topics will be discussed which includes:

AAV basic virology, gene therapy, cancer gene therapy, AAV vector technology, AAV

vector for cancer, directed evolution by screening using AAV capsid library, cancer

model based on osteosarcoma.

15

Adeno-associated Virus

AAV was discovered in 1965 as a contaminant of Adenovirus (Ad) isolates [1]. It

belongs to the genus Dependoparvovirus of the family Parvoviridae. AAV is a

replication-deficient virus. In order to have productive viral replication, a cell infected

with AAV must be co-infected with a helper virus such as Ad, or herpes simplex virus. It

is a nonenveloped virus that has a single-stranded linear DNA genome, approximately

5kb in length [2]. The viral genome consists of three open reading frames (ORF) that

encode for eight proteins expressed from three promoters (Figure 1-1). The coding

regions of AAV are flanked by the inverted terminal repeats (ITRs). The ITRs are 145

bases long and form, as a cis-element, a T-shaped hairpin structure, which functions as

the origin of DNA replication and signal for genome packaging [3, 4]. The replication (rep)

ORF encodes four non structure proteins, Rep78, Rep68, Rep52 and Rep40, which

play roles in viral genome replication, transcription as well as packaging. Differential

promoters (p5 promoter for Rep78 and Rep68, p19 for Rep52 and Rep40) and

alternative splicing are involved in generating mRNAs for the Rep proteins (Figure 1-1).

The capsid (cap) ORF encodes three structural proteins that form the AAV capsid, VP1,

VP2, and VP3. The p40 promoter initiates mRNAs that are alternatively spliced to make

the VP1-VP3 (Figure 1-1). The assembly-activating protein (AAP), is transcribed in

another ORF [5] (Figure 1-1), which facilitates nuclear import of VP3 proteins and

promotes assembly and maturation of the capsid. In the ratio of 1:1:10 (VP1:VP2:VP3,

total 60 copies of VP monomers), the mature virion forms a T=1 icosahedral capsid,

~25nm in diameter.

16

AAV Capsid Structure and Variable Regions

Thirteen distinct human and nonhuman primate AAV serotypes (AAV1-13) have

been reported so far and over 100 AAV variants have been successively identified in

primate and human tissues through PCR studies [6-8]. Through pseudotyping studies in

which the AAV2 ITRs serve as the packaging signals for encapsidation of the same

transgene into alternate AAV capsids, it has been shown that the transduction

efficiencies and tissue tropism are dictated by the AAV capsid [9-13]. The capsid plays

roles throughout the viral life cycle, from the initial binding to cell-surface receptors, to

intracellular trafficking, and entry into the nucleus, which all contribute to the ability of

AAV for gene transfer [14, 15].

To date, preliminary structure characterizations of AAV1-AAV9 have been

reported [16-28]. It should be mentioned that only the C-terminal overlapping VP amino

acid (aa) residues (~520 aas, common VP region) have been structurally determined.

Comparison of them shows that the topology of the structurally ordered common VP

region is highly conserved between different AAVs. The variability between different

AAVs is not distributed throughout the capsid protein but is concentrated in the loops or

variable regions (VRs, I-IX) that are displayed on the surface. The AAV capsid surface

is characterized by depressions at the twofold axes (dimple), a cylindrical channel at the

fivefold axes (canyon), and protrusions at or surrounding the threefold axes. The VRs

cluster at the fivefold axes, the threefold protrusions, and two fold depressions. The

residues in these VRs play important roles in viral-receptor binding, neutralizing

antibody binding, transduction efficiency and tissue tropism (detailed review in [15]).

17

Viral-based Gene Therapy

Gene therapy involves the use of a nucleic acid polymer as the drug to treat

disease. In gene therapy, there are three critical elements: the vector or gene delivery

vehicle; the transgene; and the target tissue. In my dissertation, we focused on two of

the three components to develop a novel viral vector to target cancer.

Viruses have evolved natural mechanisms to gain access to host cells and

deliver their genomes. Taking advantage of this, an engineered virus or viral vector is

an excellent candidate for delivering foreign DNA. To target cells, viral vectors for gene

therapy applications keep their efficient infectious ability but avoid most of the viral

replication and pathogenesis. This is achieved by replacing essential genes involved in

replication and toxicity with foreign DNAs of interest.

In 1995, using retroviral vectors, two independent groups reported successful

gene therapy for adenosine deaminase (ADA) deficiency patients, marked the first

genetic disorder treated by gene therapy [29, 30]. Despite the initial enthusiasm for gene

therapy as a revolutionary technology, the safety of this new paradigm was under

debated. In 1999, massive inflammatory toxicity against capsid of the Ad vector due to

widespread vector dissemination, led to the death of a patient in the ornithine

transcarbamylase deficiency trial [31-34]. In 2000, gene therapy using a retroviral vector

for human severe combined immunodeficiency-XI syndrome achieved clinical efficacy

[35]. However, after additional patients were treated, two developed leukemia-like

disease due to integration of retroviral vector genome near or in the LIM domain only 2

(LMO2) oncogene which activated LMO2 expression [36, 37]. The lack of early clinical

success was due, in a large part, to our lack of knowledge of how viral vectors interact

18

with the host and consequently a failure to make safe vectors that specifically and

efficiently deliver genes to diseased cells.

Learning from history, intense efforts have been made to understand vector

biology to allow the development of novel vectors with improved efficiency, specificity,

and safety. In my Ph.D. work, we are interested in understanding AAV-mediated gene

delivery to cancer so that we can develop methods for specific and efficient cancer

transduction and possibly improved methods for treating this disease.

Cancer Gene Therapy

In addition to the repair of single-gene defects, gene therapy has been extended

to acquired, muti-gene diseases such as cancer [38, 39]. As a matter of fact, by 2007,

66.5% of gene therapy clinical trials worldwide were for cancer [40]. This has been

maintained, 64.4%, by 2012 [41]. In cancer gene therapy, various strategies can be used,

such as overexpression of tumor suppressor genes, inhibition of oncogene expression,

delivery of suicide genes to cancer cells, delivery of anti-angiogenic genes, immune

gene therapy for cancer, sensitization of the cancer cells to chemotherapy, etc. Over the

years, gene therapy clinical trials for many different cancers have been conducted. This

includes lung, gynecological, skin, urological, neurological and gastrointestinal, as well

as hematological malignancies [41]. These trials have established the proof-of-principle

for cancer gene therapy and show the safety of this paradigm.

Despite the proliferation of clinical protocols for cancer, there are many aspects

of gene transfer that are less than ideal, especially for solid tumors. The majority of

gene therapy clinical trials for solid tumors have used direct intratumoral injection. This

secures tumor specificity but limits its use to solitary tumors. The ultimate success of

cancer gene therapy requires the induction of systemic effects as metastatic disease is

19

the greatest challenge for treatment. The major challenge is the need for vectors that

selectively and efficiently target tumors in vivo following systemic injection. Delivery to

non-target tissues should be minimized. Therefore, one of the most important areas for

future cancer gene therapy is vector design, an area that requires an understanding of

cancer biology to guide the molecular engineering of the vector and transgene. In

addition to optimization of the therapeutic gene construct, the development of a vector

that is broadly applicable to many types of cancer may be the future direction.

Recombinant Adeno-associated Viral Vector and Gene Therapy

In the recombinant AAV (rAAV) vector, all the viral protein coding sequences are

substituted with foreign DNA. The only AAV-derived sequences present in rAAV vector

are the two ITRs [3, 42]. The expression cassette of an rAAV vector contains appropriate

enhancer, promoter, poly(A) and splice signals to ensure correct gene expression.

A double or triple-plasmid transfection method is commonly used for packaging

research-grade rAAV vector[43, 44]. For triple transfection, the first plasmid contains the

rAAV genome. The second plasmid contains the AAV rep and cap sequences and

provides for their expression in trans. The third plasmid encodes the Ad helper genes

which include E2a, E4 and VA RNA. The three plasmids are transfected into packaging

cell line, HEK 293 cells, which provides additional adenoviral gene products necessary

for rAAV packaging, Ad E1a and E1b. For double transfection, the AAV rep, cap and Ad

helper sequences are combined on a single plasmid. After production in HEK293 cells,

the rAAV particles are purified and quantified (titered) as described in Chapter 2.

rAAV vector is a promising tool for human gene therapy. Relative to other viral

vector systems and the potential for clinical translation, rAAV offers several important

advantages: (1) Favorable safety profile: no known human disease is associated with

20

wild type AAV, which can only replicate under special circumstances. There are no viral

protein coding sequences in the vector. The rAAV vector rarely integrates into the host

genome. (2) Ability to infect both dividing and non-dividing cells in vitro and in vivo. (3)

Long-term expression of the transgene in various tissues in vivo. (4) The transduced

cells have a low immunogenic profile. All of these contribute to proven efficacy in

numerous animal models, as well as an increasing number of clinical studies (reviewed

in [45, 46]) including Leber’s congenital amaurosis [47-49], Hemophilia B [50, 51], Alpha-1

antitrypsin deficiency [52], Aromatic L-Amino Acid Decarboxylase Deficiency [53],

choroideremia [54], Parkinson’s disease [55, 56], Canavan’s disease [57] and muscular

dystrophies [58]. In 2012, the European Commission approved a rAAV-based product for

lipoprotein lipase deficiency, the first gene therapy product approved in the western

world [59].

AAV Vector for Cancer

Although the utilization of AAV for cancer gene delivery has not been as

extensively explored as the other viral vectors, numerous advantages of AAV make it a

promising vector for this application. Here we focus on the evolution of AAV vector

technology (capsid modification) for cancer gene delivery based on preclinical studies.

The first major advancement was the discovery that multiple AAV serotypes and

variants exists in nature. Due to historical reasons, wild type AAV2 capsid was the first

exploited for gene delivery to cancer cell lines, including cervical, breast, prostate,

colon, small cell lung carcinoma, ovarian, hepatocellular carcinoma, and melanoma as

well as primary tumor cells isolated from melanoma and ovarian carcinoma patients[60-

64]. With the discovery of additional AAV serotypes including AAV1, AAV3, AAV4, AAV5,

AAV6, AAV7 and AAV8, the comparison between them for in vitro and in vivo tumor

21

transduction was conducted [65-68]. In general, AAV2 is the most efficient for in vitro

tumor cell transduction. The tumor transduction efficiency in vivo for different AAV

serotypes, however, depends on the biology of the tumor. The growing number of

naturally-existing AAVs is continuously being characterized for cancer transduction.

Unfortunately, it has been proven to be difficult to achieve specific and efficient cancer

transduction by using naturally existing AAVs, and therefore most of the current studies

are based on the local injection of the vector. In addition, it is laborious to systemically

characterize each AAV variant for its capacity of infecting different tumors.

The second major advancement is the modification of the AAV capsid to mediate

enhanced gene transfer to previously non-permissive cancer cells. Certain tissues and

cell types are naturally resistant to rAAV transduction, such as leukemia cells [69, 70]. In

addition, many neoplasms are characterized by a deficiency of heparan sulfate

proteoglycan (HSPG) expression, the primary receptor for AAV2 [71].In order to

transduce them, the HSPG-independent gene delivery was explored. This includes

genetically modified capsids, genetic incorporation of targeting peptides into the AAV

capsid for binding cancer cell markers [72-76], a bispecific antibody in which one arm

recognizes an alternative cell-surface receptor and the other recognizes the AAV capsid

[77-79]. The above-mentioned techniques require in-depth understanding of the AAV

capsid and cancer cell biology, especially surface marker expression. In addition,

incorporating foreign entities into AAV capsid tends to make the vector unstable and

hard to scale-up for clinical production.

Recently, a directed evolution technique (next section) was developed to

generate novel designer AAV variants for targeting cancer. A peptide-insertion library

22

based on the AAV2 capsid was recently used to screen for optimized AAV for

transducing breast cancer in vitro and in vivo [80]. The in vivo screening allows for

selection of vectors with an extended but not restricted tropism towards the breast

cancer. Learning from the above study, it is foreseeable in the future that more cancer

types will be tested for AAV library screening.

AAV Library Based Directed Evolution

Directed evolution is a high-throughput laboratory process which mimics the

process of natural evolution to create biological entities with desired traits [81]. To alter

the undesired tropism, directed evolution has been used to select AAV capsids with

enhanced transduction efficiency and specificity for target cells and tissues [82-85].

The method involves engineering genetic diversification into the capsid to create

a library of replication competent viruses, repeated rounds of screening or selection

which enable the enrichment of key mutations or motifs that help to achieve the user-

defined goal. For AAV, this process includes creating viral particle libraries which

contain mutations in the cap ORF with large genetic diversity. Then, selective pressure

is applied to the AAV library to promote the emergence of capsid variants that are best

suited for the selected trait. They are then recovered and used as enriched sub-library

for the next cycle of selection. After sequential rounds of selection, the resulting AAVs

can be tested clonally for the desired property.

Currently, four different techniques have been applied to create genetic diversity

in cap ORF. First, random point mutations were introduced into the cap ORF and

amplified by error-prone PCR [82, 86]. This method, however, gives rise to high yield of

dead-end AAV variants derived from random mutagenesis. Second, chimeric cap genes

can be generated by mixing multiple AAV capsid sequences for DNA shuffling, a PCR-

23

based method for genetic recombination [84, 85]. However, the level of chimerism and the

genetic diversity depend on the input parental AAV capsid sequences, which are usually

limited. Third, peptide library sequences can be inserted into the AAV capsid, usually

the receptor binding domain of AAV2 capsid, at R588 position [87] or corresponding

position of another AAV serotype [88].

Finally, genetic diversification can focus on the VRs of the AAV capsid. It was

first introduced to four VRs [89]. Recently, this has been extended to eight VRs, except

VR II (due to its overlapping with AAP ORF), either individually or combinatorially [90].

The eight VR modified library was developed by Dr. Damien Marsic in Dr. Zolotukhin’s

lab and was used in my doctoral work. In the following paragraphs, I will explain how the

VR modified AAV capsid library was generated by Marsic et al. [90].

Combining the sequence information of over 150 naturally-occurring variants,

and the structual information of AAV2, the amino acid residues of the VRs that have

side chains exposed to the capsid surface were chosen as candidate positions for

mutagenesis. Apart from these, four additional positions were modified: surface Y444F

and Y500F for their ability to increase the transduction efficiency [91] and surface R585

and R588 for their role in binding to HSPG [92, 93], the primary receptor for AAV2 [71].

A library containing mutations in individual VR lineages (each with mutations in

only one or two VRs) was created. A novel gene-synthesis based approach was used to

generate mutations in a particular VR lineage while other VRs were unmodified. Then, it

was used to package individual VR AAV libraries. The recovered encapsidated viral

DNAs for each VR, identified variants that were compatible with the capsid struture,

which were then used to create a combinatorial VR library. This stepwise approach for

24

the library construction helped to select for variants with aa substations compatible with

capsid structure, and thereby increase the probability of generating functional mutant

virions. This strategy produced a synthetic combinatorial library encoding simultaneous

mutations in eight capsid surface VRs, with a complexity close to 1 × 108 [90].

This variable region-modified capsid library was used in my doctoral project for

selecting AAV variants with enhanced tumor targeting. Using the current AAV

knowledge, this library provides us a unique opportunity to elucidate the resulting amino

acids and motifs in the AAV capsid that are functional for tumor targeting. The results

gained in this study will facilitate future rational design of AAV vectors for cancer

targeting.

Osteosarcoma

The tumor model used in the project is a human osteosarcoma xenograft mouse

model.

Though rare (~3 per 1 million of the population, comprising less than 1% of

cancers diagnosed in the United States) [94], osteosarcoma (OS) is the most common

primary tumor of bone, which is characterized histologically by osteoid production. It

onsets during periods of skeletal growth and thus primarily affects children and

adolescents (between 12 and 25 years of age) [95, 96]. The second peak of OS rises in

individuals over 60 years of age which is associated with other pathological conditions

that stimulate atypical bone growth such as Paget’s disease or radiation exposure [96].

OS occurs most commonly in the metaphyseal regions of long bones. The femur

is the most common anatomic location (45%), followed by the tibia (15%) and the

humerus (10%) [97]. The natural history of OS is one of relentless progression, with local

invasion of bone, loss of function of the affected extremity, and distant metastasis.

25

Human OS most often metastasizes to the lung (90%) and rarely to the lymph node. At

diagnosis, approximately 80% of patients are believed to have micrometastatic disease.

However, only 8-15% of them are detected with current diagnostic tools and many thus

patients have undetectable pulmonary micrometastasis at diagnosis.

Current treatments for OS involve radical surgery combined with multi-drug

chemotherapy. Treatments are generally comprised of preoperative chemotherapy

(“neoadjuvant” chemotherapy). The tumor then is extirpated by amputation or a limb

salvage procedure. This is followed by postoperative “adjuvant” chemotherapy. The

chemotherapeutic regimen for OS patients usually combines cisplatin, doxorubicin, and

high-dose methotrexate [98, 99] which causes severe toxic side effects, such as

cardiomyopathy, hearing loss, and risk of secondary malignancy [100, 101]. Despite

intensive efforts to improve both chemotherapeutics and surgical management, the 5-

year survival rate is between 65% and 75% for localized disease, whereas for patients

with obvious metastasis at presentation, it remains poor at 20% [102]. This has not been

improved over the past 30 years. Therefore, there is an urgent need for the

development of novel therapeutics that can specifically and efficaciously eliminate tumor

burden with reduced toxicity for OS patients.

The scope of this doctoral project is not to develop therapy for OS per se as

there is no consensus gene or gene combination that has been proven effective.

Lessons from gene delivery have shown that it is best to use therapeutic genes that

complement the specific attributes of the vector. Therefore, the development of a novel

targeting platform for OS will provide a solid foundation for further development of novel

therapeutics for OS.

26

Osteosarcoma Mouse Model Generated by Transplantation of Osteosarcoma Tumor Initiating Cells

The OS model used in the project is generated by xenotransplantation of OS

tumor initiating cells (TICs) into immune-compromised mice.

TICs, also described by some as cancer stem cells, are those cells within a

heterogeneous tumor, that have the ability to proliferate, self-renew and initiate growth

of a tumor subsequently [103]. Though not consistent with our data, TICs are thought to

be resistant to conventional cancer therapeutics and lead to relapse or tumor

recurrence are are responsible for the current failure in the cancer treatment. The

identification, understanding of TICs and intratumoral heterogeneity also hold great

opportunities to develop novel cancer treatment based on targeting all tumor cell

populations.

Our lab was the first to show that a subpopulation of OS cells functions as TICs

[95]. These cells are able to form spheres in serum-free semi-solid medium with

epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) and low

attachment culture (anchorage independence) conditions. They also have the ability to

self-renew in which single cells dissociated from the spheres are capable of forming

secondary spheres at an increased frequency.

Following the previous discovery, our group aimed to identify the distinct subsets

of OS cells as well as examine their biology. Using OS cells from patient biopsies, it was

found that OS TICs are uniquely capable of activating a fluorescent reporter construct

containing the full-length Oct-4 promoter linked to the coding sequence for green

florescent protein (GFP) [104]. The OS Oct-4/GFP+ cells, or OS TICs, variously comprise

between 20% and 70% of the tumor volume, and show > 100 fold enhancement of

27

tumorigenic activity following xenotransplantation into immune-deficient mice [104].

Moreover, these TICs form heterogeneous primary tumors which are comprised of both

malignant and non-malignant tumor cells, and specifically metastasize to the lung [104].

The beauty of this OS model is that it develops spontaneous metastasis from

subcutaneous implanted primary tumor without oncogene transformation such as v-Ki-

ras-oncogene [105, 106].

The development of this clinically relevant model provides us a unique

opportunity to study the process of AAV mediated gene delivery to tumor.

Conclusion of the Dissertation

Contrary to the prevailing theory of vector design, which focuses solely on

increased interaction between vector and target cell surface antigens, we found that the

AAV capsid motifs selected for selective AAV tumor cell interaction did not lead to

enhanced tumor localization or transgene expression, but contributed to increased

specificity in vivo. Dramatically increased tumor transduction in vivo was achieved by

motifs arose from negative selection pressures, against motifs that limited access of the

virus to tumors. Therefore, for AAV mediated systemic gene delivery to tumor, the

vector should be designed primarily to be accessible to the tumor and secondarily for

specific interaction with tumor cells.

28

Figure 1-1. Genomic organization of the WT AAV2. (Reference[107])

29

CHAPTER 2 MATERIAL AND METHODS

Cell Culture

Osteosarcoma patient biopsies were obtained with consent using protocols

approved by the institutional review board (IRB) of University of Florida, College of

Medicine. Osteosarcoma cultures, both OS156 and OS521, were established from

patient biopsies as described[108], and were maintained in complete culture medium

(DMEM/F12, 10% FBS, 2mM L-Glutamine, 1% penicillin/streptomycin, Gibco). OS156

TIC and OS521 TIC were identified using stable transfection of osteosarcoma cultures

with phOct-4/GFP as previously described [104]. OS TICs were maintained in complete

culture medium with 0.4mg/mL G418 (Mediatech). Primary mouse lung cells were

cultured using complete culture medium. HEK293 cells were maintained in DMEM, 10%

FBS, 2mM L-Glutamine, 1% penicillin/streptomycin. All cells were grown in adherent

culture in a humidified atmosphere at 37°C in 5% CO2 and were sub-cultured after

treatment with trypsin-EDTA (Gibco) for 2-5 min in the incubator, washed and re-

suspended in the new complete medium.

In Vivo Selection for Targeting OS TICs

The AAV library was generously provided by Dr. Sergei Zolotukhin, University of

Florida, Gainesville, FL, USA. Animal experiments were approved by the University of

Florida Institutional Animal Care and Use Committee. A library of individual VR lineages

(25% in the total injection volume) was combined with a library of combinatorial VR

modifications (75% in the total injection volume). The combined libraries were used as

the starting library for all the screenings in this report [109]. In each round of selection,

NSG (nonobese diabetic/ severe combined immunodeficient, interleukin 2-gamma-

30

deficient, NOD-SCID Il2rg-/-) mice, six to eight weeks old, were subcutaneously injected

with 1 × 106 OS156 TICs to form xenografts. When the primary tumor reached 1cm in

diameter, mice were injected with 1 ×1010 to 1 × 1011 vg of viral preparation (AAV

starting library for the first round, OS-enriched sub-library in subsequent rounds) either

intratumorally or intravenously. Mice were euthanized 5 days post-injection by cervical

dislocation after being anesthetized with isoflurane. Primary tumors or lung (containing

metastases) were harvested, dissociated with collagenase type I and type II

(Worthington Biochemical Corporation, Lakewood, NJ) and sub-cultured in the complete

medium containing G418, followed by FACS to isolate GFP+ cells. Subsequently, the

GFP+ cells were continually sub-cultured. When GFP+ cells reached 90% confluence,

they were super-infected by hAd5 for 3 days to allow for AAV replication and to account

for the post-uptake parameters that can affect vector-mediated gene transfer [110]. Then,

episomal DNA was purified from the infected cells using modified Hirt DNA extraction

[111]. The resulting DNA was used as the template to amplify AAV capsid DNA

sequences using the primer set (forward: GGATGGGCGACAGAGTCATC, reverse:

CAAGCAATTACAGATTACGAGTCAGG). The amplification products were then gel

purified (QIAGEN) and inserted into linearized pSubEagApa backbone [109], a derivative

of pSub201[112] containing a deletion between ApaI sites and including an EagI site

(silent mutation) allowing reconstitution of a full-length cap gene between ApaI and EagI

sites. Gibson Assembly (NEB, Ipswich, MA) was used to insert the capsid fragment [113].

The assembled product was then subjected to bacteria transformation and maxi-

preparation (library plasmid) for AAV library packaging.

31

The packaging of OS-enriched sub-library was performed as previously

described[109, 114], except that HEK 293 cells were co-transfected with 10ng of the

library plasmid and 70ug of pHelper (molar ratio 1:5000) for each 15-cm dish. Under

these experimental conditions (5.6 × 1012 total plasmid molecules for 2.7 ×107 cells in

each plate), we calculated that between 0.2 and 1 copy of the library plasmid reaches a

cell nucleus on average. Polyethyleneimine (PEI, linear, MW 25000, Polysciences, Inc.,

Warrington, PA) was used as transfection reagent. Cells were harvested 72 hrs post-

transfection, subjected to 3 rounds of freeze-thaw to recover the AAV variants inside the

cells. To recover the AAV variants outside of cells, the culture medium was collected 72

hrs post- transfection then subjected to tangential flow filtration. Both the cell lysate and

the filtered medium were then digested with Benzonase (Invitrogen, Grand Island, NY).

AAV was purified on iodixanol gradient (Sigma, St. Louis, MO) followed by ion

exchange chromatography using HiTrap Q HP (GE Healthcare, Piscataway, NJ) [115].

The elution was concentrated by centrifugation using centrifugal spin concentrators with

150K molecular-weight cutoff (MWCO) (Orbital biosciences, Topsfield, MA). The titer of

the AAV library was quantified by qPCR using primers specific to the rep gene (forward:

GCAAGACCGGATGTTCAAAT, reverse: CCTCAACCACGTGATCCTTT).

In Vivo Selection for Mouse Lung

The procedures of in vivo selection of AAV variants from mouse lung were the

same as that of OS TICs, except that naïve NSG mice were used for AAV library

injection. Briefly, naïve NSG mice were tail vein injected with 1X1010 to 1X1011 vg of

AAV library. Mice were euthanized 5 days post-injection. Mouse lungs were harvested,

dissociated with collagenase type I and type II and sub-cultured in complete medium.

When cells reached 90% confluence, they were super-infected with hAd5 for 3 days.

32

Then, episomal DNA was isolated by Hirt DNA extraction and followed by PCR

amplification of the AAV capsid region. The purified correct PCR product was inserted

into linearized pSubEagApa backbone to check the ITR sequence before sequencing

the capsid.

Sanger Sequencing and Analyzing of the Directed Evolution Derived AAV Variants

After transformation of the assembled product (library plasmid), around 50

bacteria colonies were picked randomly. The resulting DNA products were digested with

XmaI to check for the existence of the AAV ITR sequence. The clones that have both

ITR (giving rise to a 4.7 fragment or the full-length WT AAV genome) were then

analyzed by sequencing using the primer set (forward: ACAGAGTCATCACCACCAG,

reverse: ACGAGTCAGGTATCTGGTG) that covers all the VRs in the AAV capsid. The

sequences were then aligned back to the wild type AAV2 VR reference sequence. The

mutant AAs were marked in red. For each screening, if no particular mutant aa was

specified, the probability of mutation was calculated by the number of mutants in a

particular position divided by the total number of sequences successfully aligned. If a

particular mutant aa was specified, the probability of mutation was calculated by the

number of this mutant aa in the particular position divided by the total number of

sequences successfully aligned.

Next Generation Sequencing of the Directed Evolution Derived AAV Variants

We used Illumina MiSeq paried-end (2 × 300) platform to analyze the AAV

variants derived from the directed evolution. In order to minimize the influence from the

cloning bias, the episomal DNA isolated from OS156 cells during the directed evolution

was used as the template. Each resulting episomal DNA was subjected to PCR to

33

amplify the VR IV to VR VIII region individually, using the primer set (forward:

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCATGAATCCTCTCATCGACCAGT

ACCTG and reverse:

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATGCCTGGAAGAACGCCTTG

TG). The PCR products at the correct size were gel purified (QIAGEN) which was then

subjected to index PCR using the Nextera XT index kit (Illumina) by KAPA polymerase

(KAPABIOSYSTEMS). The PCR products were cleaned (ZYMO RESEARCH) and

quantified by nanodrop. These products were then mixed and followed by next

generation sequencing conducted in the ICBR core at the University of Florida.

The reads were first merged by PEAR software (Paried-End reAd mergeR) to

combine the paried-end reads using the minimum of 25 nt overlap. The merged reads

were then filtered to include the sequences that match at least 85% of the reference

wild type AAV2 sequence. Next, those sequences were translated and aligned back to

wild type AAV2 VR reference sequence for further filtering the data. The sequences that

containing amino acid substitutions next to the VRs, contiguous amino acid substitutions

outside VRs were excluded from further analysis. After the above filtering, we chose the

reads with copy number larger than 0.1% of the existing pool for analyzing the

mutations and the probability of mutation after each selection. The probability of

mutation was calculated by the number of mutants in a particular position above the

0.1% cutoff divided by the total number of sequences above the 0.1% cutoff.

Recombinant AAV Packaging

To form rAAV, pACG2-m56, a vector derived from pACG2, with the same

modifications as pSubEagApa (deletion between 2 ApaI sites and an introduction of an

EagI site) was used to clone the directed evolution resulted capsid fragments between

34

the ApaI and EagI sites. After the second round of selection for OS156 TICs targeting,

several capsids DNA isolated from the OS lung metastases were inserted into linearized

pACG-m56 and the products were labeled as pAAV-OSLMs. When packaging rAAVs,

HEK 293 cells were co-transfected with: i) individual pAAV-OSLM; ii) pTR-UF50 which

contained the coding region of luciferase and red fluorescent reporter mApple driven by

chicken actin promoter; iii) pHelper in equimolar amounts, in a separate transfection

for each variant. Resulting rAAVs were harvested, purified and quantified as described

above, except that primers to the CBA promoter were used for titering the rAAV using

qPCR (forward: TCCCATAGTAACGCCAATAGG, reverse:

CTTGGCATATGATACACTTGATG). The representative titers of AAV vectors used in

this study are shown in Table 2-1 showing that the mutations on the AAV capsid do not

interfere with the viral packaging efficiency.

Construction of pAAV-OSLM-HD4 and pAAV-OSLM-HD15

Plasmid pIM45hep(-), containing the Rep and Cap (R585A and R588A) coding

sequences from AAV2, with expression controlled by their natural promoters [92], was

digested by NcoI (NEB, Ipswich, MA). Plasmid pAAV-OSLM-04 was also digested by

NcoI. The larger fragment of pIM45hep(-) was ligated with the smaller fragment of

pAAV-OSLM-04 using sticky end ligation. The ligation product with the correct

orientation and sequence was called pAAV-OSLM-HD4. The NcoI digested larger

fragment of pIM45hep(-) was ligated with the NcoI digested smaller fragment of pAAV-

OSLM-15. The ligation product with the correct orientation and sequence was called

pAAV-OSLM-HD15. The packaging of OSLM-HD4 and OSLM-HD15 vectors were using

standard rAAV packaging as previously described.

35

In Vitro Transduction

Cells were seeded in multi-well tissue-culture-coated plates 16hr before

transduction. Cells were mock infected or infected with rAAV vectors at a multiplicity of

infection, MOI =10,000 in serum- and antibiotic-free DMEM/F12 for 2 hrs. 48 hrs post

infection, fluorescent images were taken using an inverted fluorescence microscope,

Leica DMIL (Leica Microsystems) and a camera from QIMAGING. The cells were

subsequently lysed to detect luciferase expression (Promega) according to the

manufacturer’s instructions.

In Vivo Transduction

For characterization of OS targeting in vivo, NSG (NOD-SCID Il2rg-/-) mice were

injected subcutaneously on the ventral side between shoulder blades with 1 × 106

OS156 TICs. When the tumors reached approximately 1 cm in diameter, rAAV vectors

at 1 × 1011 vg/mouse were injected intravenously. At subsequent time post vector

injection, luciferase live imaging was taken as described below. After the final imaging,

mice were sacrificed to harvest tissues for quantifying viral genome copy number. In our

experience, from the time of vector injection to the end-point of the tumor (1.5 cm in

diameter) is no more than ten days. Therefore, most of the vector characterizations

were limited to a small period of time.

For long-term characterization of AAV2-HD and OSLM-HD4 vectors, naïve NSG

mice were intravenously injected with AAV2-HD and OSLM-HD4 vectors at 1 × 1011

vg/mouse. At day 1, day 3, week 1, week 2, month 1 and month 2 post vector injections,

luciferase live imaging was taken as described below.

36

In Vivo Imaging

At specified times post vector injection, mice were anesthetized, and D-luciferin

substrate (150mg/kg resuspended in PBS, 3ug for a 20g mouse, Caliper LifeScience,

Hopkinton, USA) was delivered intraperitoneally. Five minutes post substrate injection,

bioluminescence was measured on a Xenogen IVIS imaging system using the auto

exposure setting. The Living Image Software version 4.3 (Xenogen) was used to

analyze and quantify the signal presented as photons/second/cm2/steridian

(p/sec/cm2/sr). To quantify the transgene expression in primary OS, the tumor site was

selected as the region of interest (ROI). To quantify the transgene expression in the

mouse whole body, the whole body was selected as the ROI.

In Vivo Viral Genome Copy Number

Absolute qPCR using SYBR Green (Applied Biosystems, Grand Island, NY) was

used to quantify AAV viral genome copy number. Total DNA was extracted from various

tissues using DNeasy Blood & Tissue Kit (QIAGEN) according to the manufacturer’s

protocol. Total DNA concentration was determined using Nanodrop, and 100ng of DNA

from each sample was used as the template for qPCR. qPCR was performed on all

tissue samples and control, done in triplicate, using primers specific for the CBA

promoter (forward: TCCCATAGTAACGCCAATAGG, reverse:

CTTGGCATATGATACACTTGATG). Linearized pTR-UF50 plasmid at 100, 101, 102,

103, 104, 105, 106, 107, 108 copy numbers were used to generate a standard curve. To

calculate the relative genome copy number for each rAAV, its genome copy number in a

particular tissue was divided by its total genome copy number in lung, liver, kidney,

spleen, heart and tumor.

37

Statistical Analysis

All animal experiments were conducted with ≥ three mice per group to ensure

adequate power between groups. Results are presented as mean ± s.e.m. Differences

between groups were identified using a grouped-unpaired two-tailed distribution of

student’s T test. P values <0.05 were considered statistically significant. Error bars

depict s.e.m.

38

Table 2-1. The representative titers of AAV vectors that were used in the study.

Virus titer (vg/mL)

AAV-OSLM-02 3.24E+12





AAV2 9.71E+11

AAV8 5.29E+13

AAV-OSLM-HD4 2.18E+12

AAV-OSLM-HD15 6.31E+11

AAV2-HD 1.24E+12

39

CHAPTER 3 DIRECTED EVOLUTION IN OS USING A COMPLEX AAV CAPSID LIBRARY

Positive Selection Following Intratumoral Directed Evolution in OS

Based on the conventional concept of targeting mediated by high vector tumor

antigen interaction, we first conducted the directed evolution screening of the complex

AAV library in the OS156 xenograft by intratumoral (i.t.) injection to enrich for the AAVs

with increased interaction with OS cells. Xenografts were formed by subcutaneous

injection of OS156 TICs, a patient-derived OS cell line that forms poorly-organized,

hemorrhagic, necrotic primary tumor and spontaneous lung metastases following

xenotransplantation, recapitulating the patient tumor. Each round of selection entailed: i)

injection of the AAV library, ii) isolation of OS156 TICs from xenografts followed by

adenovirus super-infection to allow AAV replication, iii) amplification of AAV genomes

and capsid-encoding DNAs, iv) cloning and packaging of the recovered variant

genomes, and v) injection of the OS-enriched sub-library into new mice bearing OS156

xenografts (Figure 3-1). In step iv, random clones were picked for sequencing to assess

the enrichment process. The sequences were then aligned back to WT AAV2 capsid

sequence and used for calculating the probability of mutation by dividing the number of

sequences bearing mutation in a particular position by the total number of sequences

analyzed. It should be noted that the genetic diversity varies between different positions

and VRs in the starting library[90]. Therefore, we also took into account the changes of

mutation probability relative to the starting library.

Compared with the starting library, one round of i.t. screening eliminated the

AAV capsids bearing VR VIII and IX mutations (Figure 3-2 and 3-3). Meanwhile, it

lowered the mutation probability in VR IV and VII, suggesting that those regions may not

40

be beneficial for intratumoral vector delivery. To further enrich the OS specific viral

population, a second round of i.t. screening was conducted, in which the mutation

pattern was largely maintained and further enriched (Figure 3-2B and 3-4). An

independent i.v. injection was performed during the second round of enrichment, which

allowed us to isolate AAV capsids from OS156 lung metastases. Strikingly, about 75%

of the recovered AAV capsids were identical (Figure 3-5) with highly enriched mutant

motifs in VR I, V and remaining mutants in VR VII (Figure 3-2B and 3-5). Compared with

the original high genetic diversity in VR I, V and VII[90], we achieved a dramatically

decreased complexity (Figure 3-6). In the resulting motifs, since multiple mutant aas

showed predominance, they were used to calculate their probability of mutation

individually. We found that all the mutant aas were highly selected as shown by the

step-wise increase in occurrence, from low in the starting library to predominance after

selections (Figure 3-6). Thus, a positive selective pressure occurred during the i.t.

based screenings for the selection of certain mutations that improved the AAV-OS cell

interaction.

Negative Selection Following Intravenous Directed Evolution in OS Tumors and Control Selection in Mouse Lung

To study the pressures of systemic OS targeting on AAV capsids, we next

performed two rounds of intravenous (i.v.) based screenings using the same method as

the i.t. screenings. With this methodology, AAV viral particles need to travel to OS tumor

in order to infect the OS cells. In our first round of i.v. screening (Figure 3-2A), AAV

capsids with mutations in VR I to VII were recovered as previously observed but a much

lower mutation probability was found when compared to the i.t. screenings (Figure 3-2B

and 3-7). The most striking difference was in the VR VIII, in which mutation frequency

41

was strikingly increased compared to the starting library (Figure 3-2B and 3-7) and was

further increased following the second round of i.v. screening (Figure 3-2B and 3-8).

Modest enrichment of motifs in VR VIII was achieved, but the genetic diversity remained

relatively high (Figure 3-8). Additionally, we found a dramatic increase in the probability

of mutation in all of the mutated positions in VR VIII (Figure 3-9). Interestingly, in the

starting library, VR VIII showed a very low genetic diversity [90] meaning the vast

majority of the starting viral population in the library contained wild type sequences in

VR VIII (Figure 3-9). After i.v. based selections, the rare population that contained

mutations was highly selected.

VR VIII contains critical sites that allow AAV2 to bind to its primary binding

receptor, HSPG. Mutations in VR VIII lead to reduced viral infectivity in vitro and disrupt

the native viral tropism in vivo [71, 92, 93, 116, 117]. Therefore, we postulated that the i.v.

based selection to OS, a non-native tropism tissue, involved a strong negative selection

against AAV capsids with native receptor binding domain to reduce absorption of the

virus to normal tissues and to increase its freedom to move through the circulation. On

the other hand, for i.t. based screenings, there is no pressure for systemic circulation

and, therefore, VR VIII mutations had no functional benefit.

To identify the AAV variants that may transduce normal tissues and lead to

potential off-targeting expression, the full library was injected i.v. into normal mice

(Figure 3-2A). AAV variants were then isolated from mouse lung, since 90% of OS

metastases occur in the lung[97]. Interestingly, a single round of selection isolated AAV

variants bearing diverse mutations exclusively in VR VIII in a similar manner following

the i.v. based selection in OS (Figure 3-2B and 3-10). We believe this also reflected a

42

pronounced selection against the VR VIII and HSPG binding, allowing increased

trafficking to the lung relative to WT capsid.

To conclude, the i.t. and i.v. screenings identified two distinct patterns of motifs.

In the previous experiments, the enriched motifs in VR I, V and VII, derived from i.t.

screenings, were named tumor-specific motifs, while the pronounced selection against

VR VIII, derived from i.v. screenings, increased systemic trafficking.

Next Generation Sequencing of the Directed Evolution-derived AAV Genome Confirmed the Motif Patterns

To confirm the above observed motif patterns are derived from tumor selections

rather than artifacts associated with small sampling and potential cloning bias in the

Sanger sequencing experiments, next generation sequencing (NGS) was applied to

analyze the AAV capsid sequences isolated directly from the OS cells (Figure 3-1).

Limited by the short read length of the current NGS technology which cannot cover all

the VRs, targeted NGS was conducted for VR IV to VIII regions (Figure 3-1). As shown

in Figure 3-11, we confirmed the motif patterns gained from Sanger sequencing. For the

intra-tumoral directed evolution in OS, NGS data confirmed a positive selection for

mutations in VR V while VR VIII was strictly maintained wild type. Indeed, mutations in

VR VIII were extremely rare, which implied a strong positive pressure to maintain the

wild type HSPG binding domain. For intra-venous directed evolution in OS, NGS data

validated the overwhelming pressure to ablate the native receptor binding region for the

virus to reach OS tumors. Thus, the tumor-specific and systemic trafficking motifs

provide a striking paradox for both strong selections for and against the WT HSPG

binding domain.

43

Figure 3-1. Graphic representation of the directed evolution screening process. The starting AAV library was injected into animals bearing OS156 xenografts. Five days later, the animals were sacrificed to harvest the primary or the secondary tumor. The tumor tissues were dissociated and sub-cultured followed by sorting the OS156 TICs using the GFP marker. The resulting OS156 TICs were sub-cultured until 90% confluence for adenovirus super-injfection that allows AAV to replicate. Three days later, low molecular weight DNA, containing AAV genomes was isolated via Hirt’s extraction. The recovered DNA was used i) for targeted next generation sequencing of the VR IV to VIII region and ii) as the template for amplifying the AAV capsid region that was cloned into a vector to reconstitute the full-length AAV genome. The cloned products were transformed and sent for Sanger sequencing the capsid sequence. The transformation products were also used for DNA preparation for packaging the enriched AAV library that was used for the subsequent round of screening.

44

Figure 3-2. The selection of AAV capsid variants for OS targeting and the resulting AAV variants identified by Sanger sequencing. A) Schematic outline of the directed evolution strategy. Xenografts were generated by subcutaneous injection of OS156 TICs. The injection method for AAV capsid library and the tissue from which AAV variants were isolated are shown. 1) 1° intra-tumor, 2) 1° intra-tumoral 2° intra-tumoral, 3) 1° intra-tumoral 2° intra-venous, 4) 1° intra-venous, 5) 1° intra-venous 2° intra-venous, 6) control selection 1° intra-venous. N=2 for each selection step. B) Sanger sequencing analysis of AAV variants after each selection step shown by the probability of mutation enrichment in which 0 indicates wild type sequences were preferred and 1 indicates mutation was preferred. The VR number, amino acid number and WT AAV2 capsid sequence are shown on the top. As a reference, the probability of mutation in the starting library is also shown. Intratumoral injection (i.t.). Intravenous injection (i.v.)

45

Figure 3-3. Capsid sequences of AAV variants isolated from round I OS156 primary

tumor following i.t. injection of AAV library. VR number (all eight VRs which contains potential mutations), amino acid number and WT AAV2 capsid sequence are on the top. In the sequence section, gray is wild type, red indicates mutation, and enriched motifs are grouped by black boxes.

46

Figure 3-4. Capsid sequences of AAV variants isolated from round II OS156 primary tumor following i.t. injection. VR number (all eight VRs which contains potential mutations), amino acid number and WT AAV2 capsid sequence are on the top. In the sequence section, gray is wild type, red indicates mutation, and enriched motifs are grouped by black boxes.

47

Figure 3-5. Capsid sequences of AAV variants isolated from round II OS156 lung metastases following i.v. injection. VR number (all eight VRs which contains potential mutations), amino acid number and WT AAV2 capsid sequence are on the top. In the sequence section, gray is wild type, red indicates mutation, and enriched motifs are grouped by black boxes.

48

Figure 3-6. The enriched motifs in VR I, V and VII and the differences in probability of mutation after i.t. based screenings in OS156 model. VR number, amino acid number and sequence alignment are on the top. The changing in probability of a specific mutation after selection compared with its occurrence in the starting library is shown in the bottom. For a particular position, if there is a predominant mutant in the sequence alignment shown as green in the upper section, then this AA was used to calculate the probability of mutation. If wild type AA is predominant in the particular position shown as black in the upper section, all mutants were counted together to calculate the probabilities of mutation.

49

Figure 3-7. Capsid sequences of AAV variants isolated from round I OS156 primary tumor following i.v. injection of AAV library. VR number (all eight VRs which contains potential mutations), amino acid number and WT AAV2 capsid sequence are on the top. The VRs where i.t. based OS156 screenings enrich are underlined in red. The VR where enriched mouse lung is underlined in blue. In the sequence section, gray is wild type sequence, red indicates mutation. Enriched motifs are grouped by boxes where black boxes indicate motifs shared between 1st and 2nd round i.v. based screening in OS156 and blue boxes indicate motifs shared between i.t. and i.v. based screenings. Motifs less enriched but are shared between the results of different screenings are underlined.

50

Figure 3-8. Capsid sequences of AAV variants isolated from round II OS156 primary tumor following i.v. injection. VR number, amino acid number and WT AAV2 capsid sequence are on the top. The VRs where i.t. based OS156 screenings enrich are underlined in red. The VR where mouse lung enriches is underlined in blue. In the sequence section, gray is wild type sequence, red indicates mutation. Enriched motifs shared between 1st and 2nd round i.v. based screenings in OS156 are grouped by black boxes. Motifs less enriched but are shared between the results of different screenings are underlined.

51

Figure 3-9. The VR VIII sequence alignment and the changes of probability of mutation after i.v. based screenings in OS156 model. In the upper section, the VR VIII sequence alignment of the starting AAV library, reported by Marsic et al., is shown. In the middle section, the VR VIII sequence alignment of AAV variants isolated in round II OS156 primary tumor following i.v. injection is shown. Red indicates mutation and black indicates wild type. In the lower section, the probability of mutation for each aa and their changes of probability compared with the starting library is shown.

52

Figure 3-10. Capsid sequences of AAV variants isolated from mouse lung following i.v. injection. VR number, amino acid number and WT AAV2 capsid sequence are on the top. The VRs where OS156 enriches following i.t. injection are underlined in red. In the sequence section, gray is wild type sequence; red indicates mutation.

53

Figure 3-11. The selection of AAV capsid variants for OS targeting and the resulting AAV variants identified by next generation sequencing. A) Schematic outline of the directed evolution strategy. Xenografts were generated by subcutaneous injection of OS156 TICs. The injection method for AAV capsid library and the tissue from which AAV variants were isolated are shown. 1) 1° intra-tumor, 2) 1° intra-tumoral 2° intra-tumoral, 3) 1° intra-tumoral 2° intra-venous, 4) 1° intra-venous, 5) 1° intra-venous 2° intra-venous, 6) control selection 1° intra-venous. N=2 for each selection step. B) Next generation sequencing analysis of AAV variants after each selection step shown by the probability of mutation enrichment. 0 indicates wild type sequences were preferred and 1 indicated mutation was preferred. The VR number, amino acid number and WT AAV2 capsid sequence are shown on the top. As a reference, the probability of mutation in the starting library is also shown. Intratumoral injection (i.t.). Intravenous injection (i.v.)

54

CHAPTER 4 CHARACTERIZATION FOR DIRECTED EVOLUTION DERIVED MOTIFS FOR OS

TARGETING

AAVs with Tumor-specific Motifs Mediate Efficient OS Transduction In Vitro but not In Vivo Following Systemic Administration

Next, the role of AAV-OS cell interaction for specific and efficient OS transduction

was explored by testing AAV capsids with tumor-specific motifs for their transduction

efficiency. The capsid variants isolated from OS lung metastases OSLM variants

(Figure 3-2 A), were chosen for the following reasons: i) They have different sequences

from the capsids isolated from normal lung, and ii) Their mutations are highly enriched

consensus motifs (Figure 3-6). Based on the clones subjected for Sanger sequencing,

all of the distinct capsids (Figure 4-1 A) were used to package a reporter construct that

contains a firefly luciferase and a mApple fluorescent protein under the control of CMV

enhancer/chicken-beta actin hybrid promoter (CBAp). In comparison to AAV2, all of the

OSLM variants mediated significantly increased transgene expression of OS156 TICs in

vitro, as indicated by both fluorescent (Figure 4-1 B) and luciferase (Figure 4-1 C)

activity. This indicated that i.t. based selection led to functional changes in the WT

AAV2 capsid. However, when the same viral vectors were delivered i.v. into OS156

tumor bearing mice in vivo, limited transgene expression was detected in the tumors

(Figure 4-1 D and E). Interestingly, OSLM-15, which showed the highest transduction in

vitro, correlated well with its high enrichment from two rounds of i.t. screenings (Figure

4-1 A, 2° i.t. occurrence and 3-4). However, transgene expression in tumors in vivo

following systemic delivery was not significantly improved. Another variant, OSLM-04,

the predominant clone in the second round of i.v. screening (Figure 4-1 A, 2° i.v.

occurrence and 3-5) likewise demonstrated inefficient but significantly higher

55

transduction in vivo (Figure 4-1 E). These results indicated that selection for higher AAV

OS interaction via i.t. injection meaningfully increased the viral infection in vitro but not

in vivo. Thus, tumor-specific motifs on the AAV capsid selected by i.t. selection are not

sufficient to mediate productive in vivo transduction through tail-vein injection.

Increased Systemic Trafficking in OSLM Variants Led to Specific and Efficient OS Transduction In Vivo

Considering the distinct motif patterns between the i.t. and i.v. based screenings

(Figure 3-2B and 3-11), we hypothesized that the poor in vivo efficiency for OSLM

variants was due to presence of the WT AAV binding domain, specifically the absence

of VR VIII mutations in this region. Due to the lack of a consensus variant motif in VR

VIII, we focused on R585 and R588, the two positions essential for maintenance of

native HSPG binding and tropism [71, 92, 93, 116, 117]. Interestingly, in our VR VIII alignment

for OS screenings, AAs R585 and R588 were dominant in the starting library and

completely lost after two rounds of screenings (Figure 3-9), suggesting mutations in

those two positions are important for OS targeting.

To this end, mutation of the arginines at 585 and 588 positions to alanines

(R585A and R588A) were introduced into the wild-type AAV2 capsid, as well as the

capsids of OSLM-04 (the best variant in vivo) and OSLM-15 (the best variant in vitro).

The resulting capsids were termed AAV2-HD, OSLM-HD4, and OSLM-HD15,

respectively (Figure 4-2 A). As expected, R585A and R588A abolished the in vitro

transduction of OS156 TICs (Figure 4-2 B). Remarkably, in vivo, both AAV2-HD and

OSLM-HD4 showed productive transgene expression as early as day 1 post

administration, hundreds of folds higher than their parental capsids AAV2 and OSLM-

04, respectively (Figure 4-2 C and D). Improved OS transduction was also observed

56

with the OSLM-HD15 vector but transduction was lower in efficiency than AAV2-HD and

OSLM-HD4, indicating the different combination of tumor-specific and systemic

trafficking motifs negatively affected the OS transduction efficiency (Figure 4-2 C and

D). At day 7 post-viral injection, the typical liver transduction was detected in AAV2

(Figure 4-2 C). In contrast, AAV2-HD showed wide-spread transduction across the body

(Figure 4-2 C), similar to the cardiac [93, 116, 118], skeletal muscle[116, 118], and lung[116]

transduction reported by others. At the same time, OSLM-HD4 showed highly specific

expression in OS (Figure 4-2 C).

To confirm the specificity observed in OSLM-HD4, we injected the same amount

of AAV2-HD and OSLM-HD4 vectors into naive mice without tumors. This allowed us to

observe transgene expression in the whole body over two months, long enough to

observe the kinetics of the AAV transduction over time [119]. OSLM-HD4 showed

significantly lower transgene expression than AAV2-HD in naive mice by whole body

quantification (Figure 4-2 E and F). Additionally, in this experiment, we further confirmed

that the native viral tropism was disrupted in both AAV2-HD and OSLM-HD4 (Figure 4-2

E). In summary, the systemic trafficking motif, represented by R585A and R588A

mutations, gave rise to a rapid onset of transgene expression, and dramatically

increased the OS transduction efficiency in vivo. Furthermore, combining tumor specific

and systemic trafficking motifs helped restrict the transgene expression to OS.

Elimination of WT HSPG Binding Domain Played a Critical Role in Altering the Endogenous Tropism and Increasing the AAV Genome Accessibility to OS

Next, we wanted study the impact of tumor specific and systemic trafficking

motifs on viral genome distribution by quantifying genome copy number (GCN). Thus,

major organs including lung, liver, kidney, spleen, and heart, as well as the tumor, were

57

harvested from the viral-injected OS156 tumor-bearing animals. Apart from the absolute

GCN, the biodistriubtion was also shown by the relative GCN which was calculated by

dividing absolute GCN in a particular tissue by the total GCN in all six tissues.

Compared to the wild-type AAV2, the viral capsids containing tumor-specific motifs

alone (OSLM-04 and OSLM-15) hardly changed the native AAV2 tropism (Figure 4-3).

Most importantly, the majority of their genomes (around 75%) were not in the tumor

(Figure 4-3). Therefore, the tumor-specific motifs derived from i.t. screenings were not

beneficial for changing the systemic tropism which explained their low efficiency of OS

transduction in vivo (Figure 4-1 D and E).

The difference between AAV2 and AAV2-HD revealed the role of the elimination

of WT HSPG binding domain. It was evident that AAV2-HD showed not only decreased

native AAV2 tropism but also dramatically higher tumor GCN (Figure 4-3). To evaluate

the effect of combined tumor specific and systemic trafficking motifs, the results of

OSLM-HD4, OSLM-HD15 were further analyzed. The biodistribution of OSLM-HD4 and

OSLM-HD15 were much closer to that of AAV2-HD, but not to other parental capsids.

The absolute GCN in tumor correlated with the transgene expression (AAV2-HD >

OSLM-HD4 > OSLM-HD15) (Figure 4-3). Relatively, 75% or more of AAV-HD and

OSLM-HD4’s genomes were in the tumors (Figure 4-3). Therefore, vector accessibility

to the tumor is critical for high tumor transduction. Overall, we found the systemic

trafficking motif plays a critical role in reducing the native AAV2 tropism which

potentiated higher accessibility of AAV to the tumor.

58

Both Selected Motifs and Permissive Tumor Biology Facilitated Higher AAV Transduction

An important question in the directed evolution is whether the evolved entities

can demonstrate improved function in a condition that is different from the original

selection pressure. To test it, we used another, patient-derived OS cell line,

OS521TICs, to evaluate the transduction efficiency of the various AAV capsid variants

isolated from the OS156 based directed evolution. Compared with OS156 TICs-derived

xenografts, OS521 TICs-derived xenografts are less metastatic and forms primary

tumors that are well-vascularized, uniform and highly cellular.

To determine the transduction efficiency of our novel AAV capsids in OS521

TICs in vitro, OS521 TICs were infected with OSLM variants and AAV2. Notably,

several OSLM variants and AAV2 mediated significantly higher transgene expression in

the OS521 TICs than those in the OS156 TICs (Figure 4-4 A and B) indicating OS521

TICs are more permissive for AAV infection in vitro.

Next, we asked whether our novel AAV capsids could transduce OS521 more

efficiently in vivo. To this end, AAV2-HD and OSLM-HD4, the two most efficient variants

for OS156 xenograft, were delivered i.v. into OS521 tumor-bearing animals. The wild

type AAV2 capsid was used as an appropriate control. In OS521, both AAV2-HD and

OSLM-HD4 demonstrated several hundred folds higher transgene expression than

AAV2 (Figure 4-4 C and D). For all the three vectors, the transgene expression was

significantly higher than those in the OS156 xenografts (Figure 4-4 D). Therefore, the

OS521 xenograft is also more permissive for AAV infection in vivo.

Then, we studied the viral biodistribution in OS521 xenograft. Both AAV2-HD and

OSLM-HD4 vectors disrupted the native AAV2 genome biodistribution and increased

59

genome accessibility to the OS521 tumor (Figure 4-4 E). Interestingly, none of the three

vectors mediated higher absolute and relative GCN in OS521 than OS156 xenografts

(Figure 4-3 and 4-4 E).Therefore, in addition to the properties of the vectors and their

increased accessibility to the tumor, the more AAV permissive tumor biology of OS521

facilitated higher AAV-mediated transgene expression.

60

Figure 4-1. AAV capsid variants with tumor specific motifs (VR I, V and VII) mediate efficient OS transduction in vitro but not in vivo following systemic delivery. A) AAV capsid variants selected for functional characterization. The occurrence of each capsid in second round of selection (both i.t. and i.v. injection) is shown on the left. Gray is wild type sequence; red indicates mutation. OSLM: osteosarcoma lung metastases variant. B) Representative images showing mApple expression following transduction of OS156 TICs with OSLM variants in vitro. C) Luciferase expression in OS156 TICs transduced with OSLM variants. MOI = 10,000, n=3. RLU: relative light unit. D) Representative in vivo luciferase imaging of OSLM variants in OS156 tumor-bearing NSG mice following i.v. delivery. Images were taken at day 3 post injection. n=3. E) Luciferase quantification of OSLM variants in OS. Mock is uninfected control. AAV2 is wild type capsid control. Data are reported as mean ± s.e.m.

61

Figure 4-2. The combination of tumor-specific and systemic trafficking motifs lead to efficient and specific OS transduction. A) The incorporation of systemic trafficking motif into WT AAV2 (AAV2-HD), OSLM-04 (OSLM-HD4) and OSLM-15 (OSLM-HD15) capsids. Gray is wild type sequence; red indicates mutation. B) Representative images showing mApple expression following transduction of OS156 TICs with AAV2, OSLM-04, OSLM-15, AAV2-HD, OSLM-HD4 and OSLM-HD15 vectors in vitro. MOI = 10,000, n=3. C) Representative in vivo luciferase imaging of AAV2 (n=8), OSLM-04 (n=6), OSLM-15 (n=3), AAV2-HD (n=8), HD4 (n=15) and OSLM-HD15 (n=3) vectors in OS156 tumor-bearing NSG mice following i.v. delivery. The time at which the images were taken are listed. D) Luciferase quantification of AAV2, OSLM-04, OSLM-15, AAV2-HD, OSLM-HD4 and OSLM-HD15 vectors in OS.

62

E) Representative in vivo luciferase images showing transduction of naïve NSG mice (no OS) with AAV2-HD (n=4) and OSLM-HD4 (n=4) following i.v. delivery. Images were taken at day 1, day 3, week 1, week 2, month 1 and month 2 post vector administrations. F) Luciferase quantification in the mouse whole body of AAV2-HD and OSLM-HD4 injected naïve mice. RLU: relative light unit. Data are reported as mean ± s.e.m.

63

Figure 4-3. The tumor-specific and systemic trafficking motifs contribute to reduced native AAV tropism and increased GCN in the tumor. OS156 tumor-bearing NSG mice were transduced by AAV2, OSLM-04, OSLM-15, AAV2-HD, OSLM-HD4 and OSLM-HD15 vectors following i.v. injection. At day 7 post injection, lung, liver, kidney, spleen, heart and tumor were harvested to detect the vector genome copy number in each tissue, n=3-5. The absolute GCN is shown in the left and the relative GCN is shown in the right. The relative GCN was calculated by dividing the absolute GCN in a particular tissue by the total GCN in the six tissues to normalize the impact of different capsid mutations on the absolute biodistribution.

64

Figure 4-4. OS521 is more permissive for AAV infection than OS156 both in vitro and in vivo. A) Representative images showing mApple expression following transduction of OS521 TICs with OSLM variants in vitro. MOI = 10,000, n=3. B) Luciferase expression in OS521 TICs transduced with OSLM variants and its comparison to that in OS156 TICs. MOI = 10,000, n=3. RLU: relative light unit. C) Representative in vivo luciferase imaging of AAV2 (n=3), AAV2-HD (n=3), and OSLM-HD4 (n=3) vectors in OS521 tumor-bearing NSG mice following i.v. delivery. D) Luciferase quantification of AAV2, AAV2-HD and OSLM-HD4 vectors in OS521 xenografts and its comparison to that in OS156 xenografts. E) At day 7 post injection, lung, liver, kidney, spleen, heart and tumor were harvested from OS521 tumor-bearing mice injected with AAV2, AAV2-HD and OSLM-HD4 to detect the absolute and calculate relative GCNs, n=3-5. Mock is uninfected control. AAV2 is wild type capsid control. Data are reported as mean ± s.e.m.

65

CHAPTER 5 DISCUSSION

How to Engineer the AAV Vector for Tumor Targeting

Traditionally, the design of AAV vectors for tumor targeting has focused on the

ability of the vector to recognize tumor specific surface molecules. In contrast, we

reported that AAV variants selected for increased tumor cell interaction did not

contribute to tumor-specific localization following i.v. injection. In addition, we found that

the pressure necessary for systemically reaching the cancer cell involves changing the

viral native tropism and is not dependent on specific recognition of tumor cell. Based on

those findings, we believe it is necessary to rethink the traditional vector design. A

working model was generated to illustrate the critical AAs and motifs on the AAV capsid

that function to overcome the barriers during the AAV-mediated systemic tumor

targeting (Figure 5-1).

First, the primary HSPG binding domain must be inactivated to enable systemic

trafficking to the tumor (Figure. 5-1). This includes escaping from native tropism,

reducing transduction in non-targeted tissues, and obtaining access to the target cells.

The wild-type AAV and the AAV capsids with tumor specific and systemic trafficking

motif alone were unable to overcome all three barriers, and were therefore lacking in

specificity and efficiency. Higher AAV localization in tumors is achieved by employing an

i.v. motif which largely changes the biodistribution and allow higher AAV accessibility to

tumor, but not AAV tumor cell interaction. Combining i.t. and i.v. motifs contributes to

lower off-targeting expression.

Second, once reaching the tumor cell, AAV tumor cell interaction will occur. Our

data showed that the tumor cell permissiveness plays a critical role in transduction

66

efficiency (OS521> OS156). In addition, we observed rapid and efficient AAV-mediated

tumor transduction which we propose is due to the permissive environment in the tumor

(Figure 5-1). This environment includes a thin, leaky vasculature for AAV to escape

from the circulation, abundant glycans are expressed by many tumors [120] that are used

by AAV to bind to cells[121], high endocytotic activity increases internalization without

secondary receptor or co-receptors [122], increased intracellular trafficking of AAV from

stress [110], elevated metabolism, DNA synthesis enzymes, transcription and translation

machinery [123] for the transgene expression (Figure 5-1).

Successful solid tumor targeting by AAV requires knowledge in two critical in vivo

processes. First, the AAV needs to be transported to the tumor site following i.v.

delivery. This involves blood circulation, extravasation, crossing the barriers of the

extracellular matrix, preventing the elimination from tumor tissue, and then interaction

with tumor cells[124, 125]. Second, once reaching the tumor cells, the AAV must interact

with tumor cells more effectively. This includes attachment of the virus to the cell,

endocytosis, intracellular trafficking, entry into the nucleus, uncoating the capsid and

then transgene expression [110]. For AAV, we have greater understanding of the second

step but much less is known concerning the first one. However, our results clearly show

that systemic trafficking is critical to the tumor transduction.

What Have We Learned from our Directed Evolution Experiments

With regard to directed evolution, this is the first study to compare the differential

pressure for tumor screening when the route of delivery is local (i.t. injection) or

systemic (i.v. injection). We showed that the pressure involved in the i.t. screenings

select against the AAV variants that were capable of getting to the tumor systemically.

The pressure involved in the i.v. screenings identified a functional motif to allow AAV

67

access to tumor followed by incorporating motifs isolated from i.t. screenings to improve

specificity. Therefore, the vectors should first evolve to get to the tumor and then evolve

to specifically express in the tumor.

An important reason for selection for wild type VR VIII during i.t. based

screenings and mutant VR VIII during i.v. based screening is the increased expression

of HSPG in the OS156 TICs than OS156 non-TICs (Figure 5-2). For i.t. screening, the

AAV variants can directly interact with the excess amount of HSPG in the OS156

xenograft. Thus, it positively selects for the variants with native receptor binding,

solidifying its conservation. VR VIII mutations were selected against during the first

round and were not in the pool to enable positive selection in subsequent rounds. On

the other hand, for the i.v. screening, there is a strong pressure to change the native

tropism to reach OS before infection which negatively select against wild type VR VIII.

Thus, the i.v. screening strongly selected against capsids with the WT VR VIII binding

domain.

Combinatorial mutations were created in VR VIII together with other VRs. But

variability in this region was selected against during packaging [90]. Considering this,

screening the library by both i.t. and i.v. approaches independently allowed the

identification of AAs and motifs in the AAV capsid that are important for systemic

trafficking and tumor-directed transduction. Considering the stepwise evolution process,

it would be interesting to construct a similar library starting with the R585A and R588A

capsid sequence. In this manner, to build subsequent libraries as functional motifs are

identified until a fully optimized capsid is derived.

68

A hallmark of (directed) evolution is that the improvement of one property is

usually accompanied by loss of another. It should be mentioned that AAV2-HD is more

efficient, but less specific when compared with OSLM-HD4 (Figure 4-2 C and D).

Therefore, the improvement in the specificity is at the expense of efficiency.

Tumor Targeting In Vivo is Different from that In Vitro

Also, it is important to point out that the results gained from cells in vitro do not

apply to those gained from animals in vivo. Firstly, the OSLM variants demonstrated

higher transduction than AAV2 in vitro, but did not give rise to enhanced expression in

vivo (Figure. 4-1 B and D). Secondly, AAV2-HD, OSLM-HD4, and OSLM-HD15, which

showed hundreds of fold increase in OS transduction in vivo, demonstrated very low

transduction efficiency in vitro (Figure 4-2 B and C).

OSLM-HD4 vs OSLM-HD15

An interesting trend was observed for OS transduction in vivo (OSLM-04 was

more efficient OSLM-15, OSLM-HD4 was more efficient OSLM-HD15). Those two sets

of vectors differ in only four AAs that are surface exposed in VR V, positioning in 491

and 503 (mutated in OSLM-04 and OSLM-HD4) and in 492 and 499 (mutated in OSLM-

15 and OSLM-HD15). Mutation in 491 has been shown to increase the transduction

efficiency of AAV2[126]. Position 503 plays an important role in AAV4 to bind to sialic

acid[127], in AAV9 to bind galactose[128, 129] and plays a role in de-targeting AAV9 from

liver to heart and skeletal muscle[130]. These may contribute to the differences in

transduction efficiency. Both sets of vectors share the same Q263E and S264A

mutations in VR I. Since OSLM-02, which contains only Q263E and S264A mutations,

failed to mediate significantly higher OS transduction in vivo, those two mutations are

less likely to contribute to the differential transduction.

69

Potential Factors That Contribute to the Higher Permissiveness in OS521 TICs

To study the potential factors contribute to the higher permissiveness in OS521

TICs than OS156 TICs, we explored the factors known to contribute to higher

transduction by AAV vectors. Firstly, we compared the expression of AAV cell surface

receptor and co-receptor molecules in both OS521 TICs and OS156 TICs. We

examined the AAV2’s receptor HSPG (the primary binding molecule) [71] and integrins

β1 subunit and αVβ5 (two co-receptors involved in virus internalization) [131, 132]. HSPG

and integrin αVβ5 expression were similar between OS521 TICs and OS156 TICs

(Figure 5-3A and 5-3C). On the other hand, integrin β1 subunit was found to be

considerably higher on OS521 TICs than OS156 TICs (Figure 5-3B). Thus, it is possible

that AAV enters more efficiently into the OS521 TICs than OS156 TICs cells through

integrin β1 dependent mechanism.

Following attachment to cell surface receptors and co-receptors, AAV

internalization occurs mainly through endocytosis [110]. Next, we compared the cellular

trafficking pathways including endocytosis and lysosomal pathways between OS521

and OS156 TICs. Though independent studies in our lab, we generated microarray data

which compared the differentially expressed genes between OS521 and OS156 TICs.

We found higher transcription of genes associated with endocytosis (Figure 5-4) and

lysosomal pathway (Figure 5-5) in the OS521 TICs than OS156 TICs. This suggests

that the intracellular trafficking of AAV may be more efficient in OS521 TICs than OS156

TICs.

AAVs take advantage of the subcellular stress pathways such as endoplasmic

reticulum (ER) stress/ misfolded protein response [133], heat shock [134], and cell redox

status [135], for its higher gene expression. Malignant cells are prone to protein mis-

70

folding and ER stress as a result of relative nutrient deprivation and dysregulation of

protein synthesis [136]. We suggest that the ER stress/ misfolded protein response

contributes to the rapid on-set as well as efficient transgene expression observed in

both OS156 and OS521 in vivo. It may also play a role in the relatively higher AAV

transduction in OS521 than OS156 in vivo.

Taken together, OS521 TICs express higher amounts of co-receptor of AAV2,

integrin β1, which might help AAV internalize more efficiently into the cells. After

entering, the upregulated endocytosis and lysosomal activity in OS521 TICs might

facilitate a more efficient intracellular trafficking of AAV. Also, the ER stress in the

malignant cells plays an important role for the rapid on-set as well as efficient transgene

expression. Therefore, the permissive biology of OS521 TICs likely facilitates the higher

transgene expression following AAV infection.

In conclusion, further studies are evidently needed to study the multi-dimensional

complexity that is involved in the process of tumor-targeted AAV delivery. Our study

showed that the targeting is not only dependent on AAV tumor cell interaction but also,

and more importantly, depending on the accessibility of AAV to the tumor cells. Future

AAV vector design should take both into account for tumor directed gene transfer.

71

Figure 5-1. Schematic model of AAV-mediated systemic OS targeting. First, AAV needs to systemically traffic to the tumor which include escaping from its native tissue tropism, reducing off-targeting transduction and getting accessible to the target cells. During this process, both systemic trafficking and tumor specific motifs play important roles. Lacking in either type of motif contributes to low efficiency and/or specificity. Once the AAV reaches the tumor tissue, AAV needs to interact effectively with the tumor cell. Here, in contrast to normal tissue, the tumor biology provides a permissive environment that allows rapid onset of expression and efficient expression. The environment includes aberrant and leaky vasculature, high glycan and their associated trafficking for AAV to bind to and internalize into the tumor cells, high endocytosis and endosomal trafficking for intracellular trafficking of AAV, enlarged nucleolus, increased DNA synthesis and metabolic activity, high transcription and translation machinery for efficient second-strand synthesis of the AAV genome and transgene expression.

72

Figure 5-2. Comparison of heparan sulfate proteoglycan pathway between OS156 TICs

and OS156 non-TICs. Red stars indicates genes in the heparan sulfate proteoglycan pathway that show more transcription in OS156 TICs than OS156 non-TICs, p= 0.001, analyzed by NIH DAVID Bioinformatics Resources 6.7.

73

Figure 5-3. Expression profile of AAV2’s receptor and co-receptor on the cell surface of

OS521 and OS156 TIC. OS521 TICs and OS156 TICs were either unstained or stained with A) anti-HSPG antibody, B) anti-β1 integrin subunit, and C) anti- αVβ5, then those cells were subjected to flow cytometry analysis.

74

Figure 5-4. Analysis of endocytosis pathway in the OS521 and OS156 TICs. Red stars

indicates genes in the endocytosis pathway that show more transcription in OS521 TICs than OS156 TICs, p= 0.001, analyzed by NIH DAVID Bioinformatics Resources 6.7.

75

Figure 5-5. Analysis of lysosomal pathway in the OS521 and OS156 TICs. Red stars

indicates genes in the lysosomal pathway that show more transcription in OS521TICs than OS156 TICs, p= 0.001, analyzed by NIH DAVID Bioinformatics Resources 6.7.

76

CHAPTER 6 FUTURE WORKS

Our long-term goal is to develop novel gene based therapies for OS, and

possibly, for other cancers. In this chapter, I will discuss areas that might be explored in

the future. First, we aim to test whether our novel AAV capsids can target other types of

cancer. Second, we aim to analyze the immune response against AAV-OSLM variants.

And finally, we will discuss the potential gene therapy for OS.

AAV Mediated Transduction of Canine OS Cells In Vivo

Considering the translation of our findings, canine OS serves as a good large

animal immune competent model used for further study. Dogs spontaneously develop

OS which is histologically and molecularly indistinguishable from human OS [97, 137]. One

of our future plans is to test the safety and efficacy of gene therapies in canine OS

model.

Due to the high cost, less reproducible neoplasia between different dogs and

longer experimental period, the canine OS model is usually used in translational studies

following promising outcomes in small rodent models. At the current stage, for pilot

experiments, we propose to use mouse model generated by xenotransplantation of

canine OS cells.

AAV-OSLM-HD4 Showed Rapid and Efficient Transduction for Huh7 Tumor In Vivo

We have shown that OSLM-HD4 can be used for heterogeneous OS tumors

(Chapter 4). In order to apply our novel AAV-mediated targeting platform to cancer in

general, we asked whether OSLM-HD4 could be used for targeting other types of

cancer. Our lab has productive collaborations with Dr. Arun Srivastava who is

pioneering in AAV vector technology and its use for human liver cancer. We first tested

77

whether OSLM-HD4 can be used for targeting hepatocellular carcinoma (HCC) using a

xenograft model based on Huh7 cell line [138]. A standard dose, 1X1011 vg/mouse of

OSLM-HD4 vector was injected through the tail vein of animals bearing Huh7 tumor. At

day 1 and day 3 post injection, the luciferase live imaging was taken to observe the

level and the kinetics of transgene expression. As shown in Figure 6-1 A, positive

luciferase expression was detected selectively at the tumor site indicating the

successful application of OSLM-HD4 vector for targeting Huh7 xenograft. We then

compared the efficiency of transgene expression between OS156 and Huh7 (Figure 6-1

B). At day 1 post injection, the OSLM-HD4 mediated expression in Huh7 tumor was

lower than that of OS156 (Figure 6-1B). At day 3 post injection, both OS156 and Huh7

showed increased AAV-mediated transgene expression. Noticeably, the transgene

expression in Huh7 showed a dramatic increase between day 3 and day 1. At day 3

post vector administration, Huh7 showed higher transgene expression than OS156 did

(Figure 6-1B). Therefore, the kinetics of AAV-mediated transgene expression depends

on the biology of different tumors.

Dr. Srivastava’s group has reported the use of AAV3 based vector for targeting

HCC [138, 139]. OSLM-HD4 showed comparable transduction efficiency as their optimized

AAV3 vector (S663V+T492V) [138].

Overall, we concluded that OSLM-HD4 can be used to specifically and efficiently

target Huh7 based HCC xenograft model which extends the application of OSLM-HD4

based gene transfer to tumors of both mesenchymal and epithelial origins.

Building from these studies, we would like to explore potential AAV-mediated

gene therapy for other types of cancer. Also, considering all the current tested cancer

78

models are based on xenotransplantation of tumor cells into immuno-deficient mouse

background, we are looking forward to working with immune-competent cancer models

including OS and other cancers as well. This will allow us to have more understanding

of how the AAV based gene delivery technique can be applied to cancer therapy in

general.

The Immune Response against AAV-OSLM Variants

For the realization of AAV based systemic therapy for patient care and treatment

of OS, attention should be drawn to immune response against AAV capsid including

humoral response and cytotoxic T cell response.

In this part, we attempt to discuss the question whether our novel AAVs can

evade the immune response from human, while retaining OS targeting at high

efficiency. The AAV-OSLMs, the AAV2 based variants, were generated in mice which

have not been exposed to AAV before. And therefore, it is not expected that the AAV-

OSLMs can escape the neutralization from pre-existing immunity against AAV2 or other

wild type AAVs. In addition, all the experiments were based on immune-compromised

animal which is lack in T cell, B cell and NK cell responses. In this situation, we can

hardly predict the potential adaptive response against the AAV capsid and/or the

transgene product. Therefore, future works can be done for studying the immunological

aspects of AAV-OSLMs, especially OSLM-HD4, to explore how the novel vector system

we developed can be used into the clinic.

The Humoral Response against AAV-OSLM Variants

Serologic studies have shown that majority of the human population has

neutralizing antibody (NAB) to wild type AAVs including both healthy volunteers [140-142]

and patients [143, 144], with the most reactivity against AAV2. The previous exposure can

79

significantly limit the AAV mediated gene transfer [145-148]. For example, very low levels

of AAV NABs can profoundly reduce liver directed gene transfer following i.v. injection

[149, 150]. Consequently, for diseases where the target tissue is not immune privileged

tissues (eye and brain), patients with pre-existing AAV antibody were excluded from

participation in gene delivery clinical trials [50, 51]. The serologic study of AAV antibody

level in OS patient has not been done yet. It is very interesting as well as important to

test it in the future. Building from the serologic study, we can further work on the

protocols for the potential AAV gene therapy trial for OS patients.

The VR regions are known to be critical for the antibody interaction with the AAV

capsid, reviewed by Tseng et al. [151]. To this end, the original design of the VR modified

AAV libraries were based on the understanding of AAV biology including the antigenic

epitopes. Therefore, it is possible that the mutations on the AAV-OSLM capsids may

alter their immunogenic profile when compared with wild type AAV2. In the next three

paragraphs, we will discuss the current knowledge of amino acids on VR I, V and VII for

anti-AAV antibody response.

All of the AAV-OSLMs contain mutations Q263E and S264A in VR I. S264 and

G265 in VR I are among the residues conferring resistance to human IVIG

neutralization [152]. Antibody A20, specific for AAV2 and AAV3, binds residues 263 and

264 in VR I [152-154]. The antigenic footprint of antibody 3C5 of AAV5 also include VR I

[155].

Several AAV-OSLM variants contain VR V mutations. The amino acids in the VR

V region are involved in antibody recognition [155]. For example, Maheshri et al. have

shown that residue 493 in VR V confer resistance to polyclonal rabbit anti-AAV2 serum

80

[82]. Lochrie and colleagues also come to the conclusion that multiple residues in VR V

facilitate the escaping from human IVIG neutralization [152]. Efforts to the search MAB

epitopes of AAVs also confer VR V. This includes proposed epitopes for 4E4 and 5H7

of AAV1 (492-498 and 494,496-499, respectively) [155], C37-B of AAV2 (493-502) [153].

OSLM-03 and OSLM-11 contain VR VII mutations. Capsid 551 mutation located

in VR VII is one of the most frequently reported amino acid for polyclonal antibody

neutralization escape [152, 156]. In addition, VR VII is associated with binding and

neutralization by MAB of AAVs which includes A20 of AAV2 [154] and 3C5 of AAV5 [155].

Since all the three VRs are involved in antibody recognition, we asked whether

the AAV-OSLM variants have altered response to the NAB against AAV2 capsid. Serum

isolated from rats that were pre-injected with AAV2 vector was used in this study. We

found that OSLM-03 and OSLM-11 capsids (both contain mutations in VR I, V and VII)

have an altered neutralizing titer but not escaping the inhibition by neutralizing antibody

(Figure 6-2). The AAV2 shows a neutralizing titer of 1:8192 while that of OSLM-03 and

OSLM-11 are both at 1:2048 (Figure 6-2) meaning more serum is necessary to

neutralize OSLM-03 and OSLM-11 capsids. The other AAV-OSLMs, although

containing mutations conferring resistance to neutralization, do not have changes in

neutralizing titer (Figure 6-2). Due to the lack of infectivity of OSLM-HD4 in vitro, we

cannot determine the neutralizing titer of OSLM-HD4 and therefore whether OSLM-HD4

can escape the neutralizing remains to be tested. Cells permissive to OSLM-HD4

infection will be helpful in studying the neutralizing titer of OSLM-HD4. For future

experiments, we will test the ability of AAV-OSLMs to escape the human IVIG

neutralization.

81

Here, we would like to discuss potential strategies to engineer the AAV-OSLMs

to escape the neutralization. One way is to put OSLM-HD4 capsid mutations to the

corresponding places in an AAV capsid with low immunogenic profile, with the potential

to maintain OS targeting. For instance, AAV8 can serve as the AAV backbone, which

has low prevalence of pre-existing antibodies in human population [157-159]. Alternatively,

AAV capsid library based on a low NAB AAV serotype backbone can be used for

screening variants for targeting OS. For example, Dr. Marsic in Dr. Zolotukhin’s lab has

generated VRs modified AAV capsid library based on AAV3 and AAV6

backbone.(unpublished results) These libraries can be subjected to directed evolution

experiments for isolating improved AAV variants for OS targeting. Ideally, testing the

immune response against AAVs in an OS model in an immune-competent background

would give more clinically relevant results. However, with the current technology, it is

difficult to achieve.

The Cell-mediated Immunity against AAV-OSLM Variants

In clinical trials, cytotoxic immune response directed against the AAV capsid is

important in terms of both safety and efficacy of gene transfer [51, 160, 161]. Therefore, it is

critical to understand the T cell response to AAV capsid. It is believed that AAV capsid

antigen is processed by proteasome in the transduced cells and presented on MHC I

[162, 163]. Both in pre-clinical and clinical studies, differences in the ability and kinetics of T

cell induction has been reported dependent on different serotypes, vector dosing, the

target tissue and the method of administration, detailed reviewed by Basner-

Tschakarjan et al. [164].

There is limited understanding about the epitopes on AAV capsid that T cells

recognize. As a result, it is hard to predict the effect of the mutations on the AAV-OSLM

82

capsids on altering the T cell recognition and response. For future experiments, it is of

interest to compare the T cell response of AAV-OSLMs with that of AAV2.

It is revealed in the hemophilia B trial that capsid specific T cell responses seem

to be detected in a dose-dependent fashion and lower AAV vector dose may not trigger

T cell response to the capsid [51]. OSLM-HD4 is very efficient at transducing OS in vivo

which is helpful in lowering the vector dosing and furthermore in diminishing the T cell

response. To test whether OSLM-HD4 can target OS at lower vector dose and

furthermore for diminishing the T cell response, we injected a ten-fold lower dose at 1 ×

1010 vg/mouse of OSLM-HD4 into OS156 tumor bearing animals. The high dose at 1 ×

1011 results showed in Chapter 4 was then plotted together with the lower dose results.

As shown in Figure 6-3, efficient OS156 transduction was detected in both high and low

doses with a dose-dependent expression pattern. For future experiments, we will

compare the T cell response against OSLM-HD4 capsid at 1 × 1010 and 1 × 1011

vg/mouse. We expect that OSLM-HD4 vector will demonstrate lower or diminishing T

cell response at lower viral dose.

The AAV recognition by the dendritic cells and further activation of capsid-

specific T cells is depend on heparin binding [165] where AAV2-HD and OSLM-HD4 are

deficient. Therefore, we propose that AAV2-HD and OSLM-HD4 vectors will show an

attenuated CD8+ T cell response against them. In the future, it is worthwhile to test the

T cell response against them.

On the flip side, stimulating the T cell response by AAV capsid may be beneficial

for tumor treatment. Immunotherapy is a type of cancer treatment designed to boost the

body’s natural defenses to fight the cancer. In this case, T cell activation against the

83

AAV capsids in the tumor site may improve or restore the immune system function to kill

the cancer cells. This may complement the therapeutic genetic payload carrying inside

the AAV vector.

Gene Therapy for Osteosarcoma

Background

So far, there is only one gene therapy trial for human OS which is in phase II. In

this trial, Rexin-G, a retroviral vector, was used to deliver a dominant negative cyclin G1

construct as the genetic payload [166]. The vector was armed with a collagen matrix

binding motif on its surface (envelop protein) to preferably accumulate in cancerous

lesions which is beneficial in the safety as was seen in the trial [166]. It is tempting to test

AAV carrying the dominant negative cyclin G1 construct for OS.

Much more has been done for pre-clinical gene therapy for OS [94, 167]. Genes

associated with OS development such as p53 [168, 169] and Rb [170, 171], ezrin [172],

urokinase plasminogen activator (uPA) [173, 174] as well as common cancer modulating

therapeutic genes such as IL-12, herpes simplex thymidine kinase (HSV-TK) system,

cytosine deaminase (CD), endostatin, etc [94] have been tested in both OS cell lines and

animal models. Unfortunately, due to the inability to efficiently target OS following

systemic vector delivery, these studies are largely using ex vivo gene delivery or

intratumoral vector injection. Compared with them, our novel AAV based targeting

platform is able to target OS specifically and efficiently in vivo. Thus, AAV-mediated OS

gene therapy warrants further investigation.

AAV-mediated OS gene therapy to activate the immune response against OS

Using the microarray based transcriptional profiling and further immune-staining

on the protein level, we observed that OS TICs established an immune-suppressive

84

state to blunt the recognition of OS cell by the immune system. To this end, we

hypothesize that gene therapy to activate the immune response against OS has the

greatest likelihood of effective treatment. Candidate transgenes include selected

molecules that block immune suppression pathways and immune-activating cytokines

and chemokines. Those genes will be cloned into AAV vector to test AAV based gene

therapy for OS.

AAV-mediated expression of bone morphogenetic protein to treat OS

Based on the previous cancer gene therapy studies, it has been proven

extremely hard, or impossible, to achieve 100% transduction of cancer cells by any

gene delivery vehicle. Therefore, in addition to the engineering of AAV vector for

enhanced tumor targeting, a secreteable therapeutic gene will further broad the

therapeutic effect to the surrounding cells that are not transduced by the AAV vector.

Bone morphogenetic proteins (BMPs) are a group of secreted growth factors,

belonging to the transforming growth factor beta (TGFβ) superfamily [175]. BMPs can

induce the formation of bone and cartilage [175]. Since the OS TICs show a de-

differentiated transcriptional profile, we hypothesize that treating the OS with BMPs will

lead to the differentiation of TICs into less tumorigenic cells and result in therapeutic

effect. In addition, as growth factors, for therapy purpose, their potential cytotoxicity and

side effects will be much lower than conventional cancer therapies.

In preliminary data from members of our group, the OS TICs pre-treated with

recombinant BMP4/7 (rBMP4/7) showed significantly delayed tumor progression in vivo

through the activation of BMP pathway. Currently, we are working to incorporate the

BMP4 transgene into AAV vector to test the effect of AAV vector for OS treatment.

85

If the therapeutic effect of AAV-BMP4 vector remains to be improved, we will test

other activator of BMP pathway such as rBMP4/7 heterodimer, and other members in

the TGFβ superfamily such as TGFβ2 for the potential gene therapy for OS.

Conclusion

In this project, we have been able to: i) generate improved AAV variants that

show hundreds of fold higher and specific transduction in the OS tumors; ii) understand

the critical regions on the AAV capsid that function for systemic gene delivery to OS and

specific AAV OS cell interaction; iii) challenge the conventional concept for vector

targeting that focuses on interaction between vector and target cell surface antigen; iv)

suggest the important factors in the tumor biology that make tumor particularly suited for

AAV transduction.

A successful gene therapy requires in-depth knowledge of both the gene delivery

vehicle and the biology of the diseased tissue and cells. In my doctoral project, we have

laid a solid foundation in understanding a potential AAV based gene delivery method to

OS. Based on these findings, we believe it is very promising to test the AAV based gene

therapy for OS and other cancers in the future. It should be mentioned that we are

among the first groups to use AAV-mediated gene therapy for OS. Through more and

more work in OS models including rodent and dog based models, we will establish the

proof-of-principle for this novel way of OS treatment. Meanwhile, we have paid attention

to the immune response against the AAV vector. Those studies, altogether, will pave

the way for the translation of AAV based gene therapy into human cancer trials.

86

Figure 6-1. OSLM-HD4 shows rapid and efficient transduction for targeting Huh7 tumor

in vivo. A) Huh7 tumor-bearing NSG mice were used for tail-vein injection with HD4-UF50 vectors at 1X1011 vg/mouse, n=5. Representative images of mouse whole body bioluminescent images at day 3 post administration are shown. B) Quantitative luciferase data for transgene expression in OS156 and Huh7 tumors. RLU: relative light unit.

87

Figure 6-2. Neutralizing antibody titers of AAV-OSLM variants. Individual AAV-OSLM-

UF50 and AAV2-UF50 vectors were incubated with serial dilution of anti-AAV2 antiserum before adding to OS521 TICs for infection, MOI =10,000, n=3. Luciferase assays were taken at 48 hrs post infection to determine the infectious AAV amount. The NAB titers (red arrows) are reported as the dilution of serum necessary to reduce infectivity to 50% of the value measured in the absence of serum (virus only).

88

Figure 6-3. OSLM-HD4 showed a dose-dependent expression in OS156 tumor in vivo.

OS156 tumor-bearing NSG mice were used for tail-vein injection with HD4-UF50 vectors at 1X1011 vg/mouse, n=15 and 1X1010 vg/mouse, n=4. Quantitative luciferase data for transgene expression in OS156 tumor at day 1, day 3 and day 7 post viral deliveries was shown.

89

LIST OF REFERENCES

1. Atchison, RW, Casto, BC, and Hammon, WM (1965). Adenovirus-Associated Defective Virus Particles. Science 149: 754-756.

2. Srivastava, A, Lusby, EW, and Berns, KI (1983). Nucleotide sequence and organization of the adeno-associated virus 2 genome. J Virol 45: 555-564.

3. McLaughlin, SK, Collis, P, Hermonat, PL, and Muzyczka, N (1988). Adeno-associated virus general transduction vectors: analysis of proviral structures. J Virol 62: 1963-1973.

4. Hauswirth, WW, and Berns, KI (1977). Origin and termination of adeno-associated virus DNA replication. Virology 78: 488-499.

5. Sonntag, F, Schmidt, K, and Kleinschmidt, JA (2010). A viral assembly factor promotes AAV2 capsid formation in the nucleolus. Proc Natl Acad Sci U S A 107: 10220-10225.

6. Gao, G, Vandenberghe, LH, Alvira, MR, Lu, Y, Calcedo, R, Zhou, X, et al. (2004). Clades of Adeno-associated viruses are widely disseminated in human tissues. J Virol 78: 6381-6388.

7. Gao, G, Alvira, MR, Somanathan, S, Lu, Y, Vandenberghe, LH, Rux, JJ, et al. (2003). Adeno-associated viruses undergo substantial evolution in primates during natural infections. Proc Natl Acad Sci U S A 100: 6081-6086.

8. Chen, CL, Jensen, RL, Schnepp, BC, Connell, MJ, Shell, R, Sferra, TJ, et al. (2005). Molecular characterization of adeno-associated viruses infecting children. J Virol 79: 14781-14792.

9. Hauck, B, Chen, L, and Xiao, W (2003). Generation and characterization of chimeric recombinant AAV vectors. Mol Ther 7: 419-425.

10. Hauck, B, and Xiao, W (2003). Characterization of tissue tropism determinants of adeno-associated virus type 1. J Virol 77: 2768-2774.

11. Rabinowitz, JE, Rolling, F, Li, C, Conrath, H, Xiao, W, Xiao, X, et al. (2002). Cross-packaging of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. J Virol 76: 791-801.

12. Rabinowitz, JE, Bowles, DE, Faust, SM, Ledford, JG, Cunningham, SE, and Samulski, RJ (2004). Cross-dressing the virion: the transcapsidation of adeno-associated virus serotypes functionally defines subgroups. J Virol 78: 4421-4432.

90

13. Hildinger, M, Auricchio, A, Gao, G, Wang, L, Chirmule, N, and Wilson, JM (2001). Hybrid vectors based on adeno-associated virus serotypes 2 and 5 for muscle-directed gene transfer. J Virol 75: 6199-6203.

14. Van Vliet, KM, Blouin, V, Brument, N, Agbandje-McKenna, M, and Snyder, RO (2008). The role of the adeno-associated virus capsid in gene transfer. Methods Mol Biol 437: 51-91.

15. Agbandje-McKenna, M, and Kleinschmidt, J (2011). AAV capsid structure and cell interactions. Methods Mol Biol 807: 47-92.

16. DiMattia, MA, Nam, HJ, Van Vliet, K, Mitchell, M, Bennett, A, Gurda, BL, et al. (2012). Structural insight into the unique properties of adeno-associated virus serotype 9. J Virol 86: 6947-6958.

17. DiMattia, M, Govindasamy, L, Levy, HC, Gurda-Whitaker, B, Kalina, A, Kohlbrenner, E, et al. (2005). Production, purification, crystallization and preliminary X-ray structural studies of adeno-associated virus serotype 5. Acta Crystallogr Sect F Struct Biol Cryst Commun 61: 917-921.

18. Kaludov, N, Padron, E, Govindasamy, L, McKenna, R, Chiorini, JA, and Agbandje-McKenna, M (2003). Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 4. Virology 306: 1-6.

19. Nam, HJ, Lane, MD, Padron, E, Gurda, B, McKenna, R, Kohlbrenner, E, et al. (2007). Structure of adeno-associated virus serotype 8, a gene therapy vector. J Virol 81: 12260-12271.

20. Xie, Q, Bu, W, Bhatia, S, Hare, J, Somasundaram, T, Azzi, A, et al. (2002). The atomic structure of adeno-associated virus (AAV-2), a vector for human gene therapy. Proc Natl Acad Sci U S A 99: 10405-10410.

21. Lerch, TF, Xie, Q, and Chapman, MS (2010). The structure of adeno-associated virus serotype 3B (AAV-3B): insights into receptor binding and immune evasion. Virology 403: 26-36.

22. Ng, R, Govindasamy, L, Gurda, BL, McKenna, R, Kozyreva, OG, Samulski, RJ, et al. (2010). Structural characterization of the dual glycan binding adeno-associated virus serotype 6. J Virol 84: 12945-12957.

23. Quesada, O, Gurda, B, Govindasamy, L, McKenna, R, Kohlbrenner, E, Aslanidi, G, et al. (2007). Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 7. Acta Crystallogr Sect F Struct Biol Cryst Commun 63: 1073-1076.

24. Govindasamy, L, Padron, E, McKenna, R, Muzyczka, N, Kaludov, N, Chiorini, JA, et al. (2006). Structurally mapping the diverse phenotype of adeno-associated virus serotype 4. J Virol 80: 11556-11570.

91

25. Xie, Q, Ongley, HM, Hare, J, and Chapman, MS (2008). Crystallization and preliminary X-ray structural studies of adeno-associated virus serotype 6. Acta Crystallogr Sect F Struct Biol Cryst Commun 64: 1074-1078.

26. Walters, RW, Agbandje-McKenna, M, Bowman, VD, Moninger, TO, Olson, NH, Seiler, M, et al. (2004). Structure of adeno-associated virus serotype 5. J Virol 78: 3361-3371.

27. Padron, E, Bowman, V, Kaludov, N, Govindasamy, L, Levy, H, Nick, P, et al. (2005). Structure of adeno-associated virus type 4. J Virol 79: 5047-5058.

28. Miller, EB, Gurda-Whitaker, B, Govindasamy, L, McKenna, R, Zolotukhin, S, Muzyczka, N, et al. (2006). Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 1. Acta Crystallogr Sect F Struct Biol Cryst Commun 62: 1271-1274.

29. Bordignon, C, Notarangelo, LD, Nobili, N, Ferrari, G, Casorati, G, Panina, P, et al. (1995). Gene therapy in peripheral blood lymphocytes and bone marrow for ADA- immunodeficient patients. Science 270: 470-475.

30. Blaese, RM, Culver, KW, Miller, AD, Carter, CS, Fleisher, T, Clerici, M, et al. (1995). T lymphocyte-directed gene therapy for ADA- SCID: initial trial results after 4 years. Science 270: 475-480.

31. (2002). Assessment of adenoviral vector safety and toxicity: report of the National Institutes of Health Recombinant DNA Advisory Committee. Hum Gene Ther 13: 3-13.

32. Marshall, E (1999). Gene therapy death prompts review of adenovirus vector. Science 286: 2244-2245.

33. Schnell, MA, Zhang, Y, Tazelaar, J, Gao, GP, Yu, QC, Qian, R, et al. (2001). Activation of innate immunity in nonhuman primates following intraportal administration of adenoviral vectors. Mol Ther 3: 708-722.

34. Raper, SE, Chirmule, N, Lee, FS, Wivel, NA, Bagg, A, Gao, GP, et al. (2003). Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Mol Genet Metab 80: 148-158.

35. Cavazzana-Calvo, M, Hacein-Bey, S, de Saint Basile, G, Gross, F, Yvon, E, Nusbaum, P, et al. (2000). Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease. Science 288: 669-672.

36. Hacein-Bey-Abina, S, von Kalle, C, Schmidt, M, Le Deist, F, Wulffraat, N, McIntyre, E, et al. (2003). A serious adverse event after successful gene therapy for X-linked severe combined immunodeficiency. N Engl J Med 348: 255-256.

92

37. Kaiser, J (2003). Gene therapy. Seeking the cause of induced leukemias in X-SCID trial. Science 299: 495.

38. McCormick, F (2001). Cancer gene therapy: fringe or cutting edge? Nat Rev Cancer 1: 130-141.

39. Cross, D, and Burmester, JK (2006). Gene therapy for cancer treatment: past, present and future. Clin Med Res 4: 218-227.

40. Edelstein, ML, Abedi, MR, and Wixon, J (2007). Gene therapy clinical trials worldwide to 2007--an update. J Gene Med 9: 833-842.

41. Ginn, SL, Alexander, IE, Edelstein, ML, Abedi, MR, and Wixon, J (2013). Gene therapy clinical trials worldwide to 2012 - an update. J Gene Med 15: 65-77.

42. Samulski, RJ, Chang, LS, and Shenk, T (1989). Helper-free stocks of recombinant adeno-associated viruses: normal integration does not require viral gene expression. J Virol 63: 3822-3828.

43. Xiao, X, Li, J, and Samulski, RJ (1998). Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus. J Virol 72: 2224-2232.

44. Matsushita, T, Elliger, S, Elliger, C, Podsakoff, G, Villarreal, L, Kurtzman, GJ, et al. (1998). Adeno-associated virus vectors can be efficiently produced without helper virus. Gene Ther 5: 938-945.

45. Daya, S, and Berns, KI (2008). Gene therapy using adeno-associated virus vectors. Clin Microbiol Rev 21: 583-593.

46. Mingozzi, F, and High, KA (2011). Therapeutic in vivo gene transfer for genetic disease using AAV: progress and challenges. Nat Rev Genet 12: 341-355.

47. Cideciyan, AV, Aleman, TS, Boye, SL, Schwartz, SB, Kaushal, S, Roman, AJ, et al. (2008). Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics. Proc Natl Acad Sci U S A 105: 15112-15117.

48. Maguire, AM, Simonelli, F, Pierce, EA, Pugh, EN, Jr., Mingozzi, F, Bennicelli, J, et al. (2008). Safety and efficacy of gene transfer for Leber's congenital amaurosis. N Engl J Med 358: 2240-2248.

49. Bainbridge, JW, Mehat, MS, Sundaram, V, Robbie, SJ, Barker, SE, Ripamonti, C, et al. (2015). Long-term effect of gene therapy on Leber's congenital amaurosis. N Engl J Med 372: 1887-1897.

93

50. Nathwani, AC, Reiss, UM, Tuddenham, EG, Rosales, C, Chowdary, P, McIntosh, J, et al. (2014). Long-term safety and efficacy of factor IX gene therapy in hemophilia B. N Engl J Med 371: 1994-2004.

51. Nathwani, AC, Tuddenham, EG, Rangarajan, S, Rosales, C, McIntosh, J, Linch, DC, et al. (2011). Adenovirus-associated virus vector-mediated gene transfer in hemophilia B. N Engl J Med 365: 2357-2365.

52. Brantly, ML, Chulay, JD, Wang, L, Mueller, C, Humphries, M, Spencer, LT, et al. (2009). Sustained transgene expression despite T lymphocyte responses in a clinical trial of rAAV1-AAT gene therapy. Proc Natl Acad Sci U S A 106: 16363-16368.

53. Hwu, WL, Muramatsu, S, Tseng, SH, Tzen, KY, Lee, NC, Chien, YH, et al. (2012). Gene therapy for aromatic L-amino acid decarboxylase deficiency. Sci Transl Med 4: 134ra161.

54. MacLaren, RE, Groppe, M, Barnard, AR, Cottriall, CL, Tolmachova, T, Seymour, L, et al. (2014). Retinal gene therapy in patients with choroideremia: initial findings from a phase 1/2 clinical trial. Lancet 383: 1129-1137.

55. Bartus, RT, Baumann, TL, Brown, L, Kruegel, BR, Ostrove, JM, and Herzog, CD (2013). Advancing neurotrophic factors as treatments for age-related neurodegenerative diseases: developing and demonstrating "clinical proof-of-concept" for AAV-neurturin (CERE-120) in Parkinson's disease. Neurobiol Aging 34: 35-61.

56. Christine, CW, Starr, PA, Larson, PS, Eberling, JL, Jagust, WJ, Hawkins, RA, et al. (2009). Safety and tolerability of putaminal AADC gene therapy for Parkinson disease. Neurology 73: 1662-1669.

57. McPhee, SW, Janson, CG, Li, C, Samulski, RJ, Camp, AS, Francis, J, et al. (2006). Immune responses to AAV in a phase I study for Canavan disease. J Gene Med 8: 577-588.

58. Bowles, DE, McPhee, SW, Li, C, Gray, SJ, Samulski, JJ, Camp, AS, et al. (2012). Phase 1 gene therapy for Duchenne muscular dystrophy using a translational optimized AAV vector. Mol Ther 20: 443-455.

59. Bryant, LM, Christopher, DM, Giles, AR, Hinderer, C, Rodriguez, JL, Smith, JB, et al. (2013). Lessons learned from the clinical development and market authorization of Glybera. Hum Gene Ther Clin Dev 24: 55-64.

60. Hoerer, M, Bogedain, C, Scheer, U, Heberger, C, Steyrer, S, Burger, A, et al. (1997). The use of recombinant adeno-associated viral vectors for the transduction of epithelial tumor cells. Int J Immunopharmacol 19: 473-479.

94

61. Maass, G, Bogedain, C, Scheer, U, Michl, D, Horer, M, Braun-Falco, M, et al. (1998). Recombinant adeno-associated virus for the generation of autologous, gene-modified tumor vaccines: evidence for a high transduction efficiency into primary epithelial cancer cells. Hum Gene Ther 9: 1049-1059.

62. Peng, D, Qian, C, Sun, Y, Barajas, MA, and Prieto, J (2000). Transduction of hepatocellular carcinoma (HCC) using recombinant adeno-associated virus (rAAV): in vitro and in vivo effects of genotoxic agents. J Hepatol 32: 975-985.

63. Veldwijk, MR, Fruehauf, S, Schiedlmeier, B, Kleinschmidt, JA, and Zeller, WJ (2000). Differential expression of a recombinant adeno-associated virus 2 vector in human CD34+ cells and breast cancer cells. Cancer Gene Ther 7: 597-604.

64. Kunke, D, Grimm, D, Denger, S, Kreuzer, J, Delius, H, Komitowski, D, et al. (2000). Preclinical study on gene therapy of cervical carcinoma using adeno-associated virus vectors. Cancer Gene Ther 7: 766-777.

65. Hacker, UT, Wingenfeld, L, Kofler, DM, Schuhmann, NK, Lutz, S, Herold, T, et al. (2005). Adeno-associated virus serotypes 1 to 5 mediated tumor cell directed gene transfer and improvement of transduction efficiency. J Gene Med 7: 1429-1438.

66. Thorsen, F, Afione, S, Huszthy, PC, Tysnes, BB, Svendsen, A, Bjerkvig, R, et al. (2006). Adeno-associated virus (AAV) serotypes 2, 4 and 5 display similar transduction profiles and penetrate solid tumor tissue in models of human glioma. J Gene Med 8: 1131-1140.

67. Harding, TC, Dickinson, PJ, Roberts, BN, Yendluri, S, Gonzalez-Edick, M, Lecouteur, RA, et al. (2006). Enhanced gene transfer efficiency in the murine striatum and an orthotopic glioblastoma tumor model, using AAV-7- and AAV-8-pseudotyped vectors. Hum Gene Ther 17: 807-820.

68. Huszthy, PC, Svendsen, A, Wilson, JM, Kotin, RM, Lonning, PE, Bjerkvig, R, et al. (2005). Widespread dispersion of adeno-associated virus serotype 1 and adeno-associated virus serotype 6 vectors in the rat central nervous system and in human glioblastoma multiforme xenografts. Hum Gene Ther 16: 381-392.

69. Mizukami, H, Young, NS, and Brown, KE (1996). Adeno-associated virus type 2 binds to a 150-kilodalton cell membrane glycoprotein. Virology 217: 124-130.

70. Ponnazhagan, S, Wang, XS, Woody, MJ, Luo, F, Kang, LY, Nallari, ML, et al. (1996). Differential expression in human cells from the p6 promoter of human parvovirus B19 following plasmid transfection and recombinant adeno-associated virus 2 (AAV) infection: human megakaryocytic leukaemia cells are non-permissive for AAV infection. J Gen Virol 77 ( Pt 6): 1111-1122.

95

71. Summerford, C, and Samulski, RJ (1998). Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. J Virol 72: 1438-1445.

72. Girod, A, Ried, M, Wobus, C, Lahm, H, Leike, K, Kleinschmidt, J, et al. (1999). Genetic capsid modifications allow efficient re-targeting of adeno-associated virus type 2. Nat Med 5: 1052-1056.

73. Wu, P, Xiao, W, Conlon, T, Hughes, J, Agbandje-McKenna, M, Ferkol, T, et al. (2000). Mutational analysis of the adeno-associated virus type 2 (AAV2) capsid gene and construction of AAV2 vectors with altered tropism. J Virol 74: 8635-8647.

74. Pasqualini, R, Koivunen, E, Kain, R, Lahdenranta, J, Sakamoto, M, Stryhn, A, et al. (2000). Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis. Cancer Res 60: 722-727.

75. Curnis, F, Sacchi, A, Borgna, L, Magni, F, Gasparri, A, and Corti, A (2000). Enhancement of tumor necrosis factor alpha antitumor immunotherapeutic properties by targeted delivery to aminopeptidase N (CD13). Nat Biotechnol 18: 1185-1190.

76. Shi, W, and Bartlett, JS (2003). RGD inclusion in VP3 provides adeno-associated virus type 2 (AAV2)-based vectors with a heparan sulfate-independent cell entry mechanism. Mol Ther 7: 515-525.

77. Yang, Q, Mamounas, M, Yu, G, Kennedy, S, Leaker, B, Merson, J, et al. (1998). Development of novel cell surface CD34-targeted recombinant adenoassociated virus vectors for gene therapy. Hum Gene Ther 9: 1929-1937.

78. Bartlett, JS, Kleinschmidt, J, Boucher, RC, and Samulski, RJ (1999). Targeted adeno-associated virus vector transduction of nonpermissive cells mediated by a bispecific F(ab'gamma)2 antibody. Nat Biotechnol 17: 181-186.

79. Shi, W, Hemminki, A, and Bartlett, JS (2006). Capsid modifications overcome low heterogeneous expression of heparan sulfate proteoglycan that limits AAV2-mediated gene transfer and therapeutic efficacy in human ovarian carcinoma. Gynecol Oncol 103: 1054-1062.

80. Michelfelder, S, Kohlschutter, J, Skorupa, A, Pfennings, S, Muller, O, Kleinschmidt, JA, et al. (2009). Successful expansion but not complete restriction of tropism of adeno-associated virus by in vivo biopanning of random virus display peptide libraries. PLoS One 4: e5122.

81. Cobb, RE, Chao, R, and Zhao, H (2013). Directed Evolution: Past, Present and Future. AIChE J 59: 1432-1440.

96

82. Maheshri, N, Koerber, JT, Kaspar, BK, and Schaffer, DV (2006). Directed evolution of adeno-associated virus yields enhanced gene delivery vectors. Nat Biotechnol 24: 198-204.

83. Grimm, D, Lee, JS, Wang, L, Desai, T, Akache, B, Storm, TA, et al. (2008). In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses. J Virol 82: 5887-5911.

84. Li, W, Asokan, A, Wu, Z, Van Dyke, T, DiPrimio, N, Johnson, JS, et al. (2008). Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles. Mol Ther 16: 1252-1260.

85. Koerber, JT, Jang, JH, and Schaffer, DV (2008). DNA shuffling of adeno-associated virus yields functionally diverse viral progeny. Mol Ther 16: 1703-1709.

86. Asuri, P, Bartel, MA, Vazin, T, Jang, JH, Wong, TB, and Schaffer, DV (2012). Directed evolution of adeno-associated virus for enhanced gene delivery and gene targeting in human pluripotent stem cells. Mol Ther 20: 329-338.

87. Muller, OJ, Kaul, F, Weitzman, MD, Pasqualini, R, Arap, W, Kleinschmidt, JA, et al. (2003). Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors. Nat Biotechnol 21: 1040-1046.

88. Varadi, K, Michelfelder, S, Korff, T, Hecker, M, Trepel, M, Katus, HA, et al. (2012). Novel random peptide libraries displayed on AAV serotype 9 for selection of endothelial cell-directed gene transfer vectors. Gene Ther 19: 800-809.

89. Koerber, JT, Klimczak, R, Jang, JH, Dalkara, D, Flannery, JG, and Schaffer, DV (2009). Molecular evolution of adeno-associated virus for enhanced glial gene delivery. Mol Ther 17: 2088-2095.

90. Marsic, D, Govindasamy, L, Currlin, S, Markusic, DM, Tseng, YS, Herzog, RW, et al. (2014). Vector design Tour de Force: integrating combinatorial and rational approaches to derive novel adeno-associated virus variants. Mol Ther 22: 1900-1909.

91. Zhong, L, Li, B, Mah, CS, Govindasamy, L, Agbandje-McKenna, M, Cooper, M, et al. (2008). Next generation of adeno-associated virus 2 vectors: point mutations in tyrosines lead to high-efficiency transduction at lower doses. Proc Natl Acad Sci U S A 105: 7827-7832.

92. Opie, SR, Warrington, KH, Jr., Agbandje-McKenna, M, Zolotukhin, S, and Muzyczka, N (2003). Identification of amino acid residues in the capsid proteins of adeno-associated virus type 2 that contribute to heparan sulfate proteoglycan binding. J Virol 77: 6995-7006.

97

93. Kern, A, Schmidt, K, Leder, C, Muller, OJ, Wobus, CE, Bettinger, K, et al. (2003). Identification of a heparin-binding motif on adeno-associated virus type 2 capsids. J Virol 77: 11072-11081.

94. Dass, CR, and Choong, PF (2008). Gene therapy for osteosarcoma: steps towards clinical studies. J Pharm Pharmacol 60: 405-413.

95. Gibbs, CP, Kukekov, VG, Reith, JD, Tchigrinova, O, Suslov, ON, Scott, EW, et al. (2005). Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia 7: 967-976.

96. Mirabello, L, Troisi, RJ, and Savage, SA (2009). International osteosarcoma incidence patterns in children and adolescents, middle ages and elderly persons. Int J Cancer 125: 229-234.

97. Mueller, F, Fuchs, B, and Kaser-Hotz, B (2007). Comparative biology of human and canine osteosarcoma. Anticancer Res 27: 155-164.

98. Chou, AJ, and Gorlick, R (2006). Chemotherapy resistance in osteosarcoma: current challenges and future directions. Expert Rev Anticancer Ther 6: 1075-1085.

99. Jaffe, N (2009). Osteosarcoma: review of the past, impact on the future. The American experience. Cancer Treat Res 152: 239-262.

100. Jaffe, N, Carrasco, H, Raymond, K, Ayala, A, and Eftekhari, F (2002). Can cure in patients with osteosarcoma be achieved exclusively with chemotherapy and abrogation of surgery? Cancer 95: 2202-2210.

101. Meyers, PA, Schwartz, CL, Krailo, M, Kleinerman, ES, Betcher, D, Bernstein, ML, et al. (2005). Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J Clin Oncol 23: 2004-2011.

102. Bruland, OS, and Pihl, A (1997). On the current management of osteosarcoma. A critical evaluation and a proposal for a modified treatment strategy. Eur J Cancer 33: 1725-1731.

103. Zhou, BB, Zhang, H, Damelin, M, Geles, KG, Grindley, JC, and Dirks, PB (2009). Tumour-initiating cells: challenges and opportunities for anticancer drug discovery. Nat Rev Drug Discov 8: 806-823.

104. Levings, PP, McGarry, SV, Currie, TP, Nickerson, DM, McClellan, S, Ghivizzani, SC, et al. (2009). Expression of an exogenous human Oct-4 promoter identifies tumor-initiating cells in osteosarcoma. Cancer research 69: 5648-5655.

98

105. Berlin, O, Samid, D, Donthineni-Rao, R, Akeson, W, Amiel, D, and Woods, VL, Jr. (1993). Development of a novel spontaneous metastasis model of human osteosarcoma transplanted orthotopically into bone of athymic mice. Cancer research 53: 4890-4895.

106. Luu, HH, Kang, Q, Park, JK, Si, W, Luo, Q, Jiang, W, et al. (2005). An orthotopic model of human osteosarcoma growth and spontaneous pulmonary metastasis. Clin Exp Metastasis 22: 319-329.

107. chen, H (2015). Adeno-associated virus vectors for human gene therapy. World Journal of Medical Genetics 5: 28-45.

108. Ignatova, TN, Kukekov, VG, Laywell, ED, Suslov, ON, Vrionis, FD, and Steindler, DA (2002). Human cortical glial tumors contain neural stem-like cells expressing astroglial and neuronal markers in vitro. Glia 39: 193-206.

109. Marsic, D, Govindasamy, L, Currlin, S, Markusic, D, Tseng, YS, Herzog, RW, et al. (2014). Vector design tour de force: integrating combinatorial and rational approaches to derive novel Adeno-associated virus (AAV) variants. Mol Ther.

110. Nonnenmacher, M, and Weber, T (2012). Intracellular transport of recombinant adeno-associated virus vectors. Gene Ther 19: 649-658.

111. Arad, U (1998). Modified Hirt procedure for rapid purification of extrachromosomal DNA from mammalian cells. Biotechniques 24: 760-762.

112. Samulski, RJ, Chang, LS, and Shenk, T (1987). A recombinant plasmid from which an infectious adeno-associated virus genome can be excised in vitro and its use to study viral replication. J Virol 61: 3096-3101.

113. Gibson, DG, Young, L, Chuang, RY, Venter, JC, Hutchison, CA, 3rd, and Smith, HO (2009). Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6: 343-345.

114. Ling, C, Wang, Y, Lu, Y, Wang, L, Jayandharan, GR, Aslanidi, GV, et al. (2014). Enhanced transgene expression from single-stranded D-sequence-substituted recombinant AAV vectors in human cell lines in vitro and in murine hepatocytes in vivo. J Virol.

115. Zolotukhin, S, Byrne, BJ, Mason, E, Zolotukhin, I, Potter, M, Chesnut, K, et al. (1999). Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther 6: 973-985.

116. Muller, OJ, Leuchs, B, Pleger, ST, Grimm, D, Franz, WM, Katus, HA, et al. (2006). Improved cardiac gene transfer by transcriptional and transductional targeting of adeno-associated viral vectors. Cardiovasc Res 70: 70-78.

99

117. Perabo, L, Goldnau, D, White, K, Endell, J, Boucas, J, Humme, S, et al. (2006). Heparan sulfate proteoglycan binding properties of adeno-associated virus retargeting mutants and consequences for their in vivo tropism. J Virol 80: 7265-7269.

118. Asokan, A, Conway, JC, Phillips, JL, Li, C, Hegge, J, Sinnott, R, et al. (2010). Reengineering a receptor footprint of adeno-associated virus enables selective and systemic gene transfer to muscle. Nat Biotechnol 28: 79-82.

119. Zincarelli, C, Soltys, S, Rengo, G, and Rabinowitz, JE (2008). Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection. Mol Ther 16: 1073-1080.

120. Fuster, MM, and Esko, JD (2005). The sweet and sour of cancer: glycans as novel therapeutic targets. Nat Rev Cancer 5: 526-542.

121. Huang, LY, Halder, S, and Agbandje-McKenna, M (2014). Parvovirus glycan interactions. Curr Opin Virol 7: 108-118.

122. Mosesson, Y, Mills, GB, and Yarden, Y (2008). Derailed endocytosis: an emerging feature of cancer. Nat Rev Cancer 8: 835-850.

123. Hanahan, D, and Weinberg, RA (2011). Hallmarks of cancer: the next generation. Cell 144: 646-674.

124. Jain, RK (1999). Transport of molecules, particles, and cells in solid tumors. Annu Rev Biomed Eng 1: 241-263.

125. Ruoslahti, E, Bhatia, SN, and Sailor, MJ (2010). Targeting of drugs and nanoparticles to tumors. J Cell Biol 188: 759-768.

126. Aslanidi, GV, Rivers, AE, Ortiz, L, Song, L, Ling, C, Govindasamy, L, et al. (2013). Optimization of the capsid of recombinant adeno-associated virus 2 (AAV2) vectors: the final threshold? PLoS One 8: e59142.

127. Shen, S, Troupes, AN, Pulicherla, N, and Asokan, A (2013). Multiple roles for sialylated glycans in determining the cardiopulmonary tropism of adeno-associated virus 4. J Virol 87: 13206-13213.

128. Bell, CL, Gurda, BL, Van Vliet, K, Agbandje-McKenna, M, and Wilson, JM (2012). Identification of the galactose binding domain of the adeno-associated virus serotype 9 capsid. J Virol 86: 7326-7333.

129. Adachi, K, Enoki, T, Kawano, Y, Veraz, M, and Nakai, H (2014). Drawing a high-resolution functional map of adeno-associated virus capsid by massively parallel sequencing. Nat Commun 5: 3075.

100

130. Pulicherla, N, Shen, S, Yadav, S, Debbink, K, Govindasamy, L, Agbandje-McKenna, M, et al. (2011). Engineering liver-detargeted AAV9 vectors for cardiac and musculoskeletal gene transfer. Mol Ther 19: 1070-1078.

131. Asokan, A, Hamra, JB, Govindasamy, L, Agbandje-McKenna, M, and Samulski, RJ (2006). Adeno-associated virus type 2 contains an integrin alpha5beta1 binding domain essential for viral cell entry. J Virol 80: 8961-8969.

132. Summerford, C, Bartlett, JS, and Samulski, RJ (1999). AlphaVbeta5 integrin: a co-receptor for adeno-associated virus type 2 infection. Nat Med 5: 78-82.

133. Johnson, JS, Gentzsch, M, Zhang, L, Ribeiro, CM, Kantor, B, Kafri, T, et al. (2011). AAV exploits subcellular stress associated with inflammation, endoplasmic reticulum expansion, and misfolded proteins in models of cystic fibrosis. PLoS Pathog 7: e1002053.

134. Zhong, L, Qing, K, Si, Y, Chen, L, Tan, M, and Srivastava, A (2004). Heat-shock treatment-mediated increase in transduction by recombinant adeno-associated virus 2 vectors is independent of the cellular heat-shock protein 90. J Biol Chem 279: 12714-12723.

135. Sanlioglu, S, and Engelhardt, JF (1999). Cellular redox state alters recombinant adeno-associated virus transduction through tyrosine phosphatase pathways. Gene Ther 6: 1427-1437.

136. Clarke, HJ, Chambers, JE, Liniker, E, and Marciniak, SJ (2014). Endoplasmic reticulum stress in malignancy. Cancer Cell 25: 563-573.

137. Misdorp, W (1980). Skeletal osteosarcoma. Animal model: canine osteosarcoma. Am J Pathol 98: 285-288.

138. Ling, C, Wang, Y, Zhang, Y, Ejjigani, A, Yin, Z, Lu, Y, et al. (2014). Selective in vivo targeting of human liver tumors by optimized AAV3 vectors in a murine xenograft model. Hum Gene Ther 25: 1023-1034.

139. Cheng, B, Ling, C, Dai, Y, Lu, Y, Glushakova, LG, Gee, SW, et al. (2012). Development of optimized AAV3 serotype vectors: mechanism of high-efficiency transduction of human liver cancer cells. Gene Ther 19: 375-384.

140. Calcedo, R, Vandenberghe, LH, Gao, G, Lin, J, and Wilson, JM (2009). Worldwide epidemiology of neutralizing antibodies to adeno-associated viruses. J Infect Dis 199: 381-390.

141. Boutin, S, Monteilhet, V, Veron, P, Leborgne, C, Benveniste, O, Montus, MF, et al. (2010). Prevalence of serum IgG and neutralizing factors against adeno-associated virus (AAV) types 1, 2, 5, 6, 8, and 9 in the healthy population: implications for gene therapy using AAV vectors. Hum Gene Ther 21: 704-712.

101

142. Calcedo, R, Morizono, H, Wang, L, McCarter, R, He, J, Jones, D, et al. (2011). Adeno-associated virus antibody profiles in newborns, children, and adolescents. Clin Vaccine Immunol 18: 1586-1588.

143. Halbert, CL, Miller, AD, McNamara, S, Emerson, J, Gibson, RL, Ramsey, B, et al. (2006). Prevalence of neutralizing antibodies against adeno-associated virus (AAV) types 2, 5, and 6 in cystic fibrosis and normal populations: Implications for gene therapy using AAV vectors. Hum Gene Ther 17: 440-447.

144. Li, C, Narkbunnam, N, Samulski, RJ, Asokan, A, Hu, G, Jacobson, LJ, et al. (2012). Neutralizing antibodies against adeno-associated virus examined prospectively in pediatric patients with hemophilia. Gene Ther 19: 288-294.

145. Moskalenko, M, Chen, L, van Roey, M, Donahue, BA, Snyder, RO, McArthur, JG, et al. (2000). Epitope mapping of human anti-adeno-associated virus type 2 neutralizing antibodies: implications for gene therapy and virus structure. J Virol 74: 1761-1766.

146. Manning, WC, Zhou, S, Bland, MP, Escobedo, JA, and Dwarki, V (1998). Transient immunosuppression allows transgene expression following readministration of adeno-associated viral vectors. Hum Gene Ther 9: 477-485.

147. Fisher, KJ, Jooss, K, Alston, J, Yang, Y, Haecker, SE, High, K, et al. (1997). Recombinant adeno-associated virus for muscle directed gene therapy. Nat Med 3: 306-312.

148. Halbert, CL, Standaert, TA, Aitken, ML, Alexander, IE, Russell, DW, and Miller, AD (1997). Transduction by adeno-associated virus vectors in the rabbit airway: efficiency, persistence, and readministration. J Virol 71: 5932-5941.

149. Hurlbut, GD, Ziegler, RJ, Nietupski, JB, Foley, JW, Woodworth, LA, Meyers, E, et al. (2010). Preexisting immunity and low expression in primates highlight translational challenges for liver-directed AAV8-mediated gene therapy. Mol Ther 18: 1983-1994.

150. Wang, L, Calcedo, R, Wang, H, Bell, P, Grant, R, Vandenberghe, LH, et al. (2010). The pleiotropic effects of natural AAV infections on liver-directed gene transfer in macaques. Mol Ther 18: 126-134.

151. Tseng, YS, and Agbandje-McKenna, M (2014). Mapping the AAV Capsid Host Antibody Response toward the Development of Second Generation Gene Delivery Vectors. Front Immunol 5: 9.

152. Lochrie, MA, Tatsuno, GP, Christie, B, McDonnell, JW, Zhou, S, Surosky, R, et al. (2006). Mutations on the external surfaces of adeno-associated virus type 2 capsids that affect transduction and neutralization. J Virol 80: 821-834.

102

153. Wobus, CE, Hugle-Dorr, B, Girod, A, Petersen, G, Hallek, M, and Kleinschmidt, JA (2000). Monoclonal antibodies against the adeno-associated virus type 2 (AAV-2) capsid: epitope mapping and identification of capsid domains involved in AAV-2-cell interaction and neutralization of AAV-2 infection. J Virol 74: 9281-9293.

154. McCraw, DM, O'Donnell, JK, Taylor, KA, Stagg, SM, and Chapman, MS (2012). Structure of adeno-associated virus-2 in complex with neutralizing monoclonal antibody A20. Virology 431: 40-49.

155. Gurda, BL, DiMattia, MA, Miller, EB, Bennett, A, McKenna, R, Weichert, WS, et al. (2013). Capsid antibodies to different adeno-associated virus serotypes bind common regions. J Virol 87: 9111-9124.

156. Perabo, L, Endell, J, King, S, Lux, K, Goldnau, D, Hallek, M, et al. (2006). Combinatorial engineering of a gene therapy vector: directed evolution of adeno-associated virus. J Gene Med 8: 155-162.

157. Scallan, CD, Jiang, H, Liu, T, Patarroyo-White, S, Sommer, JM, Zhou, S, et al. (2006). Human immunoglobulin inhibits liver transduction by AAV vectors at low AAV2 neutralizing titers in SCID mice. Blood 107: 1810-1817.

158. Lin, J, Calcedo, R, Vandenberghe, LH, Figueredo, JM, and Wilson, JM (2008). Impact of preexisting vector immunity on the efficacy of adeno-associated virus-based HIV-1 Gag vaccines. Hum Gene Ther 19: 663-669.

159. Gao, GP, Alvira, MR, Wang, L, Calcedo, R, Johnston, J, and Wilson, JM (2002). Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proc Natl Acad Sci U S A 99: 11854-11859.

160. Manno, CS, Pierce, GF, Arruda, VR, Glader, B, Ragni, M, Rasko, JJ, et al. (2006). Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat Med 12: 342-347.

161. Mingozzi, F, Maus, MV, Hui, DJ, Sabatino, DE, Murphy, SL, Rasko, JE, et al. (2007). CD8(+) T-cell responses to adeno-associated virus capsid in humans. Nat Med 13: 419-422.

162. Pien, GC, Basner-Tschakarjan, E, Hui, DJ, Mentlik, AN, Finn, JD, Hasbrouck, NC, et al. (2009). Capsid antigen presentation flags human hepatocytes for destruction after transduction by adeno-associated viral vectors. J Clin Invest 119: 1688-1695.

163. Finn, JD, Hui, D, Downey, HD, Dunn, D, Pien, GC, Mingozzi, F, et al. (2010). Proteasome inhibitors decrease AAV2 capsid derived peptide epitope presentation on MHC class I following transduction. Mol Ther 18: 135-142.

103

164. Basner-Tschakarjan, E, and Mingozzi, F (2014). Cell-Mediated Immunity to AAV Vectors, Evolving Concepts and Potential Solutions. Front Immunol 5: 350.

165. Vandenberghe, LH, Wang, L, Somanathan, S, Zhi, Y, Figueredo, J, Calcedo, R, et al. (2006). Heparin binding directs activation of T cells against adeno-associated virus serotype 2 capsid. Nat Med 12: 967-971.

166. Chawla, SP, Chua, VS, Fernandez, L, Quon, D, Saralou, A, Blackwelder, WC, et al. (2009). Phase I/II and phase II studies of targeted gene delivery in vivo: intravenous Rexin-G for chemotherapy-resistant sarcoma and osteosarcoma. Mol Ther 17: 1651-1657.

167. Broadhead, ML, Clark, JC, Choong, PF, and Dass, CR (2010). Making gene therapy for osteosarcoma a reality. Expert Rev Anticancer Ther 10: 477-480.

168. Ternovoi, VV, Curiel, DT, Smith, BF, and Siegal, GP (2006). Adenovirus-mediated p53 tumor suppressor gene therapy of osteosarcoma. Lab Invest 86: 748-766.

169. Densmore, CL, Kleinerman, ES, Gautam, A, Jia, SF, Xu, B, Worth, LL, et al. (2001). Growth suppression of established human osteosarcoma lung metastases in mice by aerosol gene therapy with PEI-p53 complexes. Cancer Gene Ther 8: 619-627.

170. Tan, ML, Choong, PF, and Dass, CR (2009). Osteosarcoma: Conventional treatment vs. gene therapy. Cancer Biol Ther 8: 106-117.

171. Xu, HJ, Zhou, Y, Seigne, J, Perng, GS, Mixon, M, Zhang, C, et al. (1996). Enhanced tumor suppressor gene therapy via replication-deficient adenovirus vectors expressing an N-terminal truncated retinoblastoma protein. Cancer research 56: 2245-2249.

172. Khanna, C, Wan, X, Bose, S, Cassaday, R, Olomu, O, Mendoza, A, et al. (2004). The membrane-cytoskeleton linker ezrin is necessary for osteosarcoma metastasis. Nat Med 10: 182-186.

173. Choong, PF, Ferno, M, Akerman, M, Willen, H, Langstrom, E, Gustafson, P, et al. (1996). Urokinase-plasminogen-activator levels and prognosis in 69 soft-tissue sarcomas. Int J Cancer 69: 268-272.

174. Dass, CR, Nadesapillai, AP, Robin, D, Howard, ML, Fisher, JL, Zhou, H, et al. (2005). Downregulation of uPAR confirms link in growth and metastasis of osteosarcoma. Clin Exp Metastasis 22: 643-652.

175. Chen, G, Deng, C, and Li, YP (2012). TGF-beta and BMP signaling in osteoblast differentiation and bone formation. Int J Biol Sci 8: 272-288.

104

BIOGRAPHICAL SKETCH

Yuan Lu was born on May 21,1987, in Shanghai, China to Fang Lu and Xiuping

Mu. Motivated by her Grandfather, Ting Lu, a chemistry teacher, she shows a long-term

interest in science.

She received a B.S. degree in pharmacy from Fudan University, China in 2009,

with several awards and honors. Her enthusiasm for research started from the training

in Professor Yunqiu Yu’s lab working on pharmaceutical analysis. She was able to

develop a novel HPLC method for the detection of Rhodamine 123 in cell lysate which

is published in Chromatographia as the second author. In the senior year, she was

selected by Fudan University to conduct her bachelor’s thesis work at the University of

Florida.

In 2009, she joined Dr. Arun Srivastava’s lab. Dr. Srivastava has been involving

in the study of basic virology of adeno-associated virus (AAV) and its application as a

gene therapy vector for more than 30 years. She was impressed by his strong belief in

AAV as one of the best vectors for human gene therapy applications.

In 2011, encouraged by Dr. Srivastava, she applied for the Ph.D. program in UF

and was very fortunate to join Dr. Steven C. Ghivizzani’s lab. For her doctoral project,

she developed a novel AAV targeting platform for osteosarcoma and extended the

application of this technique to other cancer as well. Her hard work and dedication has

been recognized in the form of several honors and awards, as follows:

Nomination by University of Florida to apply for 2013 and 2014 HHMI

international student research fellowships; Outstanding Poster Presentation Award at

the American Society of Gene and Cell Therapy 17th Annual Meeting; Outstanding

105

International Student Award in 2014; Clinical and Translational Science Institute Pilot

Project Award in 2015; One of thirteen students to represent University of Florida for

2015 Florida statewide graduate student research symposium; Bronze Award at the

University of Florida Medical Guild 41st Annual Graduate Student Research

Competition; Meritorious Abstract Travel Award at the American Society of Gene and

Cell Therapy 19th Annual Meeting; Travel Award four years in a row from the University

of Florida for supporting her to attend national conferences.

By YUAN LU

Documents

Transcript of By YUAN LU