1

HBX-INDUCED EXPRESSION OF THE CXC CHEMOKINE IP-10 IS MEDIATED THROUGH ACTIVATION OF NF-KAPPAB AND INCREASES

MIGRATION OF LEUKOCYTES Yu Zhou1, Shuo Wang3, Jing-Wei Ma1, Zhang Lei2, Hui-Fen Zhu1, Ping Lei1, Zhuo-Shun Yang2, Biao Zhang2, Xin-Xin Yao1, Chuan Shi1, Li-Fang Sun1, Xiong-Wen Wu1, Qin Ning4, Guan-Xin

Shen1, Bo Huang2 Department of Immunology1, Department of Biochemistry and Molecular Biology2, Department of

Infectious Disease4, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, Hubei Province, People's Republic of China;

Lady Davis Institute, McGill University, Sir Mortimer B. Davis-Jewish General Hospital, Montreal, Quebec, Canada3

Address correspondence to: Guan-Xin Shen, Department of Immunology, Tongji Medical College, HUST, 13# Hangkong Road, Wuhan 430030, P.R.China. Fax: 86-27-83693500, E-mail: guanxin_shen@yahoo.com.cn; Bo Huang, Department of Biochemistry and Molecular Biology, Tongji Medical College, HUST, 13# Hangkong Road, Wuhan 430030, P.R.China. Fax: 86-27-83693500, E-mail: tjhuangbo@hotmail.com

IFN-γ inducible protein 10 (IP-10) involves the inflammatory cell recruitment and cellular immune damage during virus infection. Although the increase of peripheral IP-10 level is known in HBV-infected patients, the molecular basis of HBV infection inducing IP-10 expression has remained elusive. In the present study, we demonstrate that hepatitis B virus protein X (HBx) increases IP-10 expression in a dose-dependent manner. The transfection of HBx-expressing vector into HepG2 cells results in the nuclear translocation of NF-κB, which directly binds the promoter of IP-10 at the position from -122 to -113, thus facilitating the transcription. The addition of NF-κB inhibitor, blocks the effect of HBx on IP-10 induction. In parallel, the increase of NF-κB subunits p65 and p50 in HepG2 cells also augments IP-10 expression. Furthermore, we show that HBx induces the activation of NF-κB through TRAF2/TAK1 signaling pathway, leading to the upregulation of IP-10 expression. As a consequence, the upregulation of IP-10 may mediate the migration of peripheral blood leukocytes (PBLs) in a NF-κB-dependent manner. In conclusion, we report a novel

molecular mechanism of HBV infection inducing IP-10 expression, which involves viral protein HBx affecting NF-κB pathway, leading to the transactivation of IP-10 promoter. Our study provides insight into the migration of leucocytes in response to HBV infection, thus causing immune pathological injury of liver.

Hepatitis B virus (HBV) infection is a main health problem worldwide by causing acute and chronic liver disease and has become a main health problem worldwide. Although no direct cytopathic effect on hepatocytes, HBV infection induces the infiltration of immune cells, leading to the formation of necroinflammatory foci, thus mediating disease processes (1,2). To date, the migration of immune cells to inflammatory site is known to be triggered by chemokine signaling (3).

Chemokines are a family of small chemotactic cytokines that contain between two and four highly conserved NH2-terminal cysteine amino acid residues. They function to recruit and activate immune cells to inflammatory sites through binding to a subset of G protein-coupled receptors (4). IFN-γ inducible

http://www.jbc.org/cgi/doi/10.1074/jbc.M109.067629The latest version is at JBC Papers in Press. Published on February 17, 2010 as Manuscript M109.067629

Copyright 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

2

protein 10 (IP-10, CXCL10) is a CXC chemokine that can be secreted by hepatocytes and sinusoidal endothelium in the liver of hepatitis patients (5,6). By binding CXCR3 receptor, IP-10 exerts the chemoattracting effect on NK cells, activated T cells, and dendritic cells (7). In IP-10-/- mice, immune responses to infection by neurotropic mouse hepatitis virus are reduced, concomitant with decreased CD4+

and CD8+ lymphocyte trafficking to the brain and reduced production of inflammatory factors (8). In HBV transgenic mice, the blockade of IP-10 significantly decreases the migration of mononuclear cells and the severity of liver lesions induced by HBV-specific CTLs (9). Interestingly, the mRNA and protein levels of IP-10 in PBMCs, sinusoidal endothelium and plasma are all increased in patients with chronic hepatitis B (10). Therefore, the induction of IP-10 is an important event for the development of hepatitis B. However, the molecular basis of how IP-10 is regulated for the induction and function exertion still remains elusive so far.

The above analysis indicates that the induction of IP-10 in hepatitis B patients may play an important role in driving leukocyte migration and causing the development of the immune-mediated injury. However, to date, the mechanism of how HBV induces IP-10 expression still remains elusive. It is known that HBV genome encodes DNA polymerase, surface antigen (HBs), core protein (HBc), and nonstructural regulatory protein HBx (11). Among them, HBx is a pleiotropic protein involved in viral replication, signal transduction, and HBV-mediated carcinogenesis (12,13). HBx is located at either the cytosol or the nucleus. The former may activate the signal transduction cascade, whereas the latter activates specific transcription factors (14). HBx does not bind DNA directly but transactivates multiple transcription factors including AP1 (15), NF-κB (16,17), HIF-1 (18), and ATF/CREB (19,20). Among them, NF-κB has gained much attention

due to its pivotal role in regulating an exceptionally large number of genes, particularly those involved in the immune and inflammatory responses (21,22).

Multiple viruses may regulate the expression of IP-10, such as HRV (23), Sendai virus (24), measles virus (25), rabies virus (26), SARS coronavirus nsp-1 (27), and HIV gp120 (28). This hints that HBV probably has the same effect. In this study, we hypothesize that HBx regulates the expression of IP-10 through NF-κB pathway. Our data show that the HBx protein increases IP-10 expression by promoting the binding of NF-κB on the κB1 binding site of 5’-UTR of IP-10 in a dose- dependent manner. The activation of NF-κB by HBx involves signal molecules TRAF2 and TAK1, thus leading to the upregulation of IP-10 expression. In turn, the upregulation of IP-10 mediates the migration of peripheral blood lymphocytes (PBLs). These findings provide a new insight into the regulatory mechanism of leukocyte recruitment and infiltration to HBV infection site.

Experimental Procedures

Patients Twelve patients (8 male, 4 female; age range 32-65 years, average 48±9) with chronic hepatitis B who underwent surgery treatment for cancers were selected from the Union Hospital of Tongji Medical College for IP-10 detection in the liver tissues by real-time PCR and immunohistochemistry. These patients were positive for HBsAg, HBeAg, anti-HBc and HBV-specific DNA in serum. Other causes of chronic liver disease had been excluded by clinical and laboratory assessments. Seven patients with non-HBV infection underwent surgery for cancers were also selected. Five normal control liver tissues with non-HBV-infection were obtained from macroscopically normal area during liver hemangioma resection.

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

Cell lines and cell culture- Human hepatocellular cell lines HepG2 and HepG2.2.15 (expressing the whole HBV proteins persistently) were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% FBS at 37°C in a 5% CO2 incubator. HBx-expressing HepG2 cell line, transfected with the pCMV-HBx plasmid and stably expressed the HBx protein, was cultured with 500μg/ml G418 and 10% FBS at 37°C in a 5% CO2 incubator. RNA extraction and real time-PCR- The total RNA of fresh tissue samples was extracted using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. cDNA was synthesized as described previously (29). Equal amounts of cDNA were submitted to PCR, in the presence of the SYBR-PCR Mastermix kit (Applied Biosystems, Foster City, CA) and the real time PCR detection machine Mx3000PTM (Stratagene, La Jolla, CA). IP-10 specific primers were as follows: forward primer 5’-GCC TCTCCCATCACTTCCCTAC-3’; reverse primer 5’-GAAGCAGGGTCAGAACATCCAC-3’. The housekeeping gene GAPDH was used as an internal control. Immunohistochemistry- Immunohistochemical staining was described previously (30). In brief, after deparaffinization and hydration, the slides were treated with endogenous peroxidase in 0.3% H2O2 for 30 min. Then, the sections were blocked for 2 hrs at room temperature with 1.5% blocking serum. Sections were incubated with anti-IP-10 antibody (Abcam, Cambridge, MA) at 4°C overnight. Labeled HRP was applied for 30 min at room temperature, followed by application of diaminobezidine (DAB) solution until color developed. Slides were counterstained with hematoxylin. The results were observed under a light microscope. Preparation of promoter constructs- A 1050-bp IP-10 promoter construct, corresponding to the sequence from -953 to +97 (relative to the transcriptional start site) of the 5’-flanking region of the human IP-10 gene, was generated

from human genomic DNA using forward 5’-TTTGCTAGCCAGTTATCACTGTTACTAGC-3’ and reverse 5’-AAACTCGAGGGCAGC AAATCAGAATGGCA-3’ primers. Using the (-953/+97) IP-10 construct as a template, several deletion constructs of the IP-10 promoter, including -534/+97, -239/+97, -191/+97, and -97/+97, were similarly generated by corresponding forward primers: 5’-TTTGCTAG CACTTGCCAGTTCCAGATCTT-3’, 5’-TTTG CTAGCGAAACAGTTCATGTTTTGGAA-3’, 5’-TTTGCTAGCAAAAGAGGAGCAGAGGG AAAT-3’ and 5’-TTTGCTAGCGGTTTTGCTA AGTCAACTGTAA-3’. Point mutations in two NF-κB sites, NF-κB1 and NF-κB2, were generated in the (-534/+97) IP-10 construct using standard site-directed mutagenesis procedures. For NF-κB1, a mutant reverse primer 5’-GTTCCTGGtGAAGTCaCATGTTG CAGAC-3’ was annealed in combination with the previously described forward primer and subjected to PCR amplification. Meanwhile, a mutant forward primer 5’-GCAACATGtGACT TCaCCAGGAACAGCC-3’ was annealed in combination with the previously described reverse primer and PCR amplification. The amplified product was gel purified and ligated into pGL3-Basic vector. A point mutant construct for NF-κB2 was generated by the same strategy with mutated primers 5’-GGAGCAGA GtGAAATTaCGTAACTTGGA-3’ and 5’-CAA GTTACGtAATTTCaCTCTGCTCCTC-3’. All constructs were sequenced for success. Vectors containing individual viral structural genes of HBV and NF-κB subunits were kindly provided by Dr. Wen-Jie Huang (State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, People's Republic of China). The pNF-κB-Luc (Stratagene, La Jolla, CA) containing four copies of the binding sequence of NF-κB and firefly luciferase gene was used in NF-κB activity detection. RNA Interference- A series of double-stranded

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

small interfering RNA targeting HBs, HBc, HBx protein of HBV had been cloned into a siRNA-expressing vector pGenesil-1. The validity and efficiency of these siRNA plasmids had been identified by determining the mRNA and protein levels of corresponding target gene after transfecting them or mock vector into HepG2.2.15 cells. For the assay, cells were plated at a density of 1×105 cell/well in a 24-well plate. After 24 h, cells were transfected 0.8μg siRNA plasmids per well or mock vector using lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. HBx-expressing HepG2 cells were plated at a density of 5×105 cell/well in a 6-well plate. TRAF2 siRNA or TAK1 siRNA (Santa Cruz, Santa Cruz, CA) per well was used to knock down TRAF2 or TAK1 expression in HBx-expressing HepG2 cells according to the manufacture’s instructions. Transfections and reporter gene assays- HepG2 cells were plated at a density of 1×105 cell/well in a 24-well plate. After 24 h, cells were transfected with 0.8μg of the full-length gene of HBV (pBlue-HBV), different HBV protein expressing plasmids, p50 or p65 expressing plasmid, respectively. For luciferase assay, cells were co-transfected with 0.6 μg of expression vector plasmids, 0.18 μg of promoter reporter plasmids, and 0.02 μg of the pRL-TK plasmids. 5 hrs later, cells were washed and allowed to recover in fresh medium supplemented with 1% FBS. 48 hrs later, luciferase activity was detected with the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI) according the manufacturer’s instructions. The relative luciferase activity was determined by a ModulusTM Laboratory Luminometer (Turner Biosystems, Sunnyvale CA), and the transfection efficiency was normalized by Renilla luciferase activity. Electrophoretic Mobility Shift Assay (EMSA)- Nuclear extracts were prepared as previously

described (31) from HepG2 cells transfected relative expression vector plasmids. Biotin end-labeled oligonucleotides were synthesized and annealed to obtain double-stranded DNA fragments. The oligonucleotide sequences of NF-κB1 were as follows: 5’-CATGGGACTTCC CCAGGAACAGC-3’ and 5’-GCTGTTCCTGG GGAAGTCCCATG-3’. EMSA was performed using LightShift® Chemiluminescent EMSA Kit (Pierce, Rockford, IL) according to the manufacturer’s protocol. Briefly, the binding reactions were performed in 20μl samples containing 1μl Biotin-labeled oligonucleotides, 4 mg of nuclear extracts, 2 mg of d (I-C), 2 μl 10× binding Buffer, 0.1 mM EDTA, and 10% glycerol. After incubation at room temperature for 20 min, samples were separated on 6% polyacrylamide gels with 0.5×TBE buffer and transferred to a nylon membrane (Amersham Biosciences, Pharmacia, UK) at 380 mA (~100V) for 15 min. A chemiluminescent detection of membranes was scanned by Image Station 4000R (Kodak, Rochester, NY). The specificity of protein-DNA interaction was confirmed by competition with 20-fold or 100-fold of unlabeled probes of the same sequence, or the NF-κB1 mutated probes: 5’-CATGtGACTTCaC CAGGAACAGC -3’. Chromatin immunoprecipitation assay (ChIP)- ChIP assays were carried out using a commercial ChIP assay kit (Upstate Biotechnology, Billerica, MA). Briefly, HepG2 cells transfected with relative plasmids were cross-linked histones to DNA using 1% formaldehyde at 37 °C for 10 min. After washing with cold PBS, cells were scraped into conical tube and sonicated to shear the chromatins. The sonicated chromatins were incubated with anti-p65 antibody, anti-p50 antibody or an isotype control IgG for 2 hrs. The chromatin-antibody complex was precipitated with protein-A-agarose beads. The DNA isolated from the complex was subject to PCR amplification using the following primers flanking the NF-κB1 site in IP-10 promoter:

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

5’-AACTTGGAGGCTACAATAAA-3’ and 5’- GAGGAATGTCTCAGAAAACG -3’. Confocal Laser Scanning Microscopy- HepG2 cells were cultured on coverslips at a density of 5×104 cells per coverslip. After transfection relative plasmids for 48 hrs, cells were fixed with ice-cold methanol for 10 min, blocked with 1% bovine serum albumin in PBS for 1hr and probed for 90 min at room temperature with anti-p65 antibody (Santa Cruz, Santa Cruz, CA). After probing, the signal was visualized with FITC-conjugated second antibody (Sigma- Aldrich, St. Louis, MO). Nuclei were stained using DAPI (Sigma-Aldrich, St. Louis, MO). Micrographs were acquired with a BX51 system equipped with DP70 (Olympus, Japan). ELISAs- The amounts of IP-10 present in culture supernatants were determined using a specific rat anti-human IP-10 ELISA kit (eBioscience, San Diego, CA) according the manufacturer’s instructions. Western blotting- Total proteins, nuclear proteins and cytoplasmic proteins were prepared as previously described (32), separated by stacking gel and SDS- PAGE separating gel with Tris-glycine system at 100 V for 1 hr, and transferred to PVDF membranes (Millipore, Billerica, MA). The membranes were blocked in 5% nonfat dry milk in PBS containing 0.1% Tween-20 for 2 hrs at room temperature. Then the membranes were incubated with specific anti-p65 antibody (Santa Cruz, Santa Cruz, CA), anti Phospho-TAK1 (Thr184) antibody (Cell Signaling Technology, Boston, MA) or p-IKKα (Thr 23) antibody (Santa Cruz, Santa Cruz, CA) overnight at 4°C. The membranes were washed three times and incubated with HRP-conjugated secondary antibody. Proteins were visualized by ECL Western blotting substrate (Themo Pierce, Rockford, IL). Migration Assay- Migratory activity was quantified using 24-well Transwell inserts (5-μm pore size, Costar, Bethesda, MD). PBLs (1×105) in 200 µl of RPMI medium were added to the

upper chamber. 1 ml culture supernatant from the cells transfected with relative plasmids was added to the lower chamber. To investigate the role of IP-10 in cell migration, 10 μg of neutralizing anti-IP-10 antibody (Abcam, Cambridge, MA) isotype-matched control antibody was added 30 min prior to the migration assay. Supernatants of HepG2 cells tranfected with pCMV-HBx following treated with NF-κB inhibitor SN-50 (Upstate Biotechnology, Lake Placid, NY) were also investigated. The chambers were incubated for 4 hrs at 37°C in 5% CO2, then the Transwell inserts were removed and the migration cells were HE stained and counted. Data analysis- Data were expressed as means ± SD of three determinations. Statistical analysis Data was analyzed using the Statistical Package for Social sciences (SPSS) software (Version 13.0). Statistical comparisons were made using Student’s t-test, with P< 0.05 being considered significant.

RESULTS

Upregulation of IP-10 expression in

HBV-infected liver tissues. The upregulation of IP-10 expression has been

reported in PBMCs, plasma and liver of patients with chronic hepatitis B (10). To confirm the previous report, we analyzed the expression of IP-10 in HBV-infected liver tissues tissues, and found that the mRNA levels of IP-10 were much higher in HBV positive liver cancer tissues, compared to HBV negative liver cancer tissues or normal liver tissues (Fig. 1A). The similar protein result was also confirmed by immunohistochemical staining (Fig. 1B). These data suggested that IP-10 is elevated in HBV-infected liver tissue, and may play an important role in HBV infection-induced hepatitis.

HBx induces IP-10 gene expression in HepG2 cells. To evaluate the effect of HBV on IP-10

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

expression, HepG2 cells were transfected with the full-length HBV gene (pBlue-HBV) for 48 hours and the protein levels of IP-10 in the supernatants were measured. As shown in Fig. 2A, IP-10 protein was significantly increased in pBlue-HBV-transfected group relative to control. We then evaluated the effect of different HBV proteins by transfecting pCMV-HBs, pCMV-HBc and pCMV-HBx, respectively. The result showed that the transfection of HBx- rather than HBs- or HBc-expressing vector increased IP-10 protein levels (Fig. 2A). Consistently, using siRNA technology, we found that knowndown of HBx gene significantly decreased the protein levels of IP-10 in HepG2.2.15 cells (Fig. 2B). The efficiencies of transfection and gene silencing were determined in Fig. 2, C and D. Interestingly, we found knockdown either HBs or HBc gene had no effect on IP-10 expression in HepG2.2.15 cells (Fig. 2B). Together, these data suggested that HBx is a critical regulator for IP-10 expression during HBV infection.

To determine whether HBx induces IP-10 gene transcription though promoter, a human IP-10 promoter reporter plasmid containing the sequence from -953 to +97 (relative to the transcriptional start site) of 5’-flanking region was co-tranfected with individual HBV protein-expressing plasmids (pCMV-HBs, pCMV-HBc, or pCMV-HBx) or mock plasmid (pCMV-tag2) into HepG2 cells. The result showed that IP-10 promoter was markedly activated by HBx protein in a dose-dependent manner (Fig. 2, E and F). In line with this, a gradual increased level of HBx protein in HepG2 cells was confirmed by Western blot (Fig. 2G).

NF-κB activity is required for HBx-induced IP-10 expression. Analysis with Genomatix MatInspector program and Gene2Promoter software revealed the presence of many consensus cis-elements including GAS, ISRE, AP-1, and NF-κB binding sites on the IP-10 promoter (Fig. 3A). To investigate the role of

these cis-elements in regulating IP-10 expression by HBx protein, a series of 5’ deletions of IP-10 promoter were constructed and co-transfected with pCMV-HBx, respectively, into HepG2 cells. Luciferase activity was measured 48 hrs after transfection. As shown in Fig. 3B, the deletion from nt -953 to nt -190 did not affect HBx-induced luciferase activity, however deletion to nt -96 significantly decreased HBx-induced luciferase activity, suggesting that the sequence between nt -190 to -96 is critical for activation of IP-10 promoter by HBx protein. Coincidently, two NF-κB binding sites (NF-κB1, and NF-κB2) were found in this region, and could be the reason for IP-10 activation. Thus, we mutated these two NF-κB sites by multiple rounds of PCR, and found that only mutation of NF-κB1 but not NF-κB2 binding site effectively reduced HBx-induced activation of IP-10 promoter (Fig. 3C). These data suggested that the NF-κB1 binding site is required for the activation of IP-10 promoter regulated by HBx protein.

To further determine the roles of NF-κB in the activation of IP-10 promoter by HBx protein, HepG2 cells were treated with different concentrations of NF-κB inhibitor SN50 after co-transfection with pCMV-HBx and -953 to +97 IP-10 reporter plasmid. Results from luciferase activity assay showed that blocking NF-κB by SN50 resulted in the inhibition of IP-10 promoter activity (Fig. 3D), suggesting that NF-κB activation is required to activate the IP-10 promoter by HBx protein.

NF-κB binds to the promoter of HBx-induced IP-10 directly. Next, we asked whether the activated NF-κB bound to IP-10 promoter directly. For this purpose, we performed EMSA with a probe of biotin-labeled NF-κB1 binding oligonucleotides in the IP-10 promoter (−125 to −102), and found that the DNA binding activity of NF-κB was significantly increased in the cells transfected with pCMV-HBx, compared with mock plasmid (Fig. 4A). To determine the

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

specificity of NF-κB binding activity, nuclear extracts were incubated with the labeled NF-κB1 binding oligonucleotides in the presence of either an unlabeled wild type NF-κB binding probe or a mutated probe. As shown in Fig. 4A, the wild type NF-κB binding oligonucleotides, but not the mutated oligonucleotides abrogated NF-κB complexes. Consistently, the addition of NF-κB inhibitor SN50 also inhibited the DNA binding activity of NF-κB (Fig. 4A). These data indicates the NF-κB binds to the NF-κB1 binding site in the IP-10 promoter.

Using a comparable approach, we also performed a ChIP assay. Chromatin fragments were prepared from HepG2 cells transfected with pCMV-HBx and immunoprecipitated with antibody against either the p50 or p65 subunit. A 177-bp DNA fragment was amplified by PCR from DNA isolated from cells transfected with pCMV-HBx in the presence of anti-p50 or anti-p65 antibody, but they were not detected in the presence of mock plasmid or control antibody (Fig. 4B). Thus, these data suggested that the NF-κB binds to the NF-κB1 binding site in the IP-10 promoter.

HBx induces translocation of NF-κB subunits p65 into the nucleus. NF-κB is composed of homo- and heterodimers, typically p65 and p50 heterodimers. After the destruction of IκB, NF-κB is capable of translocating into the nucleus and tansactivates target genes (33). We examined the effect of HBx protein on the translocation of p65 from cytosol to nucleus after transfection pCMV-HBx into HepG2 cells. Nuclear translocation of p65 was defined by confocal microscopy. As showed in Fig. 5A, transfection with pCMV-HBx, but not pCMV-tag, caused a remarkable translocation of the p65 subunit of NF-κB from the cytosol to the nucleus. In addition, we also tested HBV-transfected HepG2.2.15 cell line. The similar result was observed; and the knockdown of HBx expression by transfecting the siRNA impaired p65 translocation (data not shown).

Moreover, at 0, 24, and 48 h post-transfection of pCMV-HBx, protein levels of p65 in the cytosol and nucleus fractions were analyzed by Western blot using anti-p65 antibody. As shown in Fig. 5C, the levels of p65 protein decreased in cytosol and increased in nucleus in parallel with the transfection time. However, this phenomenon was not observed in cells transfected with pCMV-tag (data not showed). Together, these data suggested that HBx protein facilitates the translocation of p65 from the cytosol to the nucleus.

NF-κB subunits p65 and p50 increase the transcriptional activity of IP-10. NF-κB is composed of homo- and heterodimers, typically p65 and p50 heterodimers. To investigate the effect of p50 and p65 subunits of NF-κB on the transcriptional activation of IP-10, HepG2 cells were transfected with the plasmid expressing p65 or p50, and the protein levels of IP-10 were determined by ELISA. As shown in Fig. 6A, the transfection of p50 or p65 protein increased the IP-10 protein levels, and IP-10 reached the highest level when both p50 and p65 proteins were present. Furthermore, we co-transfected HepG2 cells with plasmids expressing p65 or p50 and the IP-10 (-534/+97) reporter plasmids. Results from luciferase activity assays showed that the transcriptional activity of IP-10 was higher in the presence of p50 or p65 protein comparing to that of control (Fig. 6B). And the highest level was reached when both p50 and p65 proteins were present (Fig. 6B). However, mutating NF-κB1 binding site in the IP-10 promoter abolished the effect of p50 and/or p65 protein on the activation of the IP-10 promoter (Fig. 6B). Therefore, these data suggested that the p65/p50 heterodimer induces IP-10 expression.

HBx-induced IP-10 expression is mediated by TRAF2/TAK1/ NF-κB signaling pathway

Mechanisms on the activation of NF-κB by HBx have been reported before (16,34). However, the upstream molecular event still

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

remains largely unknown. Numerous studies have demonstrated that NF-κB can be activated through Toll-like receptor (TLR) signaling pathway. TLRs are a type of pattern recognition receptor (PRR) and recognize molecules that are broadly shared by pathogens but distinguishable from host molecules, collectively referred to as pathogen-associated molecular patterns (PAMPs) (35). After binding to ligand, TLR signaling is transducted and the scaffold intermediate kinase TAK1 is activated, which subsequently activates IKK, leading to the activation of NF-κB. Since HBx is a viral protein, it can also be considered as a PAMP. In this regard, we here hypothesized that HBx induced the activation of NF-κB via activating TAK1. After transfection of HBx plasmid into HepG2 cell line, the phosphorylation of TAK1 and IKKα was observed in HBx plasmid group, but not in mock or PBS group (Fig. 7, A and B). 5Z-7-Oxozeaenol is a specific inhibiter of TAK1 by competing with ATP to bind TAK1, thus inhibiting TAK1 activity (36). Therefore, we here further used (5Z)-7-Oxozeaenol to block the activity of HBx-induced TAK1 in HepG2 cells. As shown in Fig. 7C, both NF-κB activity and IP-10 promoter activity were reduced by TAK1 inhibition. In parallel, the knockdown of TAK1 by the siRNA also caused the decrease of NF-κB and IP-10 promoter activities (Fig. 7, D- F). Together, these data suggested that HBx indeed may activate NF-κB via activating TAK1/IKK.

To further investigate the upstream signal molecule(s) which results in the activation of TAK1, we concentrated on TRAF2 due to (1) TRAF family members such as TRAF6 and TRAF2 participate in the activation of TAK1; (2) document had reported that HBx may activate TNFR1 (37) and TRAF2 is the adaptor for TNFR1 signaling. For this purpose, we knocked down TRAF2 gene by transfecting TRAF2 siRNA into cells. The efficiency of TRAF2 siRNA was confirmed by western bolt. (Fig. 7,

D and E) Under such condition, we measured the NF-κB and IP-10 promoter activity induced by HBx. The result showed that TRAF2 knockdown impaired the NF-κB activity induced by HBx. (Fig. 7F). Consistently, the knockdown of TRAF2 or TAK1 resulted in the inhibition of the nuclear translocation of NF-κB subunit p65 (Fig. 5A). The levels of ectopic HBx protein as well as the the levels TRAF2 and TAK1 in cells transfected with the respective siRNA and controls were shown by western blots (Fig. 5B). Taken together, our data suggested that HBx-induced IP-10 expression might be mediated by TRAF2/TAK1/ NF-κB signaling pathway.

HBx-induced IP-10 increases migration of peripheral blood leukocytes (PBLs). To define the functionality of the secreted IP-10, we performed migration assay. With the 4h time frame of the experiment, minimal migration of PBLs was observed in response to supernatant from HepG2 cells tranfected with mock plasmid; however PBLs exhibited decent increase of migratory activity in response to supernatants from cells transfected with plasmids expressing HBx, p50, or p65 (Fig. 8). The addition of neutralizing anti-IP-10 but not the control antibody to the supernatants significantly impaired this migration (Fig. 8). Interestingly, we additionally found that the treatment with NF-κB inhibitor SN50 after transfection of pCMV-HBx could decrease the chemotactic activity (Fig. 8). Together, these data suggested that HBx-induced IP-10 may mediate the migration of PBLs and NF-κB activity is involved in this process.

DISCUSSION

During HBV infection, the increase of chemokine IP-10 is a critical step for the inflammatory cell recruitment and hepatopathology. In the present study, we demonstrate the increase of IP-10 levels in

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

HBV-infected patients, and elucidate the molecular mechanism of IP-10 expression through viral regulatory protein HBx-activated NF-κB signaling pathway in human hepatocellular cell line HepG2. We also define that the HBx-induced IP-10 can attract inflammatory cells in vitro.

The regulation of IP-10 expression has been reported by various transcription factors and signal elements. For instance, the phosphorylation of STAT1 could transcriptionally activate IP-10 though ISRE-binding factors (38-40); and signal molecules such as PKC, PKA, Akt and p38 MAPK may be involved the regulation (41-44). Regardless of these, the mechanism of the increase of IP-10 expression in individuals carrying HBV (10) remains elusive so far. Here, we demonstrate that HBx rather than HBs or HBc encoded by HBV activates IP-10 expression. Different from HBs or HBc, HBx profoundly influences various signaling pathways. HBx protein interacts with and stimulates many kinases such as PKC, Jak1, IKK, PI-3-K, SAPK and Akt/PKB (12,37,45-47). The 154 amino acids of HBx protein contain regions important in transactivation, dimerization, p53 binding, and 14-3-3 protein binding (13). In this study, we find that HBx tansactivates IP-10 by activating and translocting NF-κB to nucleus. Although interferons α/β or γ are known as the inducer for IP-10 via STAT1 signaling pathway (38,48), our unpublished data confirm that the levels of IFN-α, IFN-β, IFN-γ mRNAs and proteins are not changed in HepG2 cells after transfection of HBx vector. Thus, interferons are unlikely involved in HBx-induced IP-10 expression. Nevertheless whether other signaling pathway(s) contributes to HBx-induced IP-10 expression still needs to be clarified, if considering that HBx targets multiple signaling pathways.

NF-κB can be homo- or heterodimers, made up of different members of the Rel family of

proteins (p50/NF-κB1, p52/NF-κB2, c-rel/Rel, p65/Rel-A, Rel-B and Dorsal). Of these, the p50/p65 heterodimer (commonly referred to as NF-κB) is the most abundant and ubiquitous. In this study, we find the heterodimer of p50 and p65 involved in HBx-induced IP-10 expression, evaluated by EMSA and ChIP assays. These results are further confirmed by the transfection of wild type p50 and p65 into HepG2 cells and the followed increase of IP-10 expression. Previous studies have reported that HBx activated NF-κB through multiple ways, including 1) HBx may induce the degradation of IκBα and the p105 via phosphorylation of these proteins (16); 2) HBx directly interacts with IκBα and IκBε, leading to translocation of NF-κB into the nucleus (34); 3) HBx protein may activate hepatic NF-κB via TNFR1(37); 4) collaboration of HBx with hepatitis B virus X-associated protein is also capable of coactivating NF-κB signaling (49). In addition, several upstream signal transduction cascades defined to involved in the HBx-induced activation of NF-κB, including PKC, Src, Ras and Akt, have been identified (12,14,39,45). In this study, we define another upstream signaling pathway. HBx may activate NF-κB activity though phosphorylation of TAK1 and IKK. Blockade TAK1 activity by its specific inhibitor markedly inhibits NF-κB activity and IP-10 luciferase activity. As a pivotal factor for MAPK and NF-κB activation in response to TLR, IL-1R and TNFR stimulation (40), TAK1 activation requires the participation of TRAF family members such as TRAF2 and TRAF6. Here, we further confirm that TRAF2 is required for HBx-induced NF-κB activation.

IP-10 shares the receptor CXCR3 with CXCL9 (Mig) recruiting inflammatory cells to the sites of infected tissues and may exaggerate the immune-mediated injury. In mouse model of hepatitis virus infection, treatment with either anti-IP-10 or anti-Mig antibody shows a decrease of T cell infiltration into brain (41,42).

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

Similarly, in HBV transgenic mice, Blockade of IP-10 significantly reduces the recruitment of host-derived inflammatory cells into the liver and the severity of the liver damage (9). Those findings demonstrate that CXCR3 signaling is critical in the leukocytic chemotaxis and the pathogenesis of liver disease after HBV infection. Interestingly, in the present study, we find that such chemotaxis activity of HBx-induced IP-10 requires the activity of NF-κB. The transfection of either p65 or p50 expression vector to cells significantly increased the chemoattractive effect, whereas the addition of NF-κB inhibitors to the culture medium significantly decreased the chemotaxis, suggesting that NF-κB is a critical mediator for HBx-resulted, IP-10-induced chemotaxis. Blockade of NF-κB pathway has served as a potential strategy to treat inflammatory diseases and tumors, such as rheumatoid arthritis, myeloma, T-cell leukemia/lymphoma (43,44,50).

Our findings further suggest that targeting NF-κB pathway is a potential therapeutic strategy against HBV-related inflammatory damage, which not only blocks IP-10 generation but also impairs its chemotatic function.

In summary, the data reported here show for the first time that HBx protein encoded by HBV induces IP-10 expression directly in hepatocytes, and the binding of NF-κB to the NF-κB1 site in the IP-10 promoter is important for HBx-induced IP-10 expression. The underlying molecular mechanism involves TRAF2/TAK1-mediated signaling pathway. Our data also indicate that NF-κB signaling pathway play an important role in the chemotaxis of HBx-induced IP-10. These findings may shed light on understanding how leukocytes migrate into the liver and exaggerate host-derived immune responses, and probably provide a novel therapeutic target in severe acute or fulminant hepatitis.

REFERENCE

1. Chisari, F. V., and Ferrari, C. (1995) Annu Rev Immunol 13, 29-60 2. Tiollais, P., Charnay, P., and Vyas, G. N. (1981) Science 213, 406-411 3. Luster, A. D., Wang, J., Zhao, J. H., Wang, P. P., Xiang, G. J., Lee, Y. H., Yun, Y., Doria, M., Klein, N.,

Lucito, R., and Schneider, R. J. (1998) N Engl J Med 338, 436-445 4. Rossi, D., and Zlotnik, A. (2000) Annu Rev Immunol 18, 217-242 5. Narumi, S., Tominaga, Y., Tamaru, M., Shimai, S., Okumura, H., Nishioji, K., Itoh, Y., and Okanoue, T.

(1997) J Immunol 158, 5536-5544 6. Nishioji, K., Okanoue, T., Itoh, Y., Narumi, S., Sakamoto, M., Nakamura, H., Morita, A., and Kashima,

K. (2001) Clin Exp Immunol 123, 271-279 7. Neville, L. F., Mathiak, G., and Bagasra, O. (1997) Cytokine Growth Factor Rev 8, 207-219 8. Dufour, J. H., Dziejman, M., Liu, M. T., Leung, J. H., Lane, T. E., and Luster, A. D. (2002) J Immunol

168, 3195-3204 9. Kakimi, K., Lane, T. E., Wieland, S., Asensio, V. C., Campbell, I. L., Chisari, F. V., and Guidotti, L. G.

(2001) J Exp Med 194, 1755-1766 10. Wang, J., Zhao, J. H., Wang, P. P., and Xiang, G. J. (2008) Hepatobiliary Pancreat Dis Int 7, 45-50 11. Robinson, W. S., Clayton, D. A., and Greenman, R. L. (1974) J Virol 14, 384-391 12. Kekule, A. S., Lauer, U., Weiss, L., Luber, B., and Hofschneider, P. H. (1993) Nature 361, 742-745 13. Diao, J., Garces, R., and Richardson, C. D. (2001) Cytokine Growth Factor Rev 12, 189-205 14. Doria, M., Klein, N., Lucito, R., and Schneider, R. J. (1995) Embo J 14, 4747-4757 15. Benn, J., Su, F., Doria, M., and Schneider, R. J. (1996) J Virol 70, 4978-4985

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

11

16. Su, F., and Schneider, R. J. (1996) J Virol 70, 4558-4566 17. Lucito, R., and Schneider, R. J. (1992) J Virol 66, 983-991 18. Moon, E. J., Jeong, C. H., Jeong, J. W., Kim, K. R., Yu, D. Y., Murakami, S., Kim, C. W., and Kim, K.

W. (2004) Faseb J 18, 382-384 19. Maguire, H. F., Hoeffler, J. P., and Siddiqui, A. (1991) Science 252, 842-844 20. Williams, J. S., and Andrisani, O. M. (1995) Proc Natl Acad Sci U S A 92, 3819-3823 21. Ghosh, S., May, M. J., and Kopp, E. B. (1998) Annu Rev Immunol 16, 225-260 22. Karin, M., and Delhase, M. (2000) Semin Immunol 12, 85-98 23. Spurrell, J. C., Wiehler, S., Zaheer, R. S., Sanders, S. P., and Proud, D. (2005) Am J Physiol Lung Cell

Mol Physiol 289, L85-95 24. Le Goffic, R., Mouchel, T., Aubry, F., Patard, J. J., Ruffault, A., Jegou, B., and Samson, M. (2002)

Endocrinology 143, 1434-1440 25. Nazar, A. S., Cheng, G., Shin, H. S., Brothers, P. N., Dhib-Jalbut, S., Shin, M. L., and Vanguri, P. (1997)

J Neuroimmunol 77, 116-127 26. Nakamichi, K., Saiki, M., Sawada, M., Takayama-Ito, M., Yamamuro, Y., Morimoto, K., and Kurane, I.

(2005) J Virol 79, 11801-11812 27. Law, A. H., Lee, D. C., Cheung, B. K., Yim, H. C., and Lau, A. S. (2007) J Virol 81, 416-422 28. Asensio, V. C., Maier, J., Milner, R., Boztug, K., Kincaid, C., Moulard, M., Phillipson, C., Lindsley, K.,

Krucker, T., Fox, H. S., and Campbell, I. L. (2001) J Virol 75, 7067-7077 29. Park, S. R., Lee, J. H., and Kim, P. H. (2001) Eur J Immunol 31, 1706-1715 30. Kim, S. J., Rabbani, Z. N., Dewhirst, M. W., Vujaskovic, Z., Vollmer, R. T., Schreiber, E. G.,

Oosterwijk, E., and Kelley, M. J. (2005) Lung Cancer 49, 325-335 31. Takenaka, M., Preston, A. S., Kwon, H. M., and Handler, J. S. (1994) J Biol Chem 269, 29379-29381 32. Kim, Y., and Fischer, S. M. (1998) J Biol Chem 273, 27686-27694 33. Hayden, M. S., and Ghosh, S. (2004) Genes Dev 18, 2195-2224 34. Weil, R., Sirma, H., Giannini, C., Kremsdorf, D., Bessia, C., Dargemont, C., Brechot, C., and Israel, A.

(1999) Mol Cell Biol 19, 6345-6354 35. Aderem, A., and Ulevitch, R. J. (2000) Nature 406, 782-787 36. Ninomiya-Tsuji, J., Kajino, T., Ono, K., Ohtomo, T., Matsumoto, M., Shiina, M., Mihara, M., Tsuchiya,

M., and Matsumoto, K. (2003) J Biol Chem 278, 18485-18490 37. Kim, W. H., Hong, F., Jaruga, B., Hu, Z., Fan, S., Liang, T. J., and Gao, B. (2001) Faseb J 15,

2551-2553 38. Wenzel, J., Zahn, S., Bieber, T., and Tuting, T. (2009) Arch Dermatol Res 301, 83-86 39. Kim, H., Lee, Y. H., Won, J., and Yun, Y. (2001) Biochem Biophys Res Commun 286, 886-894 40. Sato, S., Sanjo, H., Takeda, K., Ninomiya-Tsuji, J., Yamamoto, M., Kawai, T., Matsumoto, K.,

Takeuchi, O., and Akira, S. (2005) Nat Immunol 6, 1087-1095 41. Mahalingam, S., Farber, J. M., and Karupiah, G. (1999) J Virol 73, 1479-1491 42. Liu, M. T., Chen, B. P., Oertel, P., Buchmeier, M. J., Armstrong, D., Hamilton, T. A., and Lane, T. E.

(2000) J Immunol 165, 2327-2330 43. Feldmann, M., Maini, R. N., Bondeson, J., Taylor, P., Foxwell, B. M., and Brennan, F. M. (2001) Adv

Exp Med Biol 490, 119-127 44. Harousseau, J. L., Shaughnessy, J., Jr., and Richardson, P. (2004) Hematology Am Soc Hematol Educ

Program, 237-256 45. Chung, T. W., Lee, Y. C., and Kim, C. H. (2004) Faseb J 18, 1123-1125

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12

46. Diao, J., Khine, A. A., Sarangi, F., Hsu, E., Iorio, C., Tibbles, L. A., Woodgett, J. R., Penninger, J., and Richardson, C. D. (2001) J Biol Chem 276, 8328-8340

47. Lee, Y. H., and Yun, Y. (1998) J Biol Chem 273, 25510-25515 48. Rotondi, M., Lazzeri, E., Romagnani, P., and Serio, M. (2003) J Endocrinol Invest 26, 177-180 49. Shamay, M., Barak, O., Doitsh, G., Ben-Dor, I., and Shaul, Y. (2002) J Biol Chem 277, 9982-9988 50. Horie, R., Watanabe, T., and Umezawa, K. (2006) Drug News Perspect 19, 201-209

FOOTNOTES This work was supported by the National Key and Basic Research Development Program of

China (2007CB512900), State Project on Major Infectious Diseases Prevention (No. 2008ZX10002-009), Program for New Century Excellent Talents in University (NCET-08-0219), Special Research Foundation for Universities affiliated with China Ministry of Education (Z2009005).

We wish to thank Dr. Wen-jie Huang for the HBV protein expession vectors.

FIGURE LEGENDS Figure 1. IP-10 expression in human liver tissues. (A) The real-time PCR detection of IP-10 mRNA expression in HBV-infection cancer liver tissues, non-HBV-infection cancer liver tissues and normal control liver tissues. Results shown were mean ± S.D. of three experiments performed in duplicate and relative to housekeeping gene GAPDH. (B) Detection of IP-10 protein expression in liver tissues by immunohistochemistry. a, immunoreactive IP-10 protein was mainly visualized on sinusoidal endothelium and hepatocytes in HBV-infection cancer liver tissues; b, isotype IgG was used as a negative control in HBV-infection cancer liver tissues; c, immunoreactive IP-10 protein was scarcely visualized in non-HBV-infection cancer liver tissues; d, in normal control liver tissues, IP-10 protein could not be detected by immunohistochemistry.

Figure 2. HBx protein induces IP-10 expression. (A) The full-length gene of HBV (pBlue-HBV) and plasmids expressing different HBV proteins were transfected into HepG2 cells, respectively. The protein levels of IP-10 were measured by ELISA kit. The transfection efficiency was 35.8±6.2%. Results shown were mean ± S.D. of three experiments performed in duplicate. (B) siRNA-expressing vectors targeting different HBV proteins and mock plasmids were transfected into HepG2.2.15 cells, respectively. The supernatant protein levels of IP-10 were analyzed by ELISA kit. The transfection efficiency was 41.6±7.4%. The Results were a representative of three experiments. (C) The transfection efficiency of GFP-expressing HBx siRNA plasmids into HepG2.2.15 cells has been observed under fluorescence microscope. (D) siRNA-expressing vectors targeting HBx proteins and mock plasmids were transfected into HepG2.2.15 cells, respectively. The HBx mRNA levels were analyzed by real-time PCR after 48h, 72h and 96h. The mRNA levels of HBx in HepG2.2.15 cells transfected with mock plasmids were set to 1.0 and the results were relative to housekeeping gene GAPDH. (E) HepG2 cells were co-transfected with the IP-10 promoter luciferase reporter vector and different HBV protein-expressing vector, respectively. Relative luciferase activity was determined by standard procedures. The luciferase activity of mock pCMV-Tag group was designated as 1.00. (F) HepG2 cells were co-transfected with different dose of HBx-expressing vector and the reporter vector. 48h later, relative luciferase activity was determined. (G). HepG2 cells were transfected with different

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

13

dose of pCMV-HBx-FLAG, in which the sequence for FLAG epitope (DYKDDDDK) was tagged to the 3’ end of the HBx sequence, and the sequence of HBx-FLAG was inserted into pCMV-tag2 vector. The increased protein levels of HBx were determined by Western blot with anti-Flag antibody (Sigma).

Figure 3. The κB site in IP-10 promoter is involved in HBx-induced IP-10 expression. (A) Potential binding sites for cis-acting elements in 5’-flanking region of the human IP-10 gene were shown. Gene2Promoter software revealed several transcription factor binding sites, including NF-κB, ISRE, GAS. The transcription start site and translation start site were also indicated in the figure. (B) Effect of HBx protein on the truncated IP-10 promoter constructs. HepG2 cells were co-transfected with serial truncated IP-10 promoter constructs and pCMV-HBx, and relative luciferase activity was determined. The schematic constructs were shown (left), and the bar graphs were shown as the relative levels of luciferase activity in each of the transfected samples (right). (C) Effect of mutated κB sites on the activity of IP-10 promoter. HepG2 cells were co-transfected with pCMV-HBx and construct with mutated NF-κB1 or NF-κB2 site. The relative luciferase activity was determined. (D) NF-κB activity was necessary for HBx-induced IP-10 expression. HepG2 cells were co-transfected with pCMV-HBx and the reporter vector following the treatment with NF-κB inhibitor SN50 at different concentrations as indicated. After 48h, luciferase activity was measured.

Figure 4. NF-κB subunits bind to IP-10 promoter directly. (A) EMSA assay showed a direct binding of NF-κB to the NF-κB1 site o f IP-10 promoter. HepG2 cells were transfected with pCMV-HBx or mock plasmids for 48h. Nuclear extracts were subjected to EMSA with the biotin-labeled κB1 or κB2 oligonucleotides in the absence and presence of indicated folds of unlabeled competitors or unlabeled mutated competitors. In addition, NF-κB inhibitor SN50 was involved in the indicated case. (B) CHIP assay showed a direct binding of p65 and p50 to the IP-10 promoter. Amplification of a 177-bp DNA fragment containing the NF-κB1 site in the IP-10 promoter and the input DNA were shown.

Figure 5. HBx protein induces the translocation of NF-κB subunits. (A) HepG2 cells were

transfected with HBx plasmids or co-transfected with HBx plasmids and TRAF2 or TAK1 siRNA for 48 h. Cells were then fixed, permeabilized, and stained with anti-p65 antibody followed by incubation with FITC-conjugated goat anti-rabbit secondary antibody. Nuclei were counterstained with DAPI, and immunofluorescence was monitored by confocal microscopy. (B) The levels of ectopic HBx protein in cells transfected with pCMV-HBx-FLAG were shown by Western blot using the anti-flag antibody. The levels TRAF2 and TAK1 in cells transfected with the respective siRNA and controls were also shown by western blots using the anti-TRAF2 antibody or anti-TAK1 antibody. (C) Levels of cytosolic and nuclear p65 protein were determined at indicated time by Western blot using anti-p65 antibody after transfected with pCMV-HBx.

Figure 6. NF-κB subunits increase the IP-10 expression. (A) HepG2 cells were transfected with p65 and/or p50 expression constructs. IP-10 protein levels in the supernatants were measured by ELISA kit. Results shown were mean ± S.D. of three experiments performed in duplicate. (B) HepG2 cells were co-transfected with (-534/+97) IP-10 or NF-κB1 Mut reporter constructs and p65 or p50 expression constructs, respectively. After 48h, luciferase activity was measured. The luciferase

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14

activity of the cells co-transfected with pCMV-Tag2 and indicated report plasmids was set to 1.00, respectively. Results shown were mean ± S.D. of three experiments performed in duplicate. * , a statistically significant difference from mock plasmids (P<0.05).* *, a statistically significant difference from mock plasmids (P<0.01).

Figure 7. TRAF2/TAK1/NF-κB signaling pathway is involved in HBx-induced IP-10 expression. (A) HepG2 cells were transfected with HBx expression plasmids or mock plasmids. After 48h, the phosphorylation of TAK1 and IKKα was detected by western blot. HepG2 cells stimulated with 100ng/ml LPS for 30min were used as positive control. (B) Semi-quantitative analysis of p-TAK1 and p-IKKα protein levels was performed by Band-Scan software 5.0, and the expression of β-actin was used as control. This quantitative analysis represented the respective Western blot of the above (A). (C) HepG2 cells were co-transfected with NF-κB or IP-10 promoter luciferase reporter plasmids and HBx expression plasmids or mock plasmids with or without TAK1 specific inhibitor (5Z)-7-Oxozeaenol (50nM). After 48h, luciferase activity was measured. HepG2 cells stimulated with 100ng/ml LPS for 30min were used as positive control. The luciferase activity of the cells co-transfected with mock plasmids pCMV-tag2 and indicated report plasmids was set to 1.00, respectively. (D and E) The knockdown of TAK1 and TRAF2 genes. HepG2 cells were co-transfected with HBx expression plasmid and TAK1 or TRAF2 siRNA for 48 h. The protein levels of TAK1 and TRAF2 were analyzed by Western blot, respectively (D) and quantified with Band-Scan software 5.0 against internal control β-actin (E). (F) HBx-expressing HepG2 cells were co-transfected with NF-κB or IP-10 promoter luciferase reporter plasmids and TAK1 siRNA or TRAF2 siRNA. 48h later, luciferase activity was measured. The luciferase activity of the cells co-transfected with mock siRNA and indicated report plasmids was set to 1.00. In C and F of this figure, results shown were mean ± S.D. of three experiments performed in duplicate. *, P<0.05, compared to mock plasmids. * *, P<0.01, compared to mock plasmids.

Figure 8. HBx-induced IP-10 expression increases the chemotaxis. Supernatants from HepG2 cells

transfected with indicated plasmids cells were added to the lower chamber of transwell plates, and PBLs were placed in the upper chamber. The lower chamber was in the present of neutralizing anti-IP-10 antibody or control antibody. After 4h incubation, the number of migrated cells was counted in three randomly selected fields per well. Recombinant IP-10 (10ng/ml) and antibody alone (10μg/ml) were used as the positive and negative controls, respectively. The number of migrated cells in response to surpernatants from HepG2 cells tranfected with pCMV-tag was set to 100%. Results shown were mean ± S.D. of three experiments performed in duplicate. * , a statistically significant difference from mock plasmids (P<0.05). * *, a statistically significant difference from mock plasmids (P<0.01).

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

15

Figure 1

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

16

Figure 2

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17

Figure 3

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

18

Figure 4

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

19

Figure 5

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

20

Figure 6

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

21

Figure 7

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

22

Figure 8

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Guan-Xin Shen and Bo HuangYang, Biao Zhang, Xin-Xin Yao, Chuan Shi, Li-Fang Sun, Xiong-Wen Wu, Qin Ning,

Yu Zhou, Shuo Wang, Jing-wei Ma, Zhang Lei, Hui-Fen Zhu, Ping Lei, Zhuo-Shunactivation of NF-kappaB and increases migration of leukocytes

HBx-induced expression of the CXC chemokine IP-10 is mediated through

published online February 17, 2010J. Biol. Chem. 

  10.1074/jbc.M109.067629Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on April 28, 2018

http://ww

w.jbc.org/

Dow

nloaded from