btv2

8/14/2019 btv2

1/10

JOURNAL OF VIROLOGY, Sept. 2008, p. 83398348 Vol. 82, No. 170022-538X/08/$08.000 doi:10.1128/JVI.00808-08Copyright 2008, American Society for Microbiology. All Rights Reserved.

Development of Reverse Genetics Systems for Bluetongue Virus:Recovery of Infectious Virus from Synthetic RNA Transcripts

Mark Boyce, Cristina C. P. Celma, and Polly Roy*

Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT, United Kingdom

Received 15 April 2008/Accepted 30 May 2008

Bluetongue virus (BTV), an insect-vectored emerging pathogen of both wild ruminants and livestock, hashad a severe economic impact in agriculture in many parts of the world. The investigation of BTV replicationand pathogenesis has been hampered by the lack of a reverse genetics system. Recovery of infectious BTV ispossible by the transfection of permissive cells with the complete set of 10 purified viral mRNAs derived in vitrofrom transcribing cores (M. Boyce and P. Roy, J. Virol. 81:21792186, 2007). Here, we report that in vitrosynthesized T7 transcripts, derived from cDNA clones, can be introduced into the genome of BTV using amixture of T7 transcripts and core-derived mRNAs. The replacement of genome segment 10 and the simul-taneous replacement of segments 2 and 5 encoding the two immunologically important outer capsid proteins,

VP2 and VP5, are described. Further, we demonstrate the recovery of infectious BTV entirely from T7

transcripts, proving that synthetic transcripts synthesized in the presence of cap analogue can functionallysubstitute for viral transcripts at all stages of the BTV replication cycle. The generation of BTV with a fullydefined genome permits the recovery of mutations in a defined genetic background. The ability to generatespecific mutants provides a new tool to investigate the BTV replication cycle as well as permitting thegeneration of designer vaccine strains, which are greatly needed in many countries.

Bluetongue disease causes high morbidity and can cause upto 75% mortality in domestic livestock (5). Bluetongue virus(BTV), the etiological agent of the disease, is transmitted be-tween hosts by several species of biting midges of the Culi-coides genus, which determine its geographic range (27). Thevirus has a global distribution and is endemic in many tropicaland subtropical regions including the United States, Central

America, parts of South America, Africa, Southeast Asia, andnorthern Australia, with a more recent emergence into Europe(5, 8, 1416, 22, 25, 31, 39, 40; also press release fromthe World Organisation for Animal Health, Paris, France,25 August 2006, http://www.oie.int/eng/press/en_060823.htm).

BTV belongs to the Orbivirus genus of the Reoviridaefamily and has a segmented genome consisting of 10 lineardouble-stranded RNA (dsRNA) molecules (33, 36). Thegenome segments are classified from segment 1 to segment10 in decreasing order of size. The virus particle has alayered structure, the outer layer of which is lost before theremaining core particle enters the cytoplasm of the host cell(13, 34, 35). While the viral genomic dsRNAs never leave

the core particle, the core particle itself is transcriptionallyactive, synthesizing and extruding multiple capped single-stranded mRNA copies of each viral genome segment intothe host cell cytoplasm (13, 34, 35). These transcripts havethe dual roles of encoding the viral proteins and serving astemplates for the synthesis of the new viral dsRNA genomesegments present in progeny virus particles. We have re-cently shown that the transfection of in vitro synthesized

viral mRNAs from core particles into permissive cells issufficient to initiate an infection (1).

The introduction of defined mutations into the genomesof many viruses has enabled rational approaches to themolecular dissection of viral gene products and noncodingsequences. Among RNA viruses, initially viruses with a pos-itive-sense genome were recovered from plasmid DNA, such

as bacteriophage Q and poliovirus (23, 32). Later, viruseswith negative-sense genomes such as measles virus, influ-enza virus, and bunyaviruses were recovered entirely fromcDNA clones (2, 18, 19, 24). In recent years the introductionof plasmid-derived sequence into the dsRNA genomes ofthe Reoviridae has become possible for the Orthoreovirusgenus and, to a limited extent, for the Rotavirus genus (9, 10,26). Here, we report the first manipulation of a member ofthe Orbivirus genus (BTV) at the sequence level, using a newapproach among dsRNA virus reverse genetics systemsbased entirely on in vitro synthesized RNA transcripts. Theapproach taken extends the discovery that BTV transcriptsare infectious on transfection of permissive cells (1) by the

addition of one or more plasmid-derived T7 transcripts. Thereassortment method described is applicable to any genome seg-ment of BTV and requires the construction of a single clone orPCR product for each genome segment being recovered. Wereport the introduction of a marker sequence into the genome ofBTV and the simultaneous replacement of the serotype-specificprotein VP2 and the entry protein VP5 with proteins from adifferent serotype. Furthermore, the recovery of BTV entirelyfrom plasmid-derived T7 transcripts was investigated and foundto be viable means of generating BTV with a fully defined ge-nome. This method permits the recovery of mutants in a consis-tent genetic background with no screening required to removewild-type virus.

* Corresponding author. Mailing address: London School of Hy-giene and Tropical Medicine, Keppel St., London, WC1E 7HT, UnitedKingdom. Phone: 44 20 79272324. Fax: 44 20 79272839. E-mail: [email protected].

Published ahead of print on 18 June 2008.

8339

8/14/2019 btv2

2/10

MATERIALS AND METHODS

Cell lines and virus. BSR cells (a clone of BHK-21) were cultured in Dulbec-

cos modified Eagles medium supplemented with 5% (vol/vol) fetal bovine

serum (FBS) at 35C in 5% CO2. BTV stocks were generated by infecting BSR

cells at a multiplicity of infection of 0.1 and harvesting the medium at 3 to 4 days

postinfection. Viral stocks were stored at 4C.

Purification of BTV core particles. BSR cultures were infected with BTV at a

multiplicity of infection of 0.02 to 0.1. Transcriptionally active BTV-1 coreparticles were purified as previously described and stored at 4C (1).

Synthesis and purification of BTV mRNA in vitro. BTV core particles were

incubated at 40 g/ml at 30C for 5 to 6 h in BTV core transcription buffer (100

mM Tris-HCl, pH 8.0, 4 mM ATP, 2 mM GTP, 2 mM CTP, 2 mM UTP, 500 M

S-adenosylmethionine, 6 mM dithiothreitol, 9 mM MgCl2, 0.5U/l RNasin Plus

[Promega]). BTV core-derived mRNAs were purified using a previously de-

scribed method and stored at 80C (1).

Reverse transcription-PCR (RT-PCR) amplification of BTV-1 genome seg-

ments. cDNA copies of each BTV type 1 (BTV-1) genome segment were am-

plified from viral dsRNA in a sequence-independent manner using the method

of full-length amplification of cDNAs (FLAC) (12). Briefly, the hairpin anchor

primer was ligated to viral dsRNA as described previously, followed by cDNA

synthesis from gel-purified genome segments with SuperScript III (Invitrogen) at

a concentration of 10 U/l and 55C for 1 h. PCR amplification was performed

using 5 phosphorylated FLAC 2 primer (5GAGTTAATTAAGCGGCCGCAG

TTTAGAATCCTCAGAGGTC3) with KOD Hot Start DNA Polymerase (No-

vagen). PacI and NotI sites are in bold type.

T7 plasmid clones used for the synthesis of BTV transcripts. cDNA plasmid

clones were constructed for BTV-10 genome segment 10 (pNS3BsmBI), segment

5 (pVP5BsmBI), and segment 2 (pVP2BsmBI), and for all 10 segments of the

BTV-1 genome. A mutant version of the BTV-10 segment 10 clone containing an

introduced HaeII site (pNS3Hae) and a mutant version of the BTV-1 segment 8

clone containing an introduced BglII site (pBTV1S8Bgl) were also constructed.

The functional cassette in each plasmid clone contained a T7 promoter and a

BsmBI, BsaI, or BpiI site, with the BTV genome segment located between these

elements. The BTV genome segment in each clone was positioned relative to the

other two sequence elements such that the T7 transcript derived from plasmid

digested with BsmBI, BsaI, or BpiI was predicted to have exactly the same

sequence as the mRNA strand of the corresponding BTV genome segment

(Fig. 2A).

Synthesis of BTV transcripts from cDNA plasmid clones. T7 plasmid cloneswere digested with BsmBI, BsaI, or BpiI and then extracted once with phenol-

chloroform and once with chloroform. Each digested plasmid was precipitated

with isopropanol in the presence of 0.15 M sodium acetate. DNA pellets were

washed twice in 70% (vol/vol) ethanol and dissolved at 1 g/l in 10 mM

Tris-HCl, pH 8.0. Transcripts with a 5 cap analogue were generated from the

digested T7 plasmid clones using a mMESSAGE mMACHINE T7 Ultra Kit

(Ambion), using a 4:1 ratio of anti-reverse cap analogue to rGTP. T7 BTV

transcripts were extracted once with phenol-chloroform, followed by one extrac-

tion with chloroform. Unincorporated ribonucleoside triphosphates were re-

moved by size fractionation using Microspin G-25 columns (GE Healthcare)

according to the manufacturers instructions. The T7 BTV transcripts were

precipitated with an equal volume of isopropanol in the presence of 0.15 M

sodium acetate. RNA pellets were washed twice in 70% (vol/vol) ethanol, dis-

solved in sterile diethylpyrocarbonate-treated water, and stored at 80C.

Denaturing agarose gel electrophoresis. Purified BTV single-stranded RNA

(ssRNA) was analyzed by electrophoresis on 1% agarose in morpholinepro-

panesulfonic acid electrophoresis buffer in the presence of formaldehyde

using standard techniques (29).

Transfection of cultured cells to recover BTV with one or two cDNA-derived

genome segments. BTV mRNAs derived from transcribing cores were mixed

with one or more T7 BTV transcripts in Opti-MEM I in the presence of 0.1

U/l RNasin Plus (Promega). The RNA mixture was incubated at 20C for 30

min before being mixed with Lipofectamine 2000 reagent (Invitrogen) (see

below). Confluent BSR monolayers in six-well plates were transfected with

1.5 g of BTV mRNA mixed with 0.75 g of each T7 BTV transcript using

Lipofectamine 2000 reagent according to the manufacturers instructions. At

4 h posttransfection the culture medium was replaced with a 6-ml overlay

consisting of minimal essential medium, 2% FBS, and 1.5% (wt/vol) agarose

type VII (Sigma). Assays were incubated at 35C in 5% CO 2 for 72 to 96 h to

allow plaques to appear.

Transfection of cultured cells to recover BTV entirely from cDNA-derived

genome segments. A total of 300 to 400 ng of each T7 BTV transcript was mixed

as described above to produce a complete genome set of T7 BTV transcripts.

Transfection of BSR monolayers was performed as described above.Preparation of dsRNA from transfection-derived BTV plaques. Each plaque

was picked into 500 l of Dulbeccos modified Eagles medium5% FBS, and 200

l was used to infect 1.5 106 BSR cells. Infected cells were incubated at 35C

in 5% CO2 for 72 to 96 h to allow amplification of the BTV. Viral dsRNA was

purified from infected BSR cells as previously described (1).Screening transfection-derived BTV plaques for reassortants containing the

introduced genome segments. Where the genome segment being introducedmigrated at a different rate on polyacrylamide gels, screening was done by

electrophoresis of the dsRNA on 9% polyacrylamide gels in Tris-glycine buffer

(pH 8.3). Gels were poststained for 30 min with ethidium bromide. Where

screening was not possible on the basis of the migration rate, RT-PCR followedby restriction endonuclease digestion was used to discriminate between reassor-

tants and wild-type BTV. cDNA was synthesized from 100 ng of heat-denatured

viral dsRNA with SuperScript III (Invitrogen), using forward and reverse prim-

ers flanking the target region, at 55C for 1 h. The target region was PCRamplified using Taq DNA polymerase with the same forward and reverse primers

and digested with restriction endonucleases. Products were resolved by electro-

phoresis in agarose gels containing ethidium bromide in Tris-borate-EDTAbuffer. Sequence analysis of RT-PCR products was done using dye terminators

on ABI 3730XL sequencing machines using the Value Read service of MWG

Biotech (30).Construction of pNS3Hae and pBTV1S8Bgl. pNS3BsmBI was altered to con-

tain an additional HaeII site by site-directed mutagenesis using primers

S10_mt_Hae_409F and S10_mt_Hae_409R by the method of Weiner et al. (37).Similarly the wild-type BTV-1 S8 clone was altered to introduce a BglII site using

primers 5BTV1_S8_BglII and 3BTV1_S8_BglII. Clones were screened for the

presence of the introduced site by HaeII or BglII digestion, and the expressioncassette was sequenced to identify clones containing no adventitious mutations

using the Value Read service of MWG Biotech.Primers. Mutagenic primers used to generate pNS3Hae from pNS3BsmBI

were the following: S10_mt_Hae_409F (5CTACTAGTGGCTGCTGTGGT

AGCGCTGCTGACATCAGTTTG3) and S10_mt_Hae_409R (5CAAACTGATGTCAGCAGCGCTACCACAGCAGCCACTAGTAG3 ). Mutagenic prim-

ers used to generate pBTV1S8Bgl from the wild-type BTV-1 S8 clone were

5BTV1_S8_BglII (5GATTTACCAGGTGTGATGAGATCTAACTACGATGTTCGTGAAC3) and 3BTV1_S8_BglII (5CGAACATCGTAGTTAGATCTC

ATCACACCTGGTAAATCGGGC3). The mutagenic bases are underlined,

and the restriction sites are in bold type.Primers for the RT-PCR amplification and sequencing of BTV-10 segment

10 were the following: BTV10_S10_238F (5-GGAGAAGGCTGCATTCGCA

TCG-3), BTV10_S10_654R (5-CTCATCCTCACTGCGTCATTATATGATTGTTTTTTCATCACTTC-3), BTV10_S10_259F (5-GGAGAAGGCTGCATTCGC

ATCG-3), and BTV10_S10_611R (5-CTCATCCTCACTGCGTCATTATATGA

TTGTTTTTTCATCACTTC-3 ).Primers for RT-PCR amplification from BTV-10 segment 5 were BTV10_

M5_724F (5-ATGACAGCAGACGTGCTAGAGGCGGCATC-3) andBTV10_M5_1590R (5-GCGTTCAAGCATTTCGTAAGAAGAG-3).

Primers for RT-PCR amplification from BTV-10 segment 2 were BTV10_

L2_727F (5-CCGTACGAACGATTTATATCCAGC-3) and BTV10_L2_1523R (5-TACTAATTCAGAACGCGCGCC-3 ).

Primers for RT-PCR amplification of BTV-1 segment 8 were NS2_Bam_T7_F

(5-CGGGATCCTAATACGACTCACTATAGTTAAAAAATCCTTGAGTCA-3) and NS2_Bam_R (5-CATGGGATCCGGACCGTCTCCGTAAGTGT

AAAATCCCC-3). The primer used for sequencing BTV-1 segment 8 was

BTV1_S8_627R (5CAGCTTCTCCAATCTGCTGG3 ).

RESULTS

Reassortment of genome segments by cotransfection with

BTV mRNA from two serotypes. The recovery of infectiousBTV from core-derived transcripts through the transfection ofpermissive cells has been demonstrated (1). With the aim ofproducing a reverse genetics system for BTV, the introductionof genome segments from one BTV serotype into another wasinvestigated as an intermediate step prior to the introductionof cDNA-derived genome segments. Infectious core-derived

8340 BOYCE ET AL. J. VIROL.

8/14/2019 btv2

3/10

transcripts were prepared from BTV-1 and BTV-9 as previ-ously described (1). The transcripts from the two serotypeswere either generated simultaneously in the same transcriptionreaction or prepared separately and then mixed. ConfluentBSR monolayers were transfected with the transcript mixtures,and virus was amplified from the resulting plaques. ThedsRNA was purified from each amplified plaque, and the or-igin of genome segments was determined by electrophoresis onnondenaturing polyacrylamide gels, which allow the discrimi-nation of some genome segments from different isolates. Whencosynthesized transcripts from BTV-1 and BTV-9 were used,progeny viruses were generated that had genome segmentsfrom both parental sources of transcripts (reassortants). In Fig.1A, lane 1 contains a reassortant which has segment 1 andsegment 4 of BTV-1 in a genetic background of segmentswhich migrate as BTV-9. Similarly, lane 2 contains a reassor-tant with the segment 3 of BTV-9 in a BTV-1 genetic back-ground, and lane 3 contains a reassortant with segment 1 ofBTV-9 in a BTV-1 genetic background. When BTV-1 andBTV-9 transcripts were prepared separately and mixed prior totransfection, reassortant progeny viruses were also generated,indicating that cosynthesis of transcripts is not necessary forreassortment to occur (Fig. 1B). The frequency at which reas-sortant progeny were generated was approximately 7 to 10%for both types of transcripts used. These data demonstratedthat cotransfection with a mixture of viral transcripts is a viable

strategy for the introduction of genome segments from a sep-arate source into the BTV genome.

The introduction of a BTV segment derived from a cDNA

clone into the BTV-1 genome. The targeted replacement of agenome segment with a T7 transcript derived from a cDNAclone was subsequently investigated as a model for the intro-duction of cloned sequences into the BTV genome. The intro-duction of the BTV-10 segment 10 T7 transcript into the ge-nome of BTV-1 was chosen to allow the rapid screening ofplaques based on the fast migration rate of segment 10 ofBTV-10 compared to BTV-1 on polyacrylamide gels. TheBTV-10 segment 10 T7 transcript was produced frompNS3BsmBI, which has a T7 promoter to generate the correct5 end sequence and a BsmBI site to generate the correct 3 end sequence (Fig. 2A). BTV-1 transcripts produced fromtranscribing core particles were mixed with the BTV-10 seg-ment 10 T7 transcript and used to transfect confluent BSRmonolayers. A 5:1 molar ratio of T7 transcript to the corre-sponding core-derived mRNA was found to be best and wasused in all experiments. Increasing the ratio of T7 transcript to

BTV-1 transcripts reduced the total number of plaques recov-ered (data not shown). Typically 50 plaques were recoveredfrom each well following the transfection of a six-well dish with1.5 g of core-derived transcripts plus 0.75 g of T7 transcript.Virus was amplified from these plaques, and the dsRNA waspurified. The origin of genome segment 10 was initially deter-mined by electrophoresis of the dsRNA on polyacrylamidegels. dsRNA genome profiles containing the faster migratingsegment 10 from BTV-10 were obtained with a sufficiently highfrequency (15 to 80%) to make screening of plaques a viableoption (Fig. 2B). The identity of segment 10 was confirmedusing RT-PCR, followed by sequencing of a region showing variation between type 1 and type 10 (Fig. 2C, D, and E).

These data demonstrated the recovery of the plasmid-derivedBTV-10 segment 10 into the genome of viable BTV-1.BTV naturally produces reassorted progeny genomes when

a cell is infected with two different strains (7). To exclude thepossibility that natural reassortment between two viruses wasthe origin of the segment 10 reassortants, a BTV-10 segment10 clone containing an introduced silent HaeII site (pNS3Hae)as a marker was made by the site-directed mutagenesis ofpNS3BsmBI. BSR monolayers were transfected with a mixtureof BTV-1 core-derived mRNAs and the BTV-10 segment 10T7 transcript containing the introduced mutation, derivedfrom pNS3Hae. The recovery of virus containing this mutantBTV-10 segment 10 sequence was initially screened for by itsincreased migration rate on polyacrylamide gels (Fig. 3A). Theintroduction of the HaeII site into segment 10 of the BTVgenome was confirmed by RT-PCR of dsRNA from plaque-purified virus followed by HaeII digestion (Fig. 3B) and bysequencing of the RT-PCR product (Fig. 3C and D). By se-quencing a full-length RT-PCR product, segment 10 was de-termined to be the same as the segment encoded in pNS3Haethroughout its length (data not shown).

The simultaneous introduction of two BTV-10 segments de-

rived from cDNA clones into the BTV-1 genome. To assess thepossibility of simultaneously altering two genome segments,the introduction of the outer capsid protein encoding segments(segments 2 and 5) from BTV-10 into a background of BTV-1genome segments was investigated. Replacement of these ge-

FIG. 1. Reassortant progeny genomes recovered from the co-transfection of BSR cells with core-derived transcripts from twoserotypes of BTV. Genomic dsRNA was run on 9% nondenaturing

polyacrylamide gels. (A) dsRNA from rescued BTV derived by thecotransfection of BSR cells with cotranscribed BTV-1 and BTV-9transcripts. Lanes 1 to 3, plaque-purified viruses containing genomesegments from both parental transcript preparations. Arrows indi-cate segments from the parent which has contributed the leastnumber of segments. BTV-1 dsRNA and BTV-9 dsRNA markerlanes are indicated. (B) dsRNA from rescued BTV derived by thecotransfection of BSR cells with BTV-1 and BTV-9 transcriptsmixed after preparation. Lanes 1 and 2, plaque-purified virusescontaining genome segments from both parental transcript prepa-rations. Arrows indicate segments from the parent which has con-tributed the least number of segments. BTV-1 dsRNA and BTV-9dsRNA marker lanes are indicated.

VOL. 82, 2008 BTV FROM SYNTHETIC RNA 8341

8/14/2019 btv2

4/10

nome segments with the segments from another serotypewould enable the serotype of the virus to be altered. T7 tran-scripts derived from segments 2 and 5 of BTV-10 were pre-pared from pVP2BsmBI and pVP5BsmBI, respectively, andmixed with BTV-1 core-derived mRNAs at a 5:1 ratio of eachT7 transcript to the corresponding core-derived transcript.Confluent BSR cell monolayers were transfected with theRNA mixture, and dsRNA was prepared from the recoveredplaques. The origins of segments 2 and 5 were initially assessedby their migration rate on polyacrylamide gels (Fig. 4A). Bothsegments 2 and 5 from BTV-10 were recovered together athigh frequency (20 to 80%). The change of serotype fromserotype 1 to serotype 10 was confirmed by a plaque sizereduction assay using anti-BTV-10 rabbit serum (data notshown). Further, the identity of the segments was confirmed byRT-PCR followed by restriction digestion (Fig. 4B and C). Thecomplete sequences of segment 2 and segment 5 were deter-

mined to be those of BTV-10 by RT-PCR amplification andsequencing (data not shown). No progeny (0 out of 19 plaquesfrom three independent experiments) were recovered that con-tained only segment 2 or only segment 5 from BTV-10, sug-gesting that viruses containing segment 2 from one parent andsegment 5 from the other parent are either of reduced viabilityor are generated at a lower frequency than the double reas-sortants. This phenomenon was further supported when theintroduction of segment 2 or segment 5 from BTV-10 intoBTV-1 was attempted singly, and no reassortant progeny wererecovered (data not shown).

The recovery of BTV entirely from T7 transcripts. While theabove method is a viable reverse genetics system that allows themanipulation of BTV genome segments, the requirement toscreen for reassortant plaques among wild-type plaques couldhinder the recovery of slow-growing mutants. The ideal reversegenetics system would permit the assembly of infectious virus

FIG. 2. Reassortant progeny genomes containing the plasmid-derived BTV-10 segment 10. (A) T7 plasmids contain the full-length BTVgenome segment flanked by a T7 promoter and a BsmBI, BsaI, or BpiI restriction enzyme site which defines the BTV 3 end sequence duringtranscription. The sequences at the 5 and 3 ends of the BTV genome segment and the flanking sequences are indicated; T7 promoter (italicized),the conserved BTV genome segment 5 and 3 end sequences (bold), and the BsmBI site (underlined) are shown. (B) Genomic dsRNA run ona 9% nondenaturing polyacrylamide gel, extracted from BTV recovered from the cotransfection of BSR cells with BTV-10 segment 10 T7 transcriptand core-derived BTV-1 transcripts. Reassortants are shown in lanes 1, 2, and 5, with arrows indicating the faster-migrating BTV-10 segment 10genome segment. Lanes 3 and 4 show results for wild-type BTV-1. BTV-1 dsRNA and BTV-10 dsRNA marker lanes are indicated. (C to E)Sequence electropherograms of segment 10 RT-PCR products. Segment 10 target sequences from total viral dsRNA were amplified by RT-PCRusing primers BTV10_S10_259F and BTV10_S10_611R. Amplified targets were sequenced using BTV10_S10_259F. (C) BTV-10. (D) BTV-1containing the introduced BTV-10 segment 10. (E) BTV-1.


8/14/2019 btv2

5/10

entirely from T7 transcripts. To maximize the probability of hav-ing a viable clone for every genome segment, RT-PCR amplifi-cation of each genome segment was performed with dsRNA ofBTV-1 using the sequence-independent FLAC method devel-oped for dsRNA templates (12). Each RT-PCR product wascloned into pUC19 (38), and the complete sequence of each clonewas compared with the complete sequence of each RT-PCRproduct in order to determine whether a representative moleculehad been cloned in each case (data not shown). Alternative cloneswere sequenced when coding changes or any differences within200 nucleotides of the ends of the cloned genome segment werepresent. Once a complete set of 10 clones was obtained, eachgenome segment was PCR amplified using the high-fidelity KODHot Start DNA Polymerase (Novagen) to introduce a T7 pro-moter directly upstream of the genome segment and a restrictionenzyme site directly downstream (Fig. 2A). These functional cas-settes were also cloned in pUC19. T7 transcripts synthesized usingthe restriction-digested plasmid clones were determined to be ofthe expected size when resolved on 1% denaturing agarose gels(Fig. 5).

T7 transcripts made from restriction-digested plasmids weremixed in equal amounts of 0.3 to 0.4 g of each in a total of 3 to4 g and used to transfect confluent BSR monolayers. Trans-fected monolayers were overlaid with agarose, and plaques ap-peared at 3 to 6 days posttransfection (Fig. 6A). dsRNA fromamplified plaques was compared with BTV-1 stock virus on poly-acrylamide gels and found to be indistinguishable, confirming that

BTV-1 had been recovered (Fig. 6B). Titration of BTV-1 derivedfrom T7 transcripts exhibited equivalent titers to that of wild-typevirus (1 107 to 3 107 PFU/ml), demonstrating that BTV-1derived from the 10 T7 transcripts has no gross replication defectswhen cultured in BSR cells. To substantiate further that BTVcould be derived from T7 transcripts, a mutant of the BTV-1segment 8 T7 clone was made that contained an introduced silentBglII site, pBTV1S8Bgl. Plaques were recovered from transfec-tions with a complete set of T7 transcripts where the segment 8BglII marker transcript replaced the wild-type S8 transcript (Fig.7A). dsRNA from amplified plaques was found to be indistin-guishable from BTV-1 stock virus on polyacrylamide gels (Fig.7B). Plaques were amplified by infection of BSR cells, and the S8segment was amplified by RT-PCR using primers NS2_Bam_Rand NS2_Bam_T7_F. Digestion of the RT-PCR product demon-strated that a BglII site had been introduced (Fig. 7C). TheRT-PCR products were sequenced using the BTV1_S8_627Rprimer confirming the introduction of the marker sequence (Fig.7D). These data demonstrate that it is possible to recover BTVfrom a complete genomic set of T7 transcripts and introduceviable mutations using this system.

DISCUSSION

The two approaches described represent alternative reversegenetics systems for BTV using either a mixture of authentic viraltranscripts and T7 transcripts or a complete genomic set of T7

FIG. 3. Reassortant progeny genomes containing the plasmid-derived BTV-10 segment 10 with an introduced marker mutation. (A) GenomicdsRNA from plaques containing BTV-10 segment 10 with an introduced HaeII site and run on a 9% nondenaturing polyacrylamide gel. Lanes 1to 3, viral dsRNA from three plaque-purified reassortants containing the faster-migrating BTV-10 segment 10. BTV-1 dsRNA and BTV-10 dsRNAmarker lanes are indicated. (B) HaeII digestion of segment 10 RT-PCR products. HaeII-digested RT-PCR products were amplified from genomicdsRNA using segment 10 primers BTV10_S10_259F and BTV10_S10_611R and separated on 2% agarose gels. U, undigested RT-PCR product;D, HaeII-digested RT-PCR product. Lanes 1, no template; lanes 2, BTV-10; lanes 3, reassortant with BTV-10 segment 10 introduced; lanes 4,reassortant with HaeII site-containing BTV-10 segment 10 introduced; lanes 5, BTV-1; lane M, StyI-digested phage DNA markers, with sizesindicated in bp. Sizes of RT-PCR product and digest fragments are indicated on the left in bp. (C and D) Sequence electropherograms of segment10 RT-PCR products. Segment 10 target sequences from total viral dsRNA were amplified by RT-PCR using primers BTV10_S10_238F andBTV10_S10_654R. Amplified targets were sequenced using BTV10_S10_ 238F. Panel C shows a reassortant with BTV-10 segment 10 introduced.Panel D shows a reassortant with an HaeII site-containing BTV-10 segment 10 introduced. The arrow indicates the introduced point mutation.


8/14/2019 btv2

6/10

transcripts. These systems extend the discovery that BTV tran-scripts are infectious when used to transfect permissive cells (1)and demonstrate that in vitro synthesized T7 transcripts with acap analogue at the 5 end can functionally substitute for tran-scripts synthesized by core particles.

The recovery of progeny virus with genome segments orig-inating from two separate core-derived mRNA preparationsestablished the principle of introducing exogenous transcriptsinto the genome of BTV by mixing with authentic viral tran-scripts (Fig. 1B). The observation that mixing the mRNA prep-

FIG. 4. Double reassortant progeny genomes containing the plasmid-derived BTV-10 segments 2 and 5. (A) Genomic dsRNA from BTV recovered fromthe cotransfection of BSR cells with the BTV-10 segment 5 T7 transcript, the BTV-10 segment 2 T7 transcript, and core-derived BTV-1 transcripts. GenomicdsRNA from progeny plaques run on a 9% nondenaturing polyacrylamide gel. Lanes 1 to 3, viral dsRNA from three plaque-purified reassortants. Arrowsindicate the slower-migrating BTV-10 segment 2 and segment 5. BTV-1 dsRNA and BTV-10 dsRNA marker lanes are indicated. (B and C) Restriction digestanalysis of segment 2 and segment 5 RT-PCR products.Target regionsfrom segment 2 andsegment 5 were RT-PCR amplifiedfrom genomic dsRNA, digested

with restriction enzymes specific to the BTV-10 segment, and separated on 1.5% agarose gels. Panel B shows SacI digestion of segment 2 RT-PCR products.SacI has specificity for segment 2 of serotype 10, with two sites in the target sequence. RT-PCR products were amplified from genomic dsRNA using segment2 primers BTV10_L2_727F and BTV10_L2_1523R. U, undigested RT-PCR product; D, SacI-digested RT-PCR product. Note that the primer pair does notamplifyBTV-1 segment2 dueto thelowhomology of thissegmentamong differentserotypes.Lanes 1, BTV-1;lanes 2, BTV-10; lanes 3, reassortant withBTV-10segments 2 and 5 introduced. StyI-digested phage DNA marker sizes in bp are indicated on left. Sizes of RT-PCR product and digest fragments are indicatedon the right in bp. Panel C shows DraI digestion of segment 5 RT-PCR products. DraI has specificity for segment 5 of serotype 10, with two sites present in the

target sequence. RT-PCR products amplified from genomic dsRNA using segment 5 primers BTV10_M5_724F and BTV10_M5_1590R. U, undigestedRT-PCR product; D, DraI-digested RT-PCR product.Templates in RT-PCRs areas indicated for panelB. Sizes of RT-PCR product and digest fragments areindicated on right in bp.

FIG. 5. T7 Transcripts of BTV-1 genome segments. Denaturing 1% agarose gel electrophoresis of BTV-1 T7 transcripts generated from restrictionendonuclease-digested clones. M, 1 g of ssRNA markers (Promega), with sizes indicated in nucleotides. (A) Lane 1, segment 1; lane 2, segment 3; lane 3,segment 5; lane 4, segment 7; lane 5, segment 9. (B) Lane 1, segment 2; lane 2, segment 4; lane 3, segment 6; lane 4, segment 8; lane 5, segment 10.


8/14/2019 btv2

7/10

arations after transcription was effective in producing reassor-tants allowed for the possibility of using plasmid-derivedtranscripts in combination with core-derived mRNAs to intro-duce targeted mutations into the BTV genome. The introduc-tion of the BTV-10 segment 10 transcript into the genome ofBTV-1 was investigated to determine whether the facile intro-duction of plasmid-derived transcripts into infectious BTVcould be achieved. A 5:1 molar ratio of T7 transcript to thecorresponding core-derived mRNA was found to give a highfrequency of reassortant plaques while maintaining the totalrecovery of plaques at a practical number. The observationthat higher ratios of T7 transcript reduced the total plaquecount may be due to negative effects on virus replicationcaused by overexpression of one gene in comparison to othergenes. Alternatively, the reduced recovery may derive from thefact that only a portion of T7 transcripts generated in thepresence of a cap analogue have the cap analogue incorpo-rated at the 5 end. Additionally, the uncapped transcripts have

a 5 triphosphate moiety that is known to be a pathogen-associated molecular pattern recognized by RIG-I that maylead to the induction of antiviral responses (3, 6, 20, 21). Thismodel system showed that using an excess of the T7 tran-script generated reassortant plaques at a frequency thatmade the screening of individual plaques practical (15 to80%). The variation in this efficiency may reflect variation inthe quality or the degree of capping of different T7 tran-script preparations. The initial screening of plaques by therate of migration of the segment 10 dsRNA on polyacryl-amide gels (Fig. 2) was confirmed by sequencing of theRT-PCR product (Fig. 2). The high efficiency of reassort-ment between the T7 transcript and authentic viral tran-scripts meant that a selectable marker approach was notrequired. The introduction of the HaeII site marker muta-tion into segment 10 of BTV confirmed that reassortantswere derived from the in vitro synthesized segment 10 T7transcript (Fig. 3). The HaeII-containing segment 10 wasrecovered with a similar efficiency to wild-type BTV-10 seg-ment 10. Neither segment 10 reassortant virus demonstrated

any gross replication deficiencies compared to wild-typeBTV-1 (data not shown). This shows that genome segment10 from BTV-10 is functionally compatible with a back-ground of BTV-1 genome segments both at the levels ofRNA packaging and replication and NS3/NS3A proteinfunction.

The simultaneous reassortment of two T7 transcripts intothe BTV genome to replace the antigenically important outercapsid proteins of BTV-1 with those from BTV-10 cDNAclones was shown to be possible using an excess of both T7transcripts (Fig. 4). Progeny plaques containing the BTV-10segments 2 and 5 were recovered at a 20 to 80% frequency, butno reassortants were isolated containing only segment 2 or

segment 5 from BTV-10. This demonstrates that together seg-ments 2 and 5 of BTV-10 can functionally substitute for thecorresponding BTV-1 genome segments and suggests thatthere is incompatibility between segment 2 and segment 5 fromthese two serotypes at some level. The encoded proteins, VP2and VP5, are highly variable due their exposure to immuneselective pressure on the surface of the virus particle. Ourfavored explanation is that the VP2 and VP5 proteins havecoevolved and that the three dimensional structure of VP2from one serotype is not necessarily compatible with the VP5from another serotype. This is consistent with the previouslyreported incompatibility of the VP2 and VP5 proteins fromsome serotype combinations observed in the generation ofBTV virus-like particles (11, 28). Incompatibility of segment 2and segment 5 in some serotype combinations at an RNApackaging level is another possibility. The simultaneous intro-duction of both outer capsid proteins from another serotypeallows the possibility of producing vaccine strains to differentserotypes based on a consistent genetic background. The highamino acid sequence divergence between the VP2 proteins ofBTV-1 and BTV-10 (40% amino acid identity) suggests thatthe assembly of varied VP2-VP5 pairs onto the conserved coreof the BTV virion will be possible.

The recovery of BTV-1 from a complete set of T7 transcripts was investigated to determine whether virus with a fully de-fined genome could be recovered from cDNA clones. Trans-fection of BSR monolayers with the 10 T7 transcripts was

FIG. 6. The recovery of infectious BTV by transfection with 10 T7

transcripts. (A) Transfected BSR monolayers overlaid with agarose.Well 1, BSR transfected with 4 g of BTV-1 T7 transcripts; well 2,BSR not transfected. Monolayers were fixed and stained with crystal

violet 5 days after transfection. (B) Genomic dsRNA run on a 9%nondenaturing polyacrylamide gel, extracted from BTV recoveredfrom the transfection of BSR monolayers as described in panel A.Lane 1, BTV-1 stock virus; lanes 2 and 3, BTV-1 from separate plaquesderived from transfection with T7 transcripts.


8/14/2019 btv2

8/10

found to lead to the production of plaques (Fig. 6). The re-covery of a BglII marker mutation into the S8 segment con-firmed that the virus recovered was derived from the T7 tran-scripts used in the transfections (Fig. 7). The recovery ofinfectious BTV from T7 transcripts alone demonstrates thatT7 transcripts synthesized in the presence of cap analogue arefunctionally equivalent to authentic viral transcripts at allstages of the replication cycle. The T7 transcripts must betranslated and selected during genome packaging and must actas templates for negative-strand synthesis if virions are to begenerated. Furthermore, after negative-strand synthesis, theresulting dsRNA genome segment must be competent for tran-

scription in the next round of infection. The recovery of BTVfrom T7 transcripts leads to the recovery of 100-fold fewerplaques than when an equivalent quantity of core-derived viraltranscripts is used. The lower efficiency may derive from thefact that only a portion of T7 transcripts generated in thepresence of a cap analogue have the cap analogue incorpo-rated at the 5 end. In addition to being poorly translated, theuncapped transcripts may be defective during RNA packaging,negative-strand synthesis, or transcription in the next round ofinfection. Additionally the induction of antiviral responses tothe 5 triphosphate via RIG-I may influence the recovery ofvirus (3, 6, 20, 21). Alternatively, the technical issues associated

B

1 2 3

T7-derived BTV-1

1

23

4

56

789

10

A1 2

1 2 3 4 5 6 7

U D U D U D U D U D U D U D

1171

491

680

1489

925

421

C

BglII

D

FIG. 7. The recovery of infectious BTV containing a marker mutation using 10 T7 transcripts. (A) Transfected BSR monolayers overlaid withagarose. Well 1, BSR transfected with 3 g of BTV-1 T7 transcripts including a segment 8 transcript with an introduced BglII site; well 2, BSRnot transfected. Monolayers were fixed and stained with crystal violet 5 days after transfection. (B) Genomic dsRNA run on a 9% nondenaturingpolyacrylamide gel was extracted from BTV recovered from the transfection of BSR monolayers as described in panel A. Lane 1, BTV-1 stock

virus; lanes 2 and 3, BTV-1 from separate plaques derived from transfection with T7 transcripts. (C) BglII digestion of segment 8 RT-PCRproducts. BglII-digested RT-PCR products amplified from genomic dsRNA using segment 8 primers NS2_Bam_T7_F and NS2_Bam_R andseparated on 1% agarose gels. U, undigested RT-PCR product; D, BglII-digested RT-PCR product. Lanes 1, wild-type BTV-1; lanes 2 to 6, fiveseparate plaques derived from transfection including the segment 8 BglII mutant transcript; lanes 7, no template. StyI-digested phage DNAmarker sizes (in bp) are indicated on left. Sizes of RT-PCR products and digest fragments are indicated on the right (in bp). (D) Sequenceelectropherogram of the segment 8 RT-PCR product from transfection including the segment 8 BglII mutant transcript. Segment 8 target sequencefrom total viral dsRNA was amplified by RT-PCR using the primers described in panel A. The amplified target was sequenced usingBTV1_S8_627R. Arrows indicate the introduced point mutations.


8/14/2019 btv2

9/10

with generating 10 ssRNA molecules with the conservedterminal sequences intact may contribute to the lower re-covery observed with T7 transcripts. The presence of tran-scripts shorter than full-length that derive from incompletetranscription or the degradation of full-length transcripts isa minor component in every T7 transcript preparation (Fig.5). These transcripts may be expected to reduce the effi-ciency of recovery of infectious virus through their incorpo-ration into assembling virions.

The recovery of BTV entirely from plasmid-derived tran-scripts allows the generation of BTV mutants with a consistentgenetic background. This approach will be useful in the recov-ery mutants, which are expected to have a slow replicationphenotype, as the screening of plaques for the desired mutantamong wild-type plaques is not required. In such cases therewould be no background of faster-replicating virus, which mayhamper the recovery of the slower-replicating mutants. Thisapproach could also be used to recover primary/low-passageisolates of BTV, avoiding gradual alteration of these strains tocell culture conditions. The recovery of reassortants containing

one plasmid-derived genome segment requires the construc-tion of a single clone or PCR product and is applicable to anygenome segment. This single-construct approach can be usedto investigate individual viral genes without the need to con-struct a full set of 10 clones. As Reoviridae members have acommon replication strategy, both the reassortment and T7-only reverse genetics approaches may be applicable to a widerange of viruses which lack a reverse genetics system. The useof in vitro synthesized T7 transcripts in both approaches obvi-ates the requirement to supply T7 RNA polymerase by infec-tion with a recombinant poxvirus, which may interfere with thereplication of the virus being recovered.

Alternative reverse genetics strategies have been used suc-

cessfully for other genera in the Reoviridae (9, 10, 26). The firstreverse genetics system was a helper virus system for the mam-malian orthoreoviruses (26). This approach combined reovirusinfection of permissive cells and transfection with viral dsRNA, viral mRNA, a T7 transcript, and in vitro translated viralmRNA. Another helper virus approach has allowed the re-placement of a rotavirus outer capsid protein with the corre-sponding protein from another serotype (10). The expressionof the introduced genome segment was driven in vivo by therecombinant T7 vaccinia virus system, and selective pressureagainst the equivalent helper virus protein was provided by theuse of antibody selection. Most recently mammalian orthoreo-virus has been recovered using a plasmid-based system similarto the T7-driven systems first used with negative-strand viruses(9). In this case expression of all 10 genome segments wasdriven in vivo by the recombinant T7 vaccinia virus system. Allthe successful reverse genetics strategies for members of thefamily have several notable features in common. (i) The ge-nome segments derived from cDNA clones are provided asmessage sense transcripts in the transfected cell. (ii) ThecDNA-derived transcripts used have the same 5 end and 3 endsequences as the corresponding viral transcript. The 5 endsare generated through the use of a T7 promoter with theappropriate sequence, and the 3 ends are generated throughthe use of the hepatitis delta ribozyme in vivo or a restrictionenzyme site in vitro. All genome segments in Reoviridae mem-bers have short conserved sequences at their extreme 5 and 3

ends the functions of which are still being elucidated. (iii) Likethe authentic viral transcripts, the cDNA-derived transcriptsare capped, either in vitro with a cap analogue or in vivothrough the cross-capping activity associated with the vacciniaT7 RNA polymerase recombinant (4). To achieve infectiousvirus recovery, gene expression must be sufficient to allow theassembly of progeny core particles, which themselves are tran-scriptionally active and lead to an amplification of gene expres-sion. A high level of gene expression is needed to assemblethese incomplete virions, and without the presence of the capstructure at the 5 end of the cDNA-derived transcripts, theirstability and level of translation would be greatly reduced (17).

Reverse genetics, as with other viruses, can contribute to theunderstanding of BTV in several research areas. The ability torecover specific mutations into the genome of BTV using ei-ther system provides not only a novel tool for the moleculardissection of BTV and related orbiviruses but also the oppor-tunity to develop specifically attenuated vaccines to these vi-ruses. The investigation of BTV protein function to date hasmainly been based on recombinant protein expression. The

ability to introduce specific mutations into the genes of BTVwill further our understanding of the functions of the viralproteins in replicating virus and allow the corroboration offunctions already assigned. The cis-acting RNA sequences thatcontrol the replication, packaging, and expression of Orbivirusgenomes remain unmapped and are poorly understood. Re-verse genetics allows mapping of these regulatory sequencesand can assist in the investigation of how they act. The replace-ment of outer capsid proteins can be used to generate vaccinestrains to different serotypes based on a common genetic back-ground. Moreover, it will be possible to identify determinantsof pathogenicity of BTV and related orbiviruses and designmultiply attenuated vaccine strains.

ACKNOWLEDGMENTS

This work was partly supported by the Biotechnology and BiologicalSciences Research Council, United Kingdom, and partly by the Na-tional Institute of Allergy and Infectious Diseases, National Institutesof Health, Bethesda, MD.

REFERENCES

1. Boyce, M., and P. Roy. 2007. Recovery of infectious bluetongue virus fromRNA. J. Virol. 81:21792186.

2. Bridgen, A., and R. M. Elliott. 1996. Rescue of a segmented negative-strandRNA virus entirely from cloned complementary DNAs. Proc. Natl. Acad.Sci. USA 93:1540015404.

3. Cui, S., K. Eisenacher, A. Kirchhofer, K. Brzozka, A. Lammens, K. Lam-mens, T. Fujita, K. K. Conzelmann, A. Krug, and K. P. Hopfner. 2008. TheC-terminal regulatory domain is the RNA 5-triphosphate sensor of RIG-I.

Mol. Cell 29:169179.4. Fuerst, T. R., and B. Moss. 1989. Structure and stability of mRNA

synthesized by vaccinia virus-encoded bacteriophage T7 RNA polymerasein mammalian cells. Importance of the 5 untranslated leader. J. Mol.Biol. 206:333348.

5. Gorman, B. M. 1990. The bluetongue viruses. Curr. Top. Microbiol. Immu-nol. 162:119.

6. Hornung, V., J. Ellegast, S. Kim, K. Brzozka, A. Jung, H. Kato, H. Poeck, S.Akira, K. K. Conzelmann, M. Schlee, S. Endres, and G. Hartmann. 2006.5-Triphosphate RNA is the ligand for RIG-I. Science 314:994997.

7. Kahlon, J., K. Sugiyama, and P. Roy. 1983. Molecular basis of bluetonguevirus neutralization. J. Virol. 48:627632.

8. Kirkland, P. D., N. Zhang, R. A. Hawkes, Z. Li, F. Zhang, R. J. Davis, D. A.Sanders, H. Li, K. Zhang, J. Ben, G. F. He, C. L. Hornitzky, and N. T. Hunt.

2002. Studies on the epidemiology of bluetongue virus in China. Epidemiol.Infect. 128:257263.

9. Kobayashi, T., A. A. R. Antar, K. W. Boehme, P. Danthi, E. A. Eby, K. M.Guglielmi, G. H. Holm, E. M. Johnson, M. S. Maginnis, S. Naik, W. B.


8/14/2019 btv2

10/10

Skelton, J. D. Wetzel, G. J. Wilson, J. D. Chappell, and T. S. Dermody. 2007.A Reverse genetics system for dsRNA viruses. Cell Host Microbe 1:147157.

10. Komoto, S., J. Sasaki, and K. Taniguchi. 2006. Reverse genetics system forintroduction of site-specific mutations into the double-stranded RNA ge-nome of infectious rotavirus. Proc. Natl. Acad. Sci. USA 103:46464651.

11. Loudon, P. T., T. Hirasawa, S. Oldfield, M. Murphy, and P. Roy. 1991.Expression of the outer capsid protein VP5 of two bluetongue viruses, andsynthesis of chimeric double-shelled virus-like particles using combinationsof recombinant baculoviruses. Virology 182:793801.

12. Maan, S., S. Rao, N. S. Maan, S. J. Anthony, H. Attoui, A. R. Samuel, andP. P. Mertens. 2007. Rapid cDNA synthesis and sequencing techniques forthe genetic study of bluetongue and other dsRNA viruses. J. Virol. Methods143:132139.

13. Martin, S. A., and H. J. Zweerink. 1972. Isolation and characterization of twotypes of bluetongue virus particles. Virology 50:495506.

14. Mehlhorn, H., V. Walldorf, S. Klimpel, B. Jahn, F. Jaeger, J. Eschweiler, B.Hoffmann, and M. Beer. 2007. First occurrence of Culicoides obsoletus-transmitted Bluetongue virus epidemic in Central Europe. Parasitol. Res.101:219228.

15. Mertens, P. P. C., H. Attoui, and D. H. Bamford (ed.). 2007. Bluetongueoutbreaks. In The RNAs and proteins of dsRNA viruses. http://www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/outbreaks.htm#top.

16. Mertens, P. P. C., and H. Attoui (ed.). 2007. Summary of the molecularepidemiology of Bluetongue virus in Europe since 1998: introductions,origins and movements of individual virus strains. In The RNAs andproteins of dsRNA viruses. http://www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ReoID/BTV-mol-epidem.htm.

17.Muthukrishnan, S., G. Both, Y. Furuichi, and A. Shatkin.

1975. 5-Terminal7-methylguanosine in eukaryotic mRNA is required for translation. Nature255:3337.

18. Neumann, G., and Y. Kawaoka. 2004. Reverse genetics systems for thegeneration of segmented negative-sense RNA viruses entirely from clonedcDNA. Curr. Top. Microbiol. Immunol. 283:4360.

19. Neumann, G., M. A. Whitt, and Y. Kawaoka. 2002. A decade after thegeneration of a negative-sense RNA virus from cloned cDNAwhat havewe learned? J. Gen. Virol. 83:26352662.

20. Pichlmair, A., O. Schulz, C. P. Tan, T. I. Naslund, P. Liljestrom, F. Weber,and C. Reis e Sousa. 2006. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5-phosphates. Science 314:9971001.

21. Plumet, S., F. Herschke, J. M. Bourhis, H. Valentin, S. Longhi, and D.Gerlier. 2007. Cytosolic 5-triphosphate ended viral leader transcript of mea-sles virus as activator of the RIG I-mediated interferon response. PLoS ONE2:e279.

22. Purse, B. V., P. S. Mellor, D. J. Rogers, A. R. Samuel, P. P. C. Mertens, andM. Baylis. 2005. Climate change and the recent emergence of bluetongue inEurope. Nat. Rev. Microbiol. 3:171181.

23. Racaniello, V. R., and D. Baltimore. 1981. Cloned poliovirus complementaryDNA is infectious in mammalian cells. Science 214:916919.

24. Radecke, F., P. Spielhofer, H. Schneider, K. Kaelin, M. Huber, C. Dotsch, G.

Christiansen, and M. A. Billeter. 1995. Rescue of measles viruses fromcloned DNA. EMBO J. 14:57735784.

25. Ravishankar, C., G. Krishnan Nair, M. Mini, and V. Jayaprakasan. 2005.Seroprevalence of bluetongue virus antibodies in sheep and goats in KeralaState, India. Rev. Sci. Technol. 24:953958.

26. Roner, M. R., and W. K. Joklik. 2001. Reovirus reverse genetics: Incorpo-ration of the CAT gene into the reovirus genome. Proc. Natl. Acad. Sci. USA98:80368041.

27. Roy, P. 1991. Towards the control of emerging Bluetongue disease. Oxford

Virology Publications, London, United Kingdom.28. Roy, P., D. H. L. Bishop, H. LeBlois, and B. J. Erasmus. 1994. Long-lasting

protection of sheep against bluetongue challenge after vaccination withvirus-like particles: evidence for homologous and partial heterologous pro-tection. Vaccine 12:805811.

29. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual,3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

30. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:54635467.

31. Stott, J. L., B. I. Osburn, R. Bushnell, E. C. Loomis, and K. R. Squire. 1985.Epizootiological study of bluetongue virus infection in California livestock:an overview. Prog. Clin. Biol. Res. 178:571582.

32. Taniguchi, T., M. Palmieri, and C. Weissmann. 1978. QB DNA-containinghybrid plasmids giving rise to QB phage formation in the bacterial host.Nature 274:223228.

33. Verwoerd, D. W. 1969. Purification and characterization of bluetongue virus.Virology 38:203212.

34. Verwoerd, D. W., H. J. Els, E. M. De Villiers, and H. Huismans. 1972.

Structure of the bluetongue virus capsid. J. Virol. 10:783794.35. Verwoerd, D. W., and H. Huismans. 1972. Studies on the in vitro and the in

vivo transcription of the bluetongue virus genome. Onderstepoort J. Vet.Res. 39:185191.

36. Verwoerd, D. W., H. Louw, and R. A. Oellermann. 1970. Characterization ofbluetongue virus ribonucleic acid. J. Virol. 5:17.

37. Weiner, M. P., G. L. Costa, W. Schoelttin, J. Cline, E. Mathur, and J. C.Bauer. 1994. Site-directed mutagenesis of double stranded DNA by thepolymerase chain reaction. Gene 151:119123.

38. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phagecloning vectors and host strains: nucleotide sequences of the M13mp18 andpUC19 vectors. Gene 33:103119.

39. Zhang, N., N. J. MacLachlan, K. R. Bonneau, J. Zhu, Z. Li, K. Zhang, F.Zhang, L. Xia, and W. Xiang. 1999. Identification of seven serotypes ofbluetongue virus from the Peoples Republic of China. Vet. Rec. 145:427429.

40. Zientara, S., C. Sailleau, G. Dauphin, C. Roquier, E. M. Remond, F. Leb-reton, S. Hammoumi, E. Dubois, C. Agier, G. Merle, and E. Breard. 2002.Identification of bluetongue virus serotype 2 (Corsican strain) by reverse-transcriptase PCR reaction analysis of segment 2 of the genome. Vet. Rec.150:598601.


btv2

Documents

Transcript of btv2