Bt

Na

b

c

a

ARAA

KHaA

1

arcfst[tA3rhap

e

1f

1d

DNA Repair 10 (2011) 1023– 1033

Contents lists available at ScienceDirect

DNA Repair

jo u rn al hom epa ge: www.elsev ier .com/ locate /dnarepai r

readth by depth: Expanding our understanding of the repair ofransposon-induced DNA double strand breaks via deep-sequencing

eil D. Huefnera, Yurie Mizunoa, Clifford F. Weilb, Ian Korfc, Anne B. Britt a,∗

Department of Plant Biology, University of California, Davis, CA 95616, United StatesDepartment of Agronomy, Purdue University, West Lafayette, IN 47907, United StatesDepartment of Molecular and Cellular Biology, University of California, Davis, CA 95616, United States

r t i c l e i n f o

rticle history:eceived 24 June 2011ccepted 26 July 2011vailable online 1 September 2011

eywords:airpin endlt-NHEJ

a b s t r a c t

The transposases of DNA transposable elements catalyze the excision of the element from the hostgenome, but are not involved in the repair of the resulting double-strand break. To elucidate the roleof various host DNA repair and damage response proteins in the repair of the hairpin-ended dou-ble strand breaks (DSBs) generated during excision of the maize Ac element in Arabidopsis thaliana,we deep-sequenced hundreds of thousands of somatic excision products from a variety of repair- orresponse-defective mutants. We find that each of these repair/response defects negatively affects thepreservation of the ends, resulting in an enhanced frequency of deletions, insertions, and inversions at

c element excision the excision site. The spectra of the resulting repair products demonstrate, not unexpectedly, that thecanonical nonhomologous end joining (NHEJ) proteins DNA ligase IV and KU70 play an important role inthe repair of the lesion generated by Ac excision. Our data also indicate that auxiliary NHEJ repair proteinssuch as DNA ligase VI and DNA polymerase lambda are routinely involved in the repair of these lesions.Roles for the damage response kinases ATM and ATR in the repair of transposition-induced DSBs are alsodiscussed.

. Introduction

DNA double strand breaks (DSBs) pose a significant threat to cell’s genomic integrity. Failure to rapidly and appropriatelyespond to such breaks can lead to perturbations of the cell cycle,hromosomal rearrangements, or cell death. Multiple pathwaysunction in the recognition of and response to DSBs; the highly con-erved nature of these repair pathways across kingdoms highlightshe importance of mounting an efficient response to these lesions1–3]. The initial response to DSBs is coordinated in large part byhe checkpoint kinases ATM (ataxia-telangiectasia, mutated) andTR (ATM and Rad3-related), members of the phosphoinositide--kinase-related protein kinase (PIKK) family [4,5]. The ultimateepair of a DSB may proceed via pathways requiring extensive

omology between the broken ends and the repair template, suchs homologous recombination or single-strand annealing, or viaathways that do not require such pairing [6]. Nonhomologous

Abbreviations: P-nucleotides, palindromic nucleotides; PEP, predominantxcision pattern.∗ Corresponding author at: Department of Plant Biology, University of California,

Shields Ave., Davis, CA 95616, United States. Tel.: +1 530 752 0699;ax: +1 530 752 5410.

E-mail address: abbritt@ucdavis.edu (A.B. Britt).

568-7864/$ – see front matter © 2011 Elsevier B.V. All rights reserved.oi:10.1016/j.dnarep.2011.07.011

© 2011 Elsevier B.V. All rights reserved.

end-joining (NHEJ) does not rely on the presence of a repair tem-plate, and so can introduce deletions or insertions at the repair site.While factors such as DNA ligase IV (LIG4) and KU70 play an essen-tial role in the canonical NHEJ pathway, it is clear that alternativeNHEJ (alt-NHEJ) pathways exist which function independently ofthese factors; the identity and role of the proteins involved in thesealternative NHEJ pathways remain, in many cases, unclear [7–10].

The manner and location in which a DSB is generated can havea significant impact on its repair. Class II transposable elements,which mobilize via a cut-and-paste mechanism, provide a powerfultool in addressing questions regarding the diversity and distribu-tion of repair products produced from a single style of break at awell-defined locus. Members of the hAT superfamily of transposons,such as McClintock’s Ac element, encode transposases whose func-tion is similar to that of RAG recombinase in V(D)J recombination[11]. Cleavage of the transposable element begins with nicks onenucleotide into the host DNA that flanks both 5′ ends of the trans-poson; each of the broken ends is then sealed to its complementarystrand, forming a hairpin loop and releasing the transposable ele-ment [11–13] (Fig. 1). While excision of the transposable elementis mediated by the transposase [14], resolution of the hairpin loops

and rejoining of the DSB must be carried out by host-encoded pro-teins [12,15].

Given the existence of multiple DSB repair pathways and theflexibility of end-processing pathways, a wide variety of excision

1024 N.D. Huefner et al. / DNA Repair 10 (2011) 1023– 1033

Fmo

paptueuaioho

2

2

stgtittgg(ieT

2

DlbimgFgi

Table 1Primers used in the detection of the intact Ac�NaeI element and in genotypingmutant lines.

Genotype Name Sequence

Ac�NaeIAc 3′ENDOUT GGAATTCGTTTCCGTCCCGCC15 TATCCAGCTCGAGTGGGTGGTGAG

lig4-2LB3 TAGCATCTGAATTTCATAACCAATCTC(C)Lig4-2 CATTAAGACTTCAAGCATTAATCTC(B)Lig4-2 GGCATGAATGTCTTGATGTGC

lig6-1LBa1 TGGTTCACGTAGTGGGCCATCG(B)Lig6-R CCCTTGAATCTTCTTTGCATTC(A)Lig6-L CCTACCTCTGCGTCCAACAT

ku70LBb1 GCGTGGACCGCTTGCTGCAACTKu70 Rev ACGCTTCTTCAGTTGGTCCTKu70 Fw TAAAGACAGCAGATAAACGC

atr-2LBa1 TGGTTCACGTAGTGGGCCATCGatr2-1 GGATCAAGTACTACTGACTCAGatr2-3 CAACTCATTTTGAATATGAGAG

atm-2LBa1 TGGTTCACGTAGTGGGCCATCGATM126 TCTCTCCTTGTTTCAAGCTCTGCATM125 GTTGGGCAGTTCCAAAGATG

LBb1 GCGTGGACCGCTTGCTGCAACT

ig. 1. Model of transposition in hAT superfamily [11]. Nicks on opposing strands areade in DNA flanking the transposable element (TE) by the transposase. Formation

f hairpin loops results in excision of the TE and production of a DSB.

roducts can be produced. The spectra of repair products generatednd their relative distributions in different mutant backgroundsrovide insight into the repair of DSBs and the roles specific pro-eins play in that repair. Deep sequencing techniques provide annprecedented look at the distribution of these repair products bynabling us to rapidly sequence millions of unique DNA repair prod-cts; the ability to multiplex sequences from multiple replicatesnd genetic backgrounds in a single run further increases the util-ty of this approach [16,17]. In order to gain a better understandingf the roles that various enzymes play in the repair of DSBs, weave used this deep sequencing approach to analyze the spectrumf excision products in a variety of mutant backgrounds.

. Materials and methods

.1. Plant lines

The Arabidopsis T-DNA insertion line A3 was used as the parentalource of the modified maize transposable element Ac�NaeI and ashe wild-type control [18]. The intact transposon is flanked by tar-et site duplications 8 bp in length and is embedded in a portion ofhe maize waxy (wx) gene; the transposable element with its flank-ng wx sequences is in turn embedded in the T-DNA construct usedo generate the A3 line. This T-DNA construct, which is carried onhe short arm of the fifth chromosome in the A3 line, is described inreater detail elsewhere [12,18]. The following alleles were used inenerating our mutant lines: lig4-2 [19], ku70 [20], lig6-1 [21], polLsalk 075391C) [22,23], atr-2 [24], and atm-2 [25]; all lines weren the Col ecotype. The primers used to detect the intact Ac�NaeIlement and in genotyping the mutant lines are summarized inable 1.

.2. Isolation of mutant lines

The Ac insertion line was crossed with each of the six differentNA repair, putative DNA repair, or DNA repair checkpoint mutant

ines: lig4, ku70, lig6, polL, atr, and atm. The F2 progeny was screenedy PCR to identify homozygous mutant lines that also carried an

ntact Ac construct. At least ten F3 seedlings from each homozygousutant line were screened by PCR to distinguish lines homozy-

ous for the Ac construct from lines segregating for its presence.or each of the mutant strains, with the exception of atr, a homozy-ous mutant line with two copies of the intact Ac construct wasdentified. Of the five homozygous mutant atr F2 lines identified

polL PolL-gDNA-Rev CGCCGTAGCTCCTGACCAGGPolL-gDNA GGAAGTTTGGGGTGTCGGTC

that carried the Ac construct, each appeared to have only a singlecopy; an atr line in which seven of the ten F3 progenies tested pos-itive for the presence of the Ac construct was selected for use inthe excision product library. All lines appeared to carry active Acelements (as revealed by PCR for excision products). In all cases,Ac activity had no effect on the plants’ growth, development orfertility.

2.3. Growth conditions

Plants were grown at 20 ◦C and 60% humidity in ConvironCMP4040 growth chambers on either Sunshine Mix #1 soil (SunGro Horticulture, Bellevue, WA) or 1× nutritive MS (Sigma–Aldrich,Saint Louis, MO), Phytoagar (PlantMedia, Dublin, OH), pH 5.9. A16 h day/8 h night cycle was simulated using light from cool-whitelamps (100–150 �mol m−2 s−1) filtered through Clear UV-filteringProtect-O-Sleeves (McGill Electrical Product Group, Rosemont, IL).Seeds to be used in the generation of the DNA library were surfacesterilized for 4 h using the vapor-phase method [26]. Seeds weresown on MS-agar plates and stored at 4 ◦C for 4 days before beingtransferred to the growth chamber; the age of the seedlings wascounted from the time the seeds were transferred to the growthchamber. Plates were maintained in a near vertical orientation suchthat the roots grew along the surface of the agar.

2.4. Isolation of genomic DNA

Genomic DNA was isolated as follows: 10 five-day-old seedlingswere harvested in a single tube (in the case of the atr line, 13seedlings rather than 10 were used, as the Ac construct was seg-regating in this line). Seedlings were macerated using a disposablepestle immediately prior to the addition of 400 �L of extractionbuffer (200 mM Tris–HCl, pH 9.0, 400 mM LiCl, 25 mM EDTA, 1%SDS). Samples were incubated at room temperature for 5 min andthen centrifuged briefly before transferring the supernatant toan equal volume of isopropanol. Samples were centrifuged again

before decanting the supernatant to allow the extracted DNA toair dry prior to resuspension in 200 �L TE. Samples were furtherpurified by phenol:chloroform extraction and again pelleted in

N.D. Huefner et al. / DNA Repair 10 (2011) 1023– 1033 1025

Fig. 2. Structure of amplified Ac excision products. Modified tandem repeats that flank the intact Ac element are shown as a shaded box with their sequence highlighted (ani n product, is depicted in this sequence). Position of the primers used to amplify excisionp and downstream of the Ac excision site are shown. Numbers above the diagram indicatet

iw

2

pa5pAetfew5ts

2

rFtRwr7f

2

ItlscwboTGtwCG5TAopw

Table 2Barcode sequences were used to label excision products. Genotypes were assignedunique barcodes for each of four biological replicates; all barcodes differ from oneanother in at least two of four nucleotide positions. Also reported is the number ofreads (n) from each dataset that aligned well with sequences both upstream anddownstream of the Ac excision site; only those reads corresponding to the XbaIdigested product collection are reported (see text).

Genotype Barcodes n Genotype Barcodes n

WT

AGGC 14,310 polL AAAC 4840CCTC 8879 CTGC 17,217GATA 18,443 GGCA 8300TACA 9387 TTGA 3435

lig4-2

AAGA 32,995 atr-2 ACAA 3600CTTA 16,400 CGAC 11,154GCAC 24,657 GTCC 2250TCGC 24,553 TGAA 2554

ku70

ATCA 4922 atm-2 AGTA 1613CACC 4291 CCCA 4110GGTC 3247 GAGC 6931TCTA 3022 TATC 4674

lig6-1

ACCC 3229CGGA 13,955

nversion of the two centermost nucleotides, as observed in the predominant excisioroducts (AcN4pho and AcH1bio) as well as restriction sites in sequences upstreamhe number of bases between the indicated restriction sites.

sopropanol and resuspended in TE [27]. Four biological replicatesere prepared for each line for a total of 28 samples.

.5. Amplification of excision products

Ac excision products were amplified by PCR using Ex Taqolymerase (TaKaRa Bio Inc.), a biotinylated primer withn engineered NheI restriction site (bold) ‘AcH1bio’ (biotin-′-GTGTGGCGGCTAGCCAGCGCTCCATGGTTTAATAAG-3′), and ahosphorylated primer ‘AcN4pho’ (P-5′-TCATTTGGAGAGGAC-CGCTCGAC-3′) (0.025 units/�L Ex Taq, 1× Ex Taq buffer, 200 �Mach dNTP, 0.24 �M each primer, 8.0 ng/�L template, 41.0 �Lotal reaction volume) (Fig. 2). Thermocycling conditions were asollows: denaturation at 98 ◦C for 10 s, annealing at 66 ◦C for 30 s,xtension at 72 ◦C for 30 s, 28 cycles. Because PCR amplificationorked most effectively with a total reaction volume less than

0 �L, six individual PCRs were run and then pooled for each ofhe 28 samples in order to obtain an ample amount of product forubsequent steps.

.6. Isolation of biotin labeled molecules

Biotin labeled molecules were isolated from PCR amplificationeactions using High Capacity NeutrAvidin Agarose Resin (Thermoisher Scientific, Waltham, MA). Following amplification, 225 �L ofhe PCR mixtures were combined with 300 �L NeutrAvidin Agaroseesin slurry in 1.5 mL tubes and diluted to a final volume of 600 �Lith 1× PBS, pH 7.4/1.0 mM EDTA. Samples were incubated on a

otator at 25 ◦C for 12 h and then rinsed once with 1 mL 1× PBS, pH.4/1.0 mM EDTA for 10 min and twice with 1 mL volumes of ddH2Oor 5 min [28,29].

.7. Preparation of indexed adapters

Custom indexed adapters were used in place of the standardllumina adapters. Adapters included a unique 4 bp tag; each ofhe tags or ‘barcodes’ differed from the remaining barcodes in ateast two of the four nucleotide positions. A set of 28 barcodes waselected that was split evenly between either a 25% or a 75% GContent and that did not end with either a G or T; each barcodeas assigned to a single genotype (Table 2). For each of the 28

arcodes, three adapters were designed: Adapter1 with a 3′-Tverhang (oligoA1 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATC-XXXXT-3′, oligoB1pho P-5′-XXXXAGATCGGAAGAGCTCGTATGCC-TCTTCTGCTTG-3′, where ‘XXXX’ and ‘XXXX’ represent one of

he 28 unique barcodes and its reverse complement), Adapter2ith a 5′-CTAG overhang (oligoA2 5′-ACACTCTTTCCCTACACGA-GCTCTTCCGATCTXXXX-3′, oligoB2pho P-5′-CTAGXXXXAGATC-GAAGAGCTCGTATGCCGTCTTCTGCTTG-3′), and Adapter3 with a′-CGCG overhang (oligoA3 5′-ACACTCTTTCCCTACACGACGCTC-TCCGATCTXXXX-3′, oligoB3pho P-5′-CGCGXXXXAGATCGGAAG-

GCTCGTATGCCGTCTTCTGCTTG-3′); oligonucleotides wererdered through Invitrogen (Carlsbad, CA). Adapters were pre-ared from appropriate oligonucleotide pairs and diluted to aorking concentration of 15 �M [16].

GTAA 6757TTAC 1902

2.8. Restriction digests and ligation of adapters to Ac excisionproducts

For each of the 28 samples, four separate excision productcollections were created covering different regions of the originalPCR amplification products. Four parallel reactions were set upto cleave the amplification products a specific distance from theoriginal excision site and to affix an indexed adapter to one end.In this paper we report only our results obtained from productscleaved and sequenced from an XbaI restriction site 53 bp fromthe Ac excision site (Fig. 2); results from the remaining excisionproduct collections are consistent with these results. The reactionconditions used to generate the excision product collections wereadapted from Illumina’s library preparation protocol [16,30].Conditions for the XbaI excision product collection were as fol-lows: 35 �L NeutrAvidin Agarose Resin with bound biotinylatedamplification products (as described above), 4 �M Adapter2 withappropriate barcode and XbaI compatible overhang, 1× NE buffer4, 1 mM ATP, 400 U T4 DNA ligase, 40 U XbaI, 100 �g/mL BSA,ddH2O to a final volume of 75 �L. After 16 h incubation on arotator at 37 ◦C, the NeutrAvidin Agarose Resin from each reactionwas rinsed twice with 1 mL volumes of ddH2O for 5 min each.The amplified excision products, now modified with an indexedadapter on one end, were cleaved from the NeutrAvidin AgaroseResin (at the engineered NheI site in primer ‘AcH1bio’) and thesecond indexed adapter was ligated to the cleaved end; reactionconditions were as follows: 35 �L NeutrAvidin Agarose Resin with

bound, adapter modified, amplification products, 4 �M Adapter2,1× NE buffer 4, 1 mM ATP, 400 U T4 DNA ligase, 40 U NheI,100 �g/mL BSA, and ddH2O to a final volume of 75 �L. Sampleswere incubated on a rotator at 37 ◦C for 16 h. Adapter-modified

1 Repa

DA‘Trwatog

sdcsureCmepfuaNM

2

aputd1fT

2

ewfnotsBfhsposuotbmugrX

026 N.D. Huefner et al. / DNA

NA fragments were enriched by PCR using primers ‘SolPCR-’ (5′-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3′) and

SolPCR-B’ (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCC-ACACGACGCTCTTCCGATCT-3′) and 1 �L of the cleavage/ligationeaction used as the template; reaction and cycling conditionsere as described above with a final volume of 25 �L and an

nnealing temperature of 68 ◦C over 38 cycles. For each sample,wo independent PCRs were run and then pooled for a total volumef 50 �L; a small aliquot of each reaction was run on an agaroseel to confirm the presence of the desired product.

Reaction conditions used to generate the three additional exci-ion product collections (Full length, BssHII digested, and BsaAIigested) were similar to those used to generate the XbaI digestedollections and are discussed in Supplemental text. For eachample, the PCR enriched products from the four excision prod-ct collections were pooled and run on a 1.5% agarose gel. Theegions between 200 bp and 500 bp were excised and the DNAxtracted using QIAquick Gel Extraction Kits (Qiagen, Valencia,A); 5 �L of eluate from each of the 28 samples were pooled andixed thoroughly. Adapter-modified DNA fragments were again

nriched by PCR as above using the pooled eluate as the tem-late. Reactions were run on a 1.5% agarose gel and the DNArom the 200 bp to 500 bp region was again excised and extractedsing Qiagen’s ‘Gel Extraction Spin Protocol’. The concentrationnd quality of the resultant DNA library were checked using aanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham,A).

.9. Sequencing of Ac excision product library

The DNA library was delivered to the DNA Technologies Coret the UC Davis Genome Center (Davis, CA, USA) for flow cellreparation and multiplex sequencing. The library was processedsing a Genome Analyzer IIx (Illumina, San Diego, CA) accordingo the manufacturer’s recommendations. Single-end sequencingata were collected for 85 cycles over 120 tiles with an average of85,698 clusters per tile. Image analysis and base calling were per-ormed automatically using Illumina’s Primary Analysis software.he resulting dataset is available upon request.

.10. Sequence data processing

A total of 18,495,640 84 bp reads were generated from the Acxcision product library in a single sequencing run. Perl scriptsere used to sort the sequence data according to the 28 unique

our-nucleotide barcodes (see Section 2.7); those reads that didot include a valid barcode and those that contained ambigu-us nucleotides in any position were discarded (12.8% of theotal number of reads). Each of the reads was aligned to theequence upstream or downstream of the Ac element with AB-LAST (Advanced Biocomputing, LCC, Saint Louis, MO) with the

ollowing parameters: M = 1, N = −5, W = 8, S = 8 – nogap. The singleighest scoring alignment for the upstream sequence and down-tream sequence was identified for each read. Reads exhibitingoor alignment with either the upstream or downstream sequencer both (i.e., reads that aligned on only one side of the excisionite, or did not align at all) were discarded. Given that the primerssed to amplify excision products should legitimately amplifynly those repair products that retain these sequences (see Sec-ion 2.5 and Fig. 2), some products, such as those with deletionseyond these limits and those exhibiting chromosomal rearrange-ents, are outside the scope of our detection. Perl scripts were

sed to identify the sequence start position of each read and toroup the reads accordingly. As stated above, in this paper weeport only those results derived from reads beginning at thebaI sequencing start position; this resulted in 261,627 legible

ir 10 (2011) 1023– 1033

reads (see Table 2 for breakdown by genotype and barcode). Theupstream and downstream alignments from each read were com-pared to identify and characterize deletions or insertions presentat the excision repair site; reads of identical sequence at and acrossthe repair junction were pooled and tallied within each barcodeddataset.

3. Results and discussion

3.1. Spectrum of footprints in the wild-type line

The transposable element present in our lines is embedded in atransgenic sequence derived from maize. Thus there is no homolo-gous “wild-type” sequence available as a template for repair. OnlyNHEJ (in all its permutations) and single-strand annealing (SSA)are available as options for repair. The Ac element introduces an8 bp target site direct duplication upon insertion; this duplicationis present in our transgenic construct. Repair via SSA, employingthe duplicated target site as the direct repeat for rejoining of over-hanging ends, would restore the “wild-type” allele. However, ashas already been repeatedly demonstrated [31], in lines that lacka wild-type homologue Ac excision rarely restores the wild-typeallele. In our dataset, restoration of the “wild-type” (single copy ofthe target site duplication) allele constituted only 3.74 ± 1.17% ofall products formed in our repair-proficient lines. This fraction wassignificantly enhanced in the polL mutant (12.06 ± 1.42), and wassignificantly decreased in lig4 (1.82 ± 0.72). Far more rare was the“precise” excision product, in which both target site duplicationsare present in an unmodified form; this product was observed onlyonce in 261,000 reads.

The products observed here are comparable to those producedby zinc-finger nuclease (ZFN) generated breaks, in that the endsare well conserved, and both deletions and insertions are small[32–34] (Sup. Fig. 1 lists the sequences of the 47 excision prod-ucts that make up approximately 90% of all wild-type footprints).Ac excision products differ from ZFN-induced mutations, however,in their tendency to exhibit short palindromic (inverted repeat)sequences derived from the target site bordering the element. Thissuggests that while hairpin formation and (erroneous) re-openingare commonplace at Ac excision sites, hairpin formation is rare ornonexistent at ZFN-induced breaks.

Outside of palindromic sequences derived from hairpin reopen-ing, these Ac footprints, like ZFN-derived mutations, do not exhibitthe insertion of short duplications of random local sequences(chromosomal and T-DNA-derived) that are frequently observedin agrobacterial T-DNA insertion sites [35].

Excision of the Ac element leaves behind a characteristic “foot-print” – a modified 8 bp target site duplication – which we describebelow as the “predominant excision pattern (PEP)”. In all fourwild-type datasets, the PEP accounts for approximately half of allreads, averaging 55.0% ± 12.4 of all excision products. PEP is char-acterized by the presence of a modified 8 bp tandem repeat inwhich the two center-most bases are replaced with their com-plements (Fig. 3A). Production of this same footprint has beendescribed before [12,31] and is consistent with the model ofAc excision described above, in which transposition is coupledwith the production of hairpin structures on both ends of theexcision site; these hairpin structures must be opened beforethe broken ends can be rejoined. Opening of the hairpin loops,which can introduce stretches of palindromic (P) nucleotides atthe excision site [15,36–40], end-processing by either nucleases

or polymerases or both, and finally ligation, gives rise to thefinal excision repair product (Fig. 3B). A summary of the dis-tribution of the types of repair products observed is shown inTable 3.

N.D. Huefner et al. / DNA Repa

Fig. 3. (A) (Top) Diagram of the intact Ac element and adjacent DNA; target siteduplications are shown in bold. (Bottom) Sequence of the predominant excisionpattern (PEP) repair junction; circle highlights the inversion of the two center-mostnucleotides. (B) Model depicting the opening of hairpin loops and repair of the DSBat excision sites. Variability in the position in which each hairpin loop is opened, andtl

3p

dspiNptliop

TDwPj

he subsequent processing of the broken ends by polymerases, nucleases, or both,eads to a variety of repair products.

.2. The role of classic NHEJ proteins in the repair of Ac excisionroducts

Given that transposition of the Ac element involves the pro-uction of a DSB whose repair is host-factor dependent, it is noturprising that plants employ NHEJ in the repair of transpositionroducts. Other work has shown that repair of Ac excision events

n yeast cells is largely dependent upon KU70 and other essentialHEJ factors [15]. Additional evidence that canonical NHEJ proteinslay an important role in the repair of these DSBs is clearly seen inhe spectra of excision repair products in the ku70 and lig4 mutant

ines (Fig. 4). While the overall frequency of excision repair eventss not reflected in the sequencing data, it is apparent that the repairf these events is not strictly dependent upon the canonical NHEJathway, as some repair is still carried out in both mutant lines.

able 3istribution of repair products in wild-type and mutant lines. Mean values, reported as pere taken over the four replicates for each line; standard deviations are reported in paren

EP, predominant excision pattern; P, palindromic nucleotides present at repair junction;unction.

PEP P P&D P&I P&D&I

Wild-type55.0 5.5 10.7 0.2 4.2

(12.4) (2.3) (3.7) (0.1) (0.4)

lig41.5 64.9 6.6 2.5 18.4

(0.5) (25.4) (2.2) (0.8) (21.2)

ku7023.1 30.5 10.9 1.6 7.2

(5.3) (4.8) (2.7) (0.5) (0.7)

lig627.4 27.0 8.5 1.5 7.1

(3.5) (3.4) (1.3) (0.3) (0.6)

polL28.3 10.9 9.9 0.7 4.3

(2.5) (4.7) (1.7) (0.3) (1.1)

atm37.9 21.6 10.6 0.9 7.5

(9.5) (10.4) (2.0) (0.5) (1.6)

atr37.5 26.3 6.5 1.3 6.6

(3.4) (9.0) (0.6) (0.4) (0.9)

ir 10 (2011) 1023– 1033 1027

3.3. A shift in the most common repair product in NHEJ deficientlines

One of the most obvious differences in the spectra of footprintsobserved in our NHEJ deficient lines as compared to wild-type,is a shift in the most common repair product from the PEP to afootprint with a six-nucleotide insertion at the excision site. Thisdifference is most striking in our lig4 line where the PEP accounts foronly 1.5% ± 0.5 of the reads observed, whereas the six-nucleotideinsertion product accounts for 64.5% ± 25.6 of the reads. In theku70 line, the PEP and six-nucleotide insertion product accountfor 23.1% ± 5.3 and 29.4% ± 4.4 of the reads respectively. A simi-lar, though less pronounced, shift towards this particular repairproduct is observed in several of our other mutant lines as well.The favorability of the six-nucleotide insertion product can likelybe explained in large part by the sequence of the target site dupli-cations that flank the intact Ac element. If the hairpins producedduring transposition are opened at or near the apex of the hairpinstructure, little or no microhomology will exist between the brokenends; in the wild-type background, these ends can be resolved toproduce the PEP. If, however, either one or both hairpins are openedfurther from the apex of the structure, the overhanging ends mayanneal, forming a highly stable repair intermediate with up to eightcomplementary bases. Resolution of this intermediate would favorproduction of the six-nucleotide insertion product. Either changesin the position in which the hairpins are opened or an increaseddependency on stabilizing microhomologies for repair would shiftthe distribution of repair products away from the PEP and towardsthe six-nucleotide insertion product.

3.4. A shift towards longer stretches of potential microhomologyis observed in lig4

Other work has shown that unlike other ligases, DNA ligase IV(LIG4) is capable of rejoining ends stabilized by little or no micro-homology [41], and that in the absence of LIG4, DSB repair productsgenerally exhibit an increase in the length of microhomology at therepair junction [42]. Plants, which lack a DNA ligase III homologue,may rely on DNA ligase I (LIG1) to rejoin broken ends in the absenceof LIG4. Considered as a nick ligase, LIG1 exhibits a greater prefer-ence for templates stabilized by longer stretches of homology thandoes LIG4 [41,43]; this preference could explain the dramatic shiftaway from the PEP in the lig4 mutant in favor of a product with

much greater potential for microhomology. In order to determinewhether this is a general effect – whether microhomology playsa more significant role in DSB repair in the absence of LIG4 – wecompared the frequency of repair products potentially derived via

ercentage of reads from a given background that fall within the specified category,thesis. Categories of repair products, as further described in the text, are as follows:

D, deletion at repair junction; I, insertion of non-palindromic nucleotides at repair

D D&I I Total ‘P’ Total ‘D’ Total ‘I’

19.9 4.6 0.0 20.6 39.3 9.0(5.9) (0.4) (0.0) (6.3) (10.1) (0.9)3.7 2.3 0.0 92.5 31.1 23.3(1.2) (2.2) (0.0) (3.5) (25.9) (22.7)21.6 5.1 0.0 50.3 44.8 13.9(1.1) (0.6) (0.0) (5.8) (1.2) (1.2)22.5 5.9 0.0 44.1 44.1 14.6(2.9) (2.9) (0.0) (3.1) (1.0) (2.8)41.3 4.5 0.0 25.9 60.1 9.5(4.3) (0.4) (0.0) (6.2) (3.7) (1.1)17.3 4.3 0.0 40.5 39.7 12.7(5.4) (0.9) (0.0) (10.8) (5.4) (0.8)16.5 5.3 0.0 40.7 34.9 13.1(5.8) (1.3) (0.0) (9.3) (6.5) (1.3)

1028 N.D. Huefner et al. / DNA Repair 10 (2011) 1023– 1033

Fig. 4. (Top) Spectra of excision products observed in wild-type and mutant backgrounds; rows correspond to the four biological replicates for each line. Patterns areorganized by category as described in the text (see also Table 3). PEP, predominant excision pattern; P, palindromic nucleotides present at repair junction; D, deletion atrepair junction; I, insertion of non-palindromic nucleotides at repair junction. The ordering of the excision products, and their color representation, is consistent across chartsfor all genotypes and replicates; within a given chart, each section represents a unique excision repair pattern. (Bottom) Sequences of major excision patterns representedi es. Nur ossibld nces t

mbsWoirmiimst

3

eooia

n the spectra of repair products. Vertical dashed lines mark positions of hairpin axight, or both (underlined) sides of the excision site. Nucleotides in bold represent pashed lines represent non-palindromic insertions. (For interpretation of the refere

icrohomology-mediated repair in wt versus lig4 lines. The distri-ution of repair products shows a significant shift towards longertretches of potential microhomology in the absence of LIG4 (Fig. 5).

e considered that the major product in the lig4 background mayvershadow the presence of other repair products, and so, exam-ned a subset of repair products, those with no insertion at theepair site, and found a similar shift in the length of junctionalicrohomology (Fig. 5). Our results are consistent with a model

n which the bulk of Ac transposition events are repaired via NHEJn a LIG4-dependent fashion; other events, even in wild-type lines,

ay be repaired via alt-NHEJ in a LIG4-independent fashion, butuch events appear to require more extensive microhomology athe repair junction.

.5. Deletions in Ac excision products are more frequent in ku70

The KU70/80 heterodimer associates rapidly with the exposednds of a DSB, where it serves as a scaffold for the assembly of

ther essential NHEJ factors and prevents significant degradationf the exposed ends [44–46]. The absence of KU generally resultsn an increase in the size of deletions at the site of repair [47,48]. Toddress the impact KU70 plays on deletion size during the repair

cleotides in lowercase correspond to palindromic sequences derived from the left,e microhomologies between the left and right sides. Nucleotides centered betweeno color in this figure legend, the reader is referred to the web version of the article.)

of Ac excision events, we analyzed each repair product for thepresence and size of deletions at the excision site. Because thelocation of the DSB is non-random, we were able to consider eachbroken end independently and determine how many nucleotideswere lost from each side of the break. In cases where we couldnot unambiguously determine the side from which a particularnucleotide was lost (i.e., nucleotides that exhibit microhomology),these nucleotides were not included in the calculation of deletionsize from either broken end (Fig. 6, inset). As seen in Fig. 6, there isa clear shift towards larger deletions among repair products in theku70 mutant, although there is no significant change in the over-all frequency of deletions (Table 3). Consistent with these results,increased deletion size has also been observed after repair ofendonuclease-induced DSBs in the ku80 mutant of Arabidopsis [32].

3.6. Longer stretches of palindromic nucleotides (P-nucleotides)are observed in repair products from ku70

One of the clearest differences between the distribution of exci-sion repair products in ku70 as compared to wild-type is a majorshift away from the PEP in favor of a six-nucleotide insertion prod-uct. One possible cause for such a shift may be a change in the

N.D. Huefner et al. / DNA Repair 10 (2011) 1023– 1033 1029

F t the rd ir prodi

ptkrn

edppjnsslpKtttsl

Fsdtscc1

the role of LIG6 in the repair of transposition products, we lookedat the number of P-nucleotides present in the repair footprints to

ig. 5. Percentage of reads exhibiting varying lengths of putative microhomology aepict standard deviation across biological replicates. (Left) Distribution of all repa

nsertion (palindromic or non-palindromic).

osition at which the hairpin intermediates are opened. Givenhat the KU70/80 heterodimer is closely associated with the bro-en ends of DNA, it is reasonable to conjecture that it may play aole in limiting the position at which the hairpin structures can beicked.

The introduction of P-nucleotides at the repair junction of manyxcision products is a common byproduct of the hairpin interme-iate step of the transposition mechanism [15,37,39,49,50]. Repairroducts arising from hairpins nicked far from their apex have theotential to introduce longer stretches of P-nucleotides at the repair

unction than those that are nicked near the apex; the number of P-ucleotides present in a particular repair product can therefore giveome measure of the distance from the apex at which the hairpintructure was opened. In our ku70 line, a clear shift is seen towardsonger stretches of P-nucleotides at the repair junction as com-ared to wild-type (Fig. 7). Our data support a model in which theU70/80 heterodimer limits access to the hairpin structure, such

hat the endonuclease or endonucleases responsible for openinghe hairpin preferentially nick the loop within a few basepairs of

he apex. In KU-deficient lines, greater accessibility to the hairpintructure results in the production of longer overhangs, and in turn,onger stretches of P-nucleotides at repair junctions.

ig. 6. Percentage of reads exhibiting varying sizes of deletions from ‘left’ and ‘right’ides of excision site in wild-type (dark grey) and ku70 (light grey) lines. Error barsepict standard deviation across biological replicates. (Inset) Example of how dele-ion sizes was calculated for left and right sides of each excision pattern. Deletionize for each side of the excision site was treated independently; nucleotides thatould not be unambiguously assigned to either side (circled) were not included inalculation of deletion size from either side. The sequence depicted falls into both the–4 bp deletion (see right side) and in the 5–8 bp (see left side) deletion categories.

epair junction in wild-type (dark grey) and lig4 (light grey) backgrounds. Error barsucts. (Right) Distribution of repair products with putative microhomology, but no

3.7. The role of DNA ligase VI in the repair of Ac excision products

As mentioned above, transposition of the Ac element and V(D)Jrecombination demonstrate several similarities, including the pro-duction of hairpin structures at the DSB. In V(D)J recombination,hairpin structures at the coding ends of gene segments that areto become mature Ig or Tcr genes are opened by the endonu-clease ARTEMIS [51]. Sequence and structure analysis by othergroups identified DNA ligase VI (LIG6) as a potential homologue ofARTEMIS in Arabidopsis [52]. Given the similarities between LIG6and ARTEMIS, we sought to test whether LIG6 is involved in therepair of Ac excision products, and more specifically, if it is theendonuclease responsible for opening the hairpin structures pro-duced during transposition. The overall distribution of excisionrepair products exhibits a clear difference between lig6 and thewild-type background, indicating that LIG6 is indeed involved inthe repair of Ac transposition products (Fig. 4). To better understand

get a better sense of where the hairpin structures were opened

Fig. 7. Percentage of reads exhibiting varying sizes of P-nucleotide insertionsderived from either the ‘left’ or ‘right’ side of the excision site in wild-type (dark grey)and ku70 (light grey) lines. Error bars depict standard deviation across biologicalreplicates. (Inset) Example of how the P-nucleotide insertion sizes was calculatedfor left and right sides of each excision pattern. P-nucleotides derived from leftand right flanking sequences were treated independently; nucleotides that couldnot be unambiguously assigned to either side (circled) were included in calcula-tion of insertion size for both sides (comparable results are obtained if these samenucleotides are included in the calculation of insertion size for neither size). Thesequence depicted falls into both the 5–6 P-nucleotide and 9–10 P-nucleotide inser-tion length categories.

1030 N.D. Huefner et al. / DNA Repair 10 (2011) 1023– 1033

Fig. 8. Percentage of reads exhibiting varying sizes of P-nucleotide insertionsderived from either the ‘left’ or ‘right’ side of the excision site in wild-type (darkgil

piPffesthcoaastd

3d

bmaeoibrpcinptpPwriCsaat

Fig. 9. Percentage of reads exhibiting varying sizes of deletions from ‘left’ and ‘right’

rey) and lig6 (light grey) lines. Error bars depict standard deviation across biolog-cal replicates. See Fig. 6 for additional information on how P-nucleotide insertionengths were calculated.

rior to rejoining. As in the case of ku70, we observed a reductionn the fraction of repair products that had between one and three-nucleotides and an increase in the fraction containing betweenour and eight P-nucleotides (Fig. 8). There is a slight increase in theraction of repair products with nine or more P-nucleotides; how-ver, unlike in the ku70 mutant, the difference was not statisticallyignificant in lig6. Our results suggest that while LIG6 is not essen-ial in opening hairpins produced during Ac excision, in its absence,airpins tend to be opened further from the apex. While we cannotonclusively state that LIG6 is a functional homologue of ARTEMIS,ur data support a model in which LIG6 binds hairpin structuresnd either nicks or facilitates the nicking of hairpins close to theirpex. In the absence of LIG6, other nucleases may open the hairpintructures, but tend to do so further from the apex. In either case,he presence of the KU70/80 heterodimer still appears to limit theistance from the apex in which the hairpin may be opened.

.8. Loss of DNA polymerase lambda causes a shift towards largereletions in repair products

Prior to ligation, the ends of a double strand break often muste processed to produce a substrate capable of being joined. Inany cases this is accomplished through resection or trimming by

variety of nucleases; in other cases however, processing includesxtension of the broken ends by polymerases [51,53–56]. Membersf the pol X polymerase family, which exhibit far more flexibilityn their substrate requirements than do other polymerases, haveeen shown to play important roles during both NHEJ and V(D)Jecombination [55–57]. DNA polymerase lambda (POLL), the onlyol X member that has been identified in plants [22,58,59], may beapable of extending broken ends across a DSB, thereby produc-ng a substrate that may be rejoined by LIG4 with minimal loss ofucleotides from the break site. The distribution of excision repairroducts in our polL mutant differs significantly from that of wild-ype, suggesting some role for POLL in the repair of Ac excisionroducts (Fig. 4). The significant reduction in the contribution of theEP in the polL background may provide insight into the mechanismhereby the PEP is produced. As in V(D)J recombination [60,61], our

esults suggest that the hairpins produced during excision of this Acnsertion are most often cleaved at or near the apex of the hairpin.leavage of both hairpin structures at their apices would produce

tructures with non-complementary single base 3′ overhangs. Lig-tion of such products requires either the deletion of nucleotidest the junction or gap filling across a non-continuous template; theemplated extension of the broken ends across this gap, followed

sides of excision site in wild-type (dark grey) and polL (light grey) lines. Error barsdepict standard deviation across biological replicates. See Fig. 5 for additional infor-mation on how deletion sizes were calculated.

by ligation, would lead to production of the PEP. The observationthat POLL enhances the frequency of the PEP relative to other prod-ucts may indicate that POLL is important in filling in such gaps priorto ligation. While the relative abundance of the PEP is reduced inthe polL mutant, POLL is not essential for its production; this isunsurprising given the flexibility in hairpin opening that producesa variety of intermediate products, some of which may be rejoinedto create the PEP without the need for a gap-filling step prior toligation.

While some members of the pol X family (i.e. terminal deoxynu-cleotidyl transferases) are capable of untemplated incorporation ofnucleotides [62], it is unlikely that POLL engages in such an activity.If it did, we would expect to see a decrease in the relative abun-dance of repair products with non-palindromic insertions in thepolL mutant as compared to wild-type, but we did not (9.5% ± 1.1and 9.0% ± 0.9 respectively).

Template based extension by POLL across a DSB may producesufficient complementation between the broken strands to allowfurther extension by other polymerases followed by ligation, orpermit the direct ligation of the broken ends. In the absence ofsuch activity, some ends may fail to be rejoined unless additionalprocessing occurs to expose complementary regions between thebroken ends; without POLL, we would therefore expect to see anincrease in the frequency and size of deletions among repair prod-ucts. Compared to wild type, the distribution of repair productsin our polL line exhibits a significant shift towards more foot-prints with a deletion at the repair junction (39.3% ± 10.1 versus60.1% ± 3.7) (Table 3), as well as a shift towards larger deletions(Fig. 9).

3.9. Lines deficient in ATM or ATR exhibit changes in thedistribution of repair products

Given the important and complex role ATR and ATM play inthe recognition of and response to DSBs, we were interested in theeffects that mutations in these genes might have on the distribu-tion of excision repair products. Though less pronounced than insome of our other mutant lines, loss of either ATM or ATR doesalter the distribution of repair products as compared to wild-type(Fig. 4). The relatively subtle shifts in the distribution of repairproducts may be due in part to some functional overlap between

ATM and ATR; alternatively, ATM and ATR may each play a sub-tle and unique role in dictating the distribution of excision repairproducts. Another possibility is that the transposon system hasevolved a mechanism of DSB creation that, similar to the V(D)J

Repair 10 (2011) 1023– 1033 1031

stanabfneAhswtsailiatammTrt

4

aavnatpcivircdpttt

edbraoipyaLioan

Fig. 10. General model for the repair of DSBs induced during the excision transpos-able elements (TE). Hairpins produced at the broken ends of the TE excision site arebound by KU heterodimer. LIG6 is recruited to the hairpin loops where it partici-

N.D. Huefner et al. / DNA

ystem, does not trigger the full ATM/ATR-mediated response tohe break. The overall distribution of repair products in atm and atrs compared to wild-type exhibits a shift towards footprints with P-ucleotides present at the repair junction (40.5% ± 10.8, 40.7% ± 9.3,nd 20.6% ± 6.3 respectively) (Table 3). The distribution in the num-er of P-nucleotides present in excision repair products is similaror atm and atr. This distribution, which shows a slight but sig-ificant increase in the fraction of repair products with four toight P-nucleotides, is similar to the trend observed in our lig6 line.s discussed above, during V(D)J recombination ARTEMIS cleavesairpins located at the coding ends of gene segments. It has beenhown that the endonuclease activity of ARTEMIS is observed onlyhen it is associated with DNA-PKcs [51,61,63], another member of

he PIKK family; furthermore, both ATM and DNA-PKc have beenhown to phosphorylate ARTEMIS thereby modulating its nucle-se function [64]. If LIG6 functions as one of the primary nucleasesnvolved in the opening of transposition induced hairpins as out-ined above, it is quite possible that its activity, like that of ARTEMIS,s modulated by one or more members of the PIKK family. Thebsence of a DNA-PKcs plant homologue may suggest that associa-ion with a PIKK family member is not necessary for endonucleasectivity in LIG6, or that some other enzyme, such as ATM or ATR,ay fill that role. It is interesting to note that the atm and the atrutants have very similar effects on repair product distribution.

his suggests that, while their functions are clearly not entirelyedundant, the two kinases are both involved in the generation ofhe PEP.

. Conclusion

Next generation sequencing techniques present a novelpproach to addressing mutagenesis [65,66] and DNA repair. Thenalysis of several thousand independent repair products from aariety of mutant backgrounds provides insights into the mecha-ism of DSB repair and an unprecedented view of the distributionnd diversity of repair products arising from a single, well-definedype of DSB. Our results not only confirm the important role NHEJroteins play in the repair of excision-induced DSBs but also indi-ate that several non-canonical NHEJ proteins routinely play a rolen their repair; every mutant tested resulted in decreased preser-ation of the target site. Our results also suggest that DSB is repairs remarkably flexible – that there are many different paths to theejoining of ends. However, our methodology does not allow us toomment on possible effects on the kinetics of repair, nor can weetermine whether a substantial number of breaks remain unre-aired in any of our lines. In addition, our PCR-based method limitshe size of observable deletions to those that do not extend beyondhe boundaries of our primers, and does not permit us to observeranslocation events.

From our results we propose the following model (Fig. 10). Uponxcision of the transposable element Ac (coupled with the pro-uction of hairpin structures at the free ends), KU heterodimerinds the broken ends, perhaps providing a scaffold for additionalepair proteins, and helps to limit the site at which the hairpinsre opened. LIG6 also clearly affects the location of the nick. Basedn its homology with ARTEMIS, it is tempting to suggest that LIG6tself acts as the endonuclease responsible for opening the hair-ins; however, the biochemical activities of this protein have notet been investigated. Positioning of LIG6 through a physical inter-ction with the KU complex, as well as functional regulation ofIG6 by ATR, ATM, or both are possibilities that warrant further

nvestigation. After nicking, in many cases POLL likely extends oner both of the broken ends, polymerizing in a templated mannercross the break. The broken ends are then rejoined primarily, butot exclusively, by LIG4. As has often been observed in nonhomolo-

pates in the opening of the DNA near the apex of the hairpin structure; activity ofLIG6 may be governed in part by ATM, ATR, or both. Broken ends are processed togenerate a substrate that is rejoined by LIG4 as described in the text.

gous end-joining [67], the entire system is remarkably flexible, andeven in wild-type plants a variety of modes of repair are employed.

Contributions

N.D.H. and A.B.B. contributed to research design; C.F.W. con-tributed to the donation of Ac T-DNA insertion line and assistancewith identification of stock lines; N.D.H. and Y.M. contributed tothe construction of stock lines; N.D.H. contributed to the prepa-ration of materials; N.D.H. and I.K. contributed to the design andconstruction of Perl programs for sequence data processing; N.D.H.and A.B.B. contributed to data analysis; N.D.H. contributed to thepreparation of manuscript.

Conflict of interest statement

The authors declared that they have no conflict of interest.

Acknowledgments

We thank Drs. Kris Niyogi and Ben Gutman (Department ofPlant and Microbial Biology, University of California, Berkeley) forproviding us with seeds from their backcrossed lig6-1 line andDr. Tomoyuki Furukawa (Department of Plant Biology, Univer-sity of California, Davis) for providing us with seeds for the polLline. We thank Dr. Charles Nicolet (DNA Technologies and Expres-sion Analysis Cores, University of California, Davis) for technicalassistance with Illumina sequencing. This work was supportedby USDA NRICGP grant # 04-35301-14740 (to A.B.B.) and a grantfrom the University of California Davis Genome Center DNA Tech-nologies Core. Support for N.D.H. came from UC Davis’s NIH MCB

training grant # T32 GM070377 and an Elsie Taylor Stocking Memo-rial Fellowship. Contributions received by Clifford F. Weil to thismanuscript were sponsored by the National Science Foundationand by Purdue University.

1 Repa

A

t

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

032 N.D. Huefner et al. / DNA

ppendix A. Supplementary data

Supplementary data associated with this article can be found, inhe online version, at doi:10.1016/j.dnarep.2011.07.011.

eferences

[1] J. Melo, D. Toczyski, A unified view of the DNA-damage checkpoint, Curr. Opin.Cell Biol. 14 (2002) 237–245.

[2] R.S. Pitcher, N.C. Brissett, A.J. Doherty, Nonhomologous end-joining in bacteria:a microbial perspective, Annu. Rev. Microbiol. 61 (2007) 259–282.

[3] J.Y. Bleuyard, M.E. Gallego, C.I. White, Recent advances in understanding of theDNA double-strand break repair machinery of plants, DNA Repair (Amst.) 5(2006) 1–12.

[4] K.M. Culligan, C.E. Robertson, J. Foreman, P. Doerner, A.B. Britt, ATR and ATMplay both distinct and additive roles in response to ionizing radiation, Plant J.48 (2006) 947–961.

[5] M. Cuadrado, B. Martinez-Pastor, O. Fernandez-Capetillo, ATR activation inresponse to ionizing radiation: still ATM territory, Cell Div. 1 (2006) 7.

[6] A. Pastink, J.C. Eeken, P.H. Lohman, Genomic integrity and the repair ofdouble-strand DNA breaks, Mutat. Res. 480–481 (2001) 37–50.

[7] G. Iliakis, Backup pathways of NHEJ in cells of higher eukaryotes: cell cycledependence, Radiother. Oncol. 92 (2009) 310–315.

[8] C. Boboila, M. Jankovic, C.T. Yan, J.H. Wang, D.R. Wesemann, T. Zhang, A.Fazeli, L. Feldman, A. Nussenzweig, M. Nussenzweig, F.W. Alt, Alternativeend-joining catalyzes robust IgH locus deletions and translocations in the com-bined absence of ligase 4 and Ku70, Proc. Natl. Acad. Sci. U.S.A. 107 (2010)3034–3039.

[9] J.E. Haber, Alternative endings, Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 405–406.10] J.L. Ma, E.M. Kim, J.E. Haber, S.E. Lee, Yeast Mre11 and Rad1 proteins define a

Ku-independent mechanism to repair double-strand breaks lacking overlap-ping end sequences, Mol. Cell. Biol. 23 (2003) 8820–8828.

11] L. Zhou, R. Mitra, P.W. Atkinson, A.B. Hickman, F. Dyda, N.L. Craig, Transpositionof hAT elements links transposable elements and V(D)J recombination, Nature432 (2004) 995–1001.

12] T.A. Rinehart, C. Dean, C.F. Weil, Comparative analysis of non-random DNArepair following Ac transposon excision in maize and Arabidopsis, Plant J. 12(1997) 1419–1427.

13] L. Krishnaswamy, J. Zhang, T. Peterson, Fusion of reverse-oriented Ds terminifollowing abortive transposition in Arabidopsis: implications for the mecha-nism of Ac/Ds transposition, Plant Cell Rep. 29 (2010) 413–417.

14] B. McClintock, The origin and behavior of mutable loci in maize, Proc. Natl.Acad. Sci. U.S.A. 36 (1950) 344–355.

15] J. Yu, K. Marshall, M. Yamaguchi, J.E. Haber, C.F. Weil,Microhomology-dependent end joining and repair of transposon-inducedDNA hairpins by host factors in Saccharomyces cerevisiae, Mol. Cell. Biol. 24(2004) 1351–1364.

16] R. Cronn, A. Liston, M. Parks, D.S. Gernandt, R. Shen, T. Mockler,Multiplex sequencing of plant chloroplast genomes using Solexasequencing-by-synthesis technology, Nucleic Acids Res. 36 (2008) e122.

17] D.R. Smith, A.R. Quinlan, H.E. Peckham, K. Makowsky, W. Tao, B. Woolf, L. Shen,W.F. Donahue, N. Tusneem, M.P. Stromberg, D.A. Stewart, L. Zhang, S.S. Ranade,J.B. Warner, C.C. Lee, B.E. Coleman, Z. Zhang, S.F. McLaughlin, J.A. Malek, J.M.Sorenson, A.P. Blanchard, J. Chapman, D. Hillman, F. Chen, D.S. Rokhsar, K.J.McKernan, T.W. Jeffries, G.T. Marth, P.M. Richardson, Rapid whole-genomemutational profiling using next-generation sequencing technologies, GenomeRes. 18 (2008) 1638–1642.

18] A.M. Bhatt, T. Page, E.J. Lawson, C. Lister, C. Dean, Use of Ac as an insertionalmutagen in Arabidopsis, Plant J. 9 (1996) 935–945.

19] J. Friesner, A.B. Britt, Ku80- and DNA ligase IV-deficient plants are sensitiveto ionizing radiation and defective in T-DNA integration, Plant J. 34 (2003)427–440.

20] Y.K. Wang, W.C. Chang, P.F. Liu, M.K. Hsiao, C.T. Lin, S.M. Lin, R.L. Pan, Ovate fam-ily protein 1 as a plant Ku70 interacting protein involving in DNAdouble-strandbreak repair, Plant Mol. Biol. 74 (2010) 453–466.

21] W.M. Waterworth, G. Masnavi, R.M. Bhardwaj, Q. Jiang, C.M. Bray, C.E. West,A plant DNA ligase is an important determinant of seed longevity, Plant J. 63(2010) 848–860.

22] A. Amoroso, L. Concia, C. Maggio, C. Raynaud, C. Bergounioux, E. Crespan, R.Cella, G. Maga, Oxidative DNA damage bypass in Arabidopsis thaliana requiresDNA polymerase {lambda} and proliferating cell nuclear antigen 2, Plant Cell23 (2011) 806–822.

23] S. Roy, S.R. Choudhury, S.K. Singh, K.P. Das, AtPollambda, a homolog of mam-malian DNA polymerase lambda in Arabidopsis thaliana, is involved in the repairof UV-B induced DNA damage through the dark repair pathway, Plant CellPhysiol. 52 (2011) 448–467.

24] K. Culligan, A. Tissier, A. Britt, ATR regulates a G2-phase cell-cycle checkpointin Arabidopsis thaliana, Plant Cell 16 (2004) 1091–1104.

25] V. Garcia, H. Bruchet, D. Camescasse, F. Granier, D. Bouchez, A. Tissier, AtATM is

essential for meiosis and the somatic response to DNA damage in plants, PlantCell 15 (2003) 119–132.

26] S.J. Clough, A.F. Bent, Floral dip: a simplified method forAgrobacterium-mediated transformation of Arabidopsis thaliana, Plant J.16 (1998) 735–743.

[

[

ir 10 (2011) 1023– 1033

27] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual,2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

28] D.J. Lavery, L. Lopez-Molina, F. Fleury-Olela, U. Schibler, Selective amplifica-tion via biotin- and restriction-mediated enrichment (SABRE), a novel selectiveamplification procedure for detection of differentially expressed mRNAs, Proc.Natl. Acad. Sci. U.S.A. 94 (1997) 6831–6836.

29] B. Kaboord, R. Liermann, Biotinylated DNA binding capacities of Pierce AvidinSupports, Pierce Application Notes, AN0014.1, 2006.

30] M.A. Quail, I. Kozarewa, F. Smith, A. Scally, P.J. Stephens, R. Durbin, H. Swerdlow,D.J. Turner, A large genome center’s improvements to the Illumina sequencingsystem, Nat. Methods 5 (2008) 1005–1010.

31] N.V. Fedoroff, Maize transposable elements, in: D.E. Berg, M.M. Howe (Eds.),Mobile DNA, American Society for Microbiology, Washington, DC, 1989.

32] K. Osakabe, Y. Osakabe, S. Toki, Site-directed mutagenesis in Arabidopsis usingcustom-designed zinc finger nucleases, Proc. Natl. Acad. Sci. U.S.A. 107 (2010)12034–12039.

33] S. de Pater, L.W. Neuteboom, J.E. Pinas, P.J. Hooykaas, B.J. van derZaal, ZFN-induced mutagenesis and gene-targeting in Arabidopsis throughAgrobacterium-mediated floral dip transformation, Plant Biotechnol. J. 7 (2009)821–835.

34] F. Zhang, M.L. Maeder, E. Unger-Wallace, J.P. Hoshaw, D. Reyon, M. Christian,X. Li, C.J. Pierick, D. Dobbs, T. Peterson, J.K. Joung, D.F. Voytas, High frequencytargeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases, Proc.Natl. Acad. Sci. U.S.A. 107 (2010) 12028–12033.

35] P. Windels, S. De Buck, E. Van Bockstaele, M. De Loose, A. Depicker, T-DNAintegration in Arabidopsis chromosomes. Presence and origin of filler DNAsequences, Plant Physiol. 133 (2003) 2061–2068.

36] J.J. Lafaille, A. DeCloux, M. Bonneville, Y. Takagaki, S. Tonegawa, Junctionalsequences of T cell receptor gamma delta genes: implications for gamma deltaT cell lineages and for a novel intermediate of V-(D)-J joining, Cell 59 (1989)859–870.

37] V. Colot, V. Haedens, J.L. Rossignol, Extensive, nonrandom diversity of excisionfootprints generated by Ds-like transposon Ascot-1 suggests new parallels withV(D)J recombination, Mol. Cell. Biol. 18 (1998) 4337–4346.

38] P.W. Atkinson, W.D. Warren, D.A. O’Brochta, The hobo transposable element ofDrosophila can be cross-mobilized in houseflies and excises like the Ac elementof maize, Proc. Natl. Acad. Sci. U.S.A. 90 (1993) 9693–9697.

39] P. Grappin, C. Audeon, M.C. Chupeau, M.A. Grandbastien, Molecular and func-tional characterization of slide, an Ac-like autonomous transposable elementfrom tobacco, Mol. Gen. Genet. 252 (1996) 386–397.

40] S.M. Lewis, P nucleotides, hairpin DNA and V(D)J joining: making the connec-tion, Semin. Immunol. 6 (1994) 131–141.

41] J. Gu, H. Lu, B. Tippin, N. Shimazaki, M.F. Goodman, M.R. Lieber, XRCC4:DNAligase IV can ligate incompatible DNA ends and can ligate across gaps, EMBO J.26 (2007) 1010–1023.

42] R.J. Romeijn, M.M. Gorski, M.A. van Schie, J.N. Noordermeer, L.H. Mullenders, W.Ferro, A. Pastink, Lig4 and rad54 are required for repair of DNA double-strandbreaks induced by P-element excision in Drosophila, Genetics 169 (2005)795–806.

43] L. Liang, L. Deng, S.C. Nguyen, X. Zhao, C.D. Maulion, C. Shao, J.A. Tis-chfield, Human DNA ligases I and III, but not ligase IV, are required formicrohomology-mediated end joining of DNA double-strand breaks, NucleicAcids Res. 36 (2008) 3297–3310.

44] K. Tamura, Y. Adachi, K. Chiba, K. Oguchi, H. Takahashi, Identification of Ku70and Ku80 homologues in Arabidopsis thaliana: evidence for a role in the repairof DNA double-strand breaks, Plant J. 29 (2002) 771–781.

45] C.E. West, W.M. Waterworth, G.W. Story, P.A. Sunderland, Q. Jiang, C.M. Bray,Disruption of the Arabidopsis AtKu80 gene demonstrates an essential role forAtKu80 protein in efficient repair of DNA double-strand breaks in vivo, Plant J.31 (2002) 517–528.

46] S.A. Nick McElhinny, C.M. Snowden, J. McCarville, D.A. Ramsden, Ku recruitsthe XRCC4-ligase IV complex to DNA ends, Mol. Cell. Biol. 20 (2000)2996–3003.

47] S.J. Boulton, S.P. Jackson, Saccharomyces cerevisiae Ku70 potentiates illegitimateDNA double-strand break repair and serves as a barrier to error-prone DNArepair pathways, EMBO J. 15 (1996) 5093–5103.

48] F. Liang, M. Jasin, Ku80-deficient cells exhibit excess degradation of extrachro-mosomal DNA, J. Biol. Chem. 271 (1996) 14405–14411.

49] A.B. Britt, V. Walbot, Germinal and somatic products of Mu1 excision from theBronze-1 gene of Zea mays, Mol. Gen. Genet. 227 (1991) 267–276.

50] E.S. Coen, T.P. Robbins, J. Almeida, A. Hudson, R. Carpenter, Consequences andmechanisms of transposition in Antirrhinum majus, in: D.E. Berg, M.M. Howe(Eds.), Mobile DNA, American Society for Microbiology, Washington, DC, 1989,pp. 413–436.

51] Y. Ma, U. Pannicke, K. Schwarz, M.R. Lieber, Hairpin opening and over-hang processing by an Artemis/DNA-dependent protein kinase complexin nonhomologous end joining and V(D)J recombination, Cell 108 (2002)781–794.

52] D. Bonatto, L.F. Revers, M. Brendel, J.A. Henriques, The eukaryoticPso2/Snm1/Artemis proteins and their function as genomic and cellular care-takers, Braz. J. Med. Biol. Res. 38 (2005) 321–334.

53] M.R. Lieber, The mechanism of human nonhomologous DNA end joining, J. Biol.Chem. 283 (2008) 1–5.

54] Y. Ma, H. Lu, B. Tippin, M.F. Goodman, N. Shimazaki, O. Koiwai, C.L. Hsieh, K.Schwarz, M.R. Lieber, A biochemically defined system for mammalian nonho-mologous DNA end joining, Mol. Cell 16 (2004) 701–713.

Repa

[

[

[

[

[

[

[

[

[

[

[

[

N.D. Huefner et al. / DNA

55] T.E. Wilson, M.R. Lieber, Efficient processing of DNA ends during yeast nonho-mologous end joining. Evidence for a DNA polymerase beta (Pol4)-dependentpathway, J. Biol. Chem. 274 (1999) 23599–23609.

56] J.M. Daley, R.L. Laan, A. Suresh, T.E. Wilson, DNA joint dependence of pol Xfamily polymerase action in nonhomologous end joining, J. Biol. Chem. 280(2005) 29030–29037.

57] S.A. Nick McElhinny, J.M. Havener, M. Garcia-Diaz, R. Juarez, K. Bebenek, B.L.Kee, L. Blanco, T.A. Kunkel, D.A. Ramsden, A gradient of template dependencedefines distinct biological roles for family X polymerases in nonhomologousend joining, Mol. Cell 19 (2005) 357–366.

58] Y. Uchiyama, S. Kimura, T. Yamamoto, T. Ishibashi, K. Sakaguchi, Plant DNApolymerase lambda, a DNA repair enzyme that functions in plant meristematicand meiotic tissues, Eur. J. Biochem. 271 (2004) 2799–2807.

59] M. Garcia-Diaz, O. Dominguez, L.A. Lopez-Fernandez, L.T. de Lera, M.L. Saniger,J.F. Ruiz, M. Parraga, M.J. Garcia-Ortiz, T. Kirchhoff, J. del Mazo, A. Bernad, L.

Blanco, DNA polymerase lambda (Pol lambda), a novel eukaryotic DNA poly-merase with a potential role in meiosis, J. Mol. Biol. 301 (2000) 851–867.

60] H. Lu, K. Schwarz, M.R. Lieber, Extent to which hairpin opening by theArtemis:DNA-PKcs complex can contribute to junctional diversity in V(D)Jrecombination, Nucleic Acids Res. 35 (2007) 6917–6923.

[

ir 10 (2011) 1023– 1033 1033

61] D. Niewolik, U. Pannicke, H. Lu, Y. Ma, L.C. Wang, P. Kulesza, E. Zandi, M.R.Lieber, K. Schwarz, DNA-PKcs dependence of Artemis endonucleolytic activity,differences between hairpins and 5′ or 3′ overhangs, J. Biol. Chem. 281 (2006)33900–33909.

62] F.J. Bollum, Thermal conversion of nonpriming deoxyribonucleic acid to primer,J. Biol. Chem. 234 (1959) 2733–2734.

63] A.A. Goodarzi, Y. Yu, E. Riballo, P. Douglas, S.A. Walker, R. Ye, C. Harer, C.Marchetti, N. Morrice, P.A. Jeggo, S.P. Lees-Miller, DNA-PK autophosphorylationfacilitates Artemis endonuclease activity, EMBO J. 25 (2006) 3880–3889.

64] K. Dahm, Functions and regulation of human Artemis in double strand breakrepair, J. Cell. Biochem. 100 (2007) 1346–1351.

65] S.R. Birkeland, N. Jin, A.C. Ozdemir, R.H. Lyons Jr., L.S. Weisman, T.E. Wilson,Discovery of mutations in Saccharomyces cerevisiae by pooled linkage analysisand whole-genome sequencing, Genetics 186 (2010) 1127–1137.

66] M. Lynch, W. Sung, K. Morris, N. Coffey, C.R. Landry, E.B. Dopman, W.J. Dickinson,

K. Okamoto, S. Kulkarni, D.L. Hartl, W.K. Thomas, A genome-wide view of thespectrum of spontaneous mutations in yeast, Proc. Natl. Acad. Sci. U.S.A. 105(2008) 9272–9277.

67] M.R. Lieber, The mechanism of double-strand DNA break repair by the nonho-mologous DNA end-joining pathway, Annu. Rev. Biochem. 79 (2010) 181–211.