BP Reaction LR Reaction Gateway cloning system.

11
BP Reaction LR Reaction Gateway cloning system

Transcript of BP Reaction LR Reaction Gateway cloning system.

Page 1: BP Reaction LR Reaction Gateway cloning system.

BP Reaction

LR Reaction

Gateway cloning system

Page 2: BP Reaction LR Reaction Gateway cloning system.
Page 3: BP Reaction LR Reaction Gateway cloning system.

Why Gateway

• No restriction enzymes needed

• Fast

• High efficiency

• Multiple destination vectors

• Site-directed mutagenesis (Empty donor vector is very small ~2.3kb)

Page 4: BP Reaction LR Reaction Gateway cloning system.

1. Design the primers

• attB1(Foward): GGGGACAAGTTTGTACAAAAAAGCAGGCTTC

• attB2(Reverse) GGGGACCACTTTGTACAAGAAAGCTGGGTC

Page 5: BP Reaction LR Reaction Gateway cloning system.

2. BP reaction

• PCR product need to be recovered from gel. Important!

PCR product 4.0ul

pDONR/Zeo 0.5ul

BP clonase 0.5ul

• O/N at R/T

• LB+Zeocin (Half salt)

Page 6: BP Reaction LR Reaction Gateway cloning system.

3. Sequencing

• PCR product+donor vector=Entry clone

• Pick 1-2 colonies (no colony PCR needed)

• M13f and M13r are used to sequence cloned fragment

Page 7: BP Reaction LR Reaction Gateway cloning system.

4. LR Reaction

Entry clone 1ul

Destination vector 1ul

LR clonase 0.5-1.0ul

TE buffer/H2O 2.0-2.5ul

• 1 hour at R/T

Page 8: BP Reaction LR Reaction Gateway cloning system.

5. Destination clones

• Bacterial selection=destination vector

• After plasmid isolation, run a gel. Sometimes entry vector will be co-transformed. Make sure there is no bright band of entry vector.

• Colony PCR if necessary.

Page 9: BP Reaction LR Reaction Gateway cloning system.

Gateway compatible destination vector construction

• Insert Gateway cassette in to target Vector.• Three cassettes with corresponding three

different reading frames. Decide which one you need. Consider N-/C-terminal fusion.

• Blunt ligation. You need check the cassette orientation.

• Bacterial selection: chloramphenicol+X• You can only use ccdB survival strains.

Page 10: BP Reaction LR Reaction Gateway cloning system.

Currently available destination vectors

• pBASTA-35S-GFP-GW• pBASTA-35S-FLAG-GW• pHYG-35S-GFP-GW• pTA7002-GW• pBASTA-GUS-GW• pGTB9BS-GW (New)• pGAD GH-GW (New)• pGEMHE-GW (New)• pGEX4T-3-GW

Page 11: BP Reaction LR Reaction Gateway cloning system.