Boletín Médico ISSN-1665-1146himfg.com.mx/descargas/documentos/BMHIM_2012/BMHIM... · Boletín...

ISSN-1665-1146

Boletín Médico del

EDITORIAL

77 Conjugated vaccine against Streptococcus pneumoniae: how many doses?Fortino Solórzano Santos

REVIEW ARTICLE

79 Maternal diet and vitamin D during pregnancy and association with bone health during childhood. Review of the literatureAna Cecilia Garza-Gisholt, Rodolfo Rivas-Ruiz, and Patricia Clark

RESEARCH ARTICLES

87 Visual outcome in pediatric patients with corneal transplantation: results of 10 years experienceMayeli Muñoz-Ocampo, Tania Yanet Valderrama-Atayupanqui, Oswaldo Manuel Aguirre-Luna, Manuel Rodríguez-Almaraz, Marco A. Ramírez-Ortiz

92 Comparison of the immune response against strains of Streptococcus pneumoniae, assessed by hemagglutination, in children immunized with heptavalent conjugated pneumococcal vaccine (two primary vaccinations with or without reinforcement)Norma Angélica Silva-Rosales, Carlos Enrique Tene, Víctor Hugo Cervantes-Kardash, Mario del Toro

98 Prevalence of vitamin D receptor gene polymorphisms in Mexican children with chronic kidney diseaseElba Onelida Medina-Hernández, Benjamín Antonio Rodríguez-Espino, Ana María Hernández-Sánchez, Lourdes Matilde Ortiz-Vázquez, Perla Oropeza, Daniel Díaz, Rubén Aldana-Vergara, Francisco Velásquez-Forero, Olynka Vega, Ricardo Correa-Rotter, Mara Medeiros

104 Direct medical costs of treating children under 2 years of age with respiratory syncytial virus in MéxicoJoaquín F. Mould-Quevedo, Iris Contreras-Hernández, Silvia Martínez-Valverde, Miguel A. Villasís-Keever, Víctor M. Granados-García, Guillermo Salinas-Escudero, Onofre Muñoz-Hernández

CASE REPORTS

109 Osteopetrosis — calcification beyond the skeletal system. A case reportPatricia Mejía Osuna, Jesús Santos-Guzmán, Luis Villela, Enrique Javier Cedillo-Alemán, Adrián García

114 Borreliosis: recurrent fever due to spirochetes. Case reportNorberto Sotelo Cruz, Pedro Valencia Mayoral

CLINICOPATHOLOGICAL CASE

119 Systemic lupus erythematosus and antiphospholipid antibody syndrome in an adolescent patientMaría del Rocío Maldonado Velázquez, Sandra Enciso Peláez, María Argelia Escobar, Rosa Delia Delgado Hernández, Gisela Abigail Monroy Prado

TOPICS IN PEDIATRICS

132 Dermatologic manifestations of Alagille syndromeAndré Morales Martínez, Carlos Alfredo Mena Cedillos, Jaime Nieto Zermeño, Verónica Morán Barroso, Salvador Villapando Carrión, Silvia Ramírez Dovala

Boletín Médico delHospital Infantil de México

BIMONTHLY PUBLICATIONVol. 69 March-April, 2012 No.2

CONTENTS

Hospital Infantil de MéxicoFederico Gómez

Instituto Nacional de Salud

Complete English versionwww.himfg.edu.mx

www.nietoeditores.com.mx

Boletín Médico del Hospital Infantil de MéxicoISSN 1665-1146

Copyright04-1985-000000000361-102

Indexed inEmbase/Excerpta Medica

Current Awareness in Biological Sciences (CABS)Index Medicus Latinoamericano (IMLA)

Other Indexes and DatabasesLiteratura Latinoamericana en Ciencias de la Salud (LILACS)

Scientific Electronic Library Online (SciELO)Biblioteca Virtual en Salud (BVS)

Periódica-Índice de Revistas Latinoamericanas en Ciencias, UNAMLatindex

EBSCO/MedicLatina

Compact discArtemisa

Design and printingEdición y Farmacia S.A. de C.V.

José Martí 55, Col. Escandón11800 Miguel Hidalgo, Ciudad de México

Tel.: 56 78 28 11

Layout: Elidé MoralesEditorial coordination: Arturo A. Peña

VITAL STATISTICS

137 Principal causes of childhood mortality in Mexico: recent trendsSonia B. Fernández-Cantón, Gonzalo Gutiérrez Trujillo, Ricardo Viguri Uribe

LETTER TO THE EDITOR

142 Early diagnosis and adequate treatment of patients with primary immunodeficiencyAmos Etzioni, Ricardo Sorensen, Executive Committee, World Primary Immunodeficiency Week (2012)

SubSCRIPTIONS

In Mexico: $500 pesosOutside Mexico: $60 USD

FORmS OF PAymENT

CashDirect at the cashier

Hospital Infantil de México Federico GómezReceived

Editing Department MédicasEdificio Mundet, tercer piso

Dr. Márquez 162, Col. Doctores06720 Cuauhtémoc, Mexico City

Hours: M-F: 8 am - 3 pm

Bank depositBanorte: 0102801543

Send copy of the deposit by FAX:(55) 57 61 89 28

Electronic bank transferBanorte

Routing number: 072180001028015432“Fondo de Ediciones Médicas”

CheckSend by mail to:

Hospital Infantil de México Federico Gómez

Departamento de Ediciones MédicasEdificio Mundet, tercer piso

Dr. Márquez 162, Col. Doctores06720 Cuauhtémoc, Ciudad de México

CONDITIONS:

Issues will be delivered or mailed to all subscribers either directly or by mail. For mailed issues,

please include the following information:Name

AddressTelephone

E-mail

FOR quESTIONS OR ANy ADDITIONAL INFORmATION:

Tel./Fax: (55) 57 61 89 28Email: [email protected]


The Pediatric Journal with the highest diffusion in Mexico

More than 65 years of uninterrupted publication. Six issues each year with more than 70 articles authored by national and international investigators with the most

relevant themes

BIOMEDICALJesús Kumate RodRíguez1

PedRo Valencia mayoRal2

PUBLIC HEALTHsonia FeRnández cantón5

HoRtensia Reyes moRales4

PEDIATRIC THEMESluis Jasso gutiéRRez2

luis Velásquez Jones2

HEALTH EDUCATION AND CLINICAL ETHICSJaime nieto zeRmeño2

Juan José luis sienRa monge2


FedeRico gómez santos †Founder

José albeRto gaRcía aRanda

General Director

onoFRe muñoz HeRnández

Associate Director

gonzalo gutiéRRez

Editor

maRía g. camPos laRa

Executive Editor

RicaRdo ViguRi uRibe

Associate Editor and Administrator

sHaRon moRey

Associate Editor

Julia seguRa uRibe

Adjunct Editor

EDITORIAL COMMITTEE

CLINICALblanca estela del Río naVaRRo2

FoRtino solóRzano santos3

CLINICAL EPIDEMIOLOGYJuan gaRduño esPinosa2

miguel ángel Villasis3

CLINICAL CASESsalVadoR VillalPando caRRión2

CLINICOPATHOLOGICAL CASESstanislaw sadowinsKi Pine2

1 Fundación IMSS2 Hospital Infantil de México Federico Gómez

3 Hospital de Pediatría, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social4 Instituto Nacional de Salud Pública, Secretaría de Salud

5 Dirección de Información Epidemiológica, Dirección General de Epidemiología, Secretaría de Salud


José luis aRRedondo gaRcía instituto nacional de PediatRía méxico d.F., méxico

manuel baeza bacab centRo médico de las améRicas méRida, yucatán, méxico

eduaRdo bancaleRi Holtz cHildRen´s HosPital miami, FloRida, u. s.alessandRa caRneVale cantoni instituto nacional de medicina genómica méxico d.F., méxico

aldo castañeda unidad de ciRugía caRdioVasculaR de guatemala guatemala, guatemala

leticia castillo cHildRen´s medical centeR, dallas, texas, u. s. uniVeRsity oF texas soutHwesteRn

FRancisco cigaRRoa uniVeRsity HosPital san antonio, texas, u. s.aleJandRo cRaVioto quintana oResPes s.a. de c.V. méxico d.F., méxico

blanca estela del Río naVaRRo HosPital inFantil de méxico FedeRico gómez méxico d.F., méxico

alFonso delgado Rubio HosPital uniVeRsitaRio madRid sancHinaRRo madRid, esPaña

aRtuRo FaJaRdo gutiéRRez centRo médico nacional s. xxi, imss méxico d.F., méxico

samuel FloRes HueRta HosPital inFantil de méxico FedeRico gómez méxico d.F., méxico

caRlos FRanco PaRedes emoRy uniVeRsity HosPital atlanta, geoRgia, u. s.saRa HueRta yePez HosPital inFantil de méxico FedeRico gómez méxico d.F., méxico

Fima liFsHitz cottage cHildRen´s HosPital sta. baRbaRa, caliFoRnia, u. s.gabRiel manJaRRez centRo médico nacional s. xxi, imss méxico d.F., méxico

HomeRo maRtínez salgado HosPital inFantil de méxico FedeRico gómez méxico d.F., méxico

maRa medeiRos HosPital inFantil de méxico FedeRico gómez méxico d.F., méxico

Juan Pablo méndez blanco instituto nacional de ciencias médicas y nutRición méxico d.F., méxico

salVadoR zubiRán

guadaluPe miRanda noVales centRo médico nacional s. xxi, imss méxico d.F., méxico

VeRónica moRán baRRoso HosPital inFantil de méxico FedeRico gómez méxico d.F., méxico

ángel nogales esPeRt HosPital uniVeRsitaRio Reina soFía cóRdoba, esPaña

samuel nuRKo cHildRen’s HosPital boston boston, massacHusetts, u. s.miguel o’Ryan uniVeRsidad de cHile santiago de cHile, cHile

albeRto Peña cincinnati cHildRen´s HosPital cincinnati, oHio, u. s.FRancisco J. Puga muñuzuRi mayo clinic RocHesteR, minnesota, u. s.guilleRmo Ramón HosPital inFantil de méxico FedeRico gómez méxico d.F., méxico

Vesta RicHaRdson lóPez collada centRo nacional de salud PaRa la inFancia y méxico d.F., méxico

la adolescencia

Fabio salamanca gómez centRo médico nacional s. xxi, imss méxico d.F., méxico

eduaRdo salazaR lindo ds-consult s.a.c. lima, PeRú

noRbeRto sotelo cRuz escuela de medicina, uniVeRsidad de sonoRa HeRmosillo, sonoRa, méxico

aleJandRo sweet coRdeRo stanFoRd uniVeRsity scHool oF medicine stanFoRd, caliFoRnia, u. s.gustaVo VaRela Fascinetto HosPital inFantil de méxico FedeRico gómez méxico d.F., méxico

aRtuRo VaRgas oRigel Facultad de medicina, uniVeRsidad de guanaJuato león, guanaJuato, méxico

edgaR Vásquez gaRibay instituto de nutRición Humana guadalaJaRa, Jalisco, méxico

FedeRico Raúl Velázquez centRo médico nacional s. xxi, imss méxico d.F., méxico

albeRto VillaseñoR sieRRa centRo de inVestigaciones biomédicas de occidente guadalaJaRa, Jalisco, méxico

EDITORIAL BOARD

77Vol. 69, March-April 2012

Unidad Médica de Alta Especialidad, Hospital de Pediatría, Centro Médico Nacional Siglo XXI, Instituto Mexicano del Seguro Social, México, D.F., México

Correspondence: Dr. Fortino SolorzanoUnidad Médica de Alta EspecialidadHospital de Pediatría, Centro Médico Nacional Siglo XXI Instituto Mexicano del Seguro Social México, D.F., MéxicoE-mail: [email protected]

Received for publication: 4-10-12Accepted for publication: 4-12-12

Conjugated vaccine against Streptococcus pneumoniae: how many doses?

editorial

Bol Med Hosp Infant Mex 2012;69(2):77-78

Dr. Fortino Solórzano Santos

Streptococcus pneumoniae infections have been a great challenge for pediatricians because of their frequency in children <5 years of age and especia-

lly those children <2 years of age. Because of this, since the year 2000 a pneumococcal conjugate vaccine was introduced in the U.S. in clinical practice that included seven serotypes (4, 6B, 9V, 14, 18C, 19F and 23F). These accounted for ~80% of the serotypes isolated in children in the U.S. and Europe.1

Several studies demonstrated the efficacy of the vac-cine when given in four doses: at 2 months, 4 months, 6 months and 12–15 months of age. We observed a protec-tive efficacy against disease caused by serotypes included in the vaccine of 89–97% (95% CI: 82.7-99.9%) and an efficiency of ~90%.2.3For this reason, it was recommended to administer the heptavalent conjugate vaccine in four do-ses. However, the number of doses administered globally varies. This has raised concerns about the protection that is achieved with fewer doses than initially recommended.

In this issue of Boletin Medico de Hospital Infantil (BMHIM) Silva-Rosales et al. present a study that eva-luated the immune response to the heptavalent vaccine

in children who received two primary vaccinations with or without a reinforcement dose and evidence of a lower response in children who didn´t received the reinforcement dose.4 This study has some limitations. For example, the number of subjects evaluated and, particularly, the techni-que used for evaluation, does not allow comparison of the results with those of other studies that have calculated the concentration of antibodies (≥0.35 mg/ml) to determine the serological response to the different serotypes.

In a meta-analysis by Scott et al., there were minimal differences between two- or three-dose vaccination sche-dules compared to the levels of seropositivity, although heterogeneity was found in the studies analyzed when comparing the patterns of two or three booster doses. There was also no difference between these, but there was a slight bias towards the scheme of three doses plus a booster dose.5 When analyzing the colonization, the effect was greater with three doses rather than the effect of two doses, 6 months after the last application. Fritzell et al. observed similar results. They found no significant differences in immunogenicity between the schemes of two or three doses plus a booster dose except that protective levels are lower for serotypes 6B and 23F.6

In other studies that evaluated the efficacy of different doses in children <1 year of age, there was an increase in immunogenicity (56%) (95% CI: 7–82) in receiving a single dose to 93% (95% CI: 70–98) to two doses when, in addition, a booster dose was administered during the second year of life.7

Other authors have evaluated the administration of one, two or three doses of heptavalent conjugate vaccine within the first 4 months of age and one dose of polysaccharide vaccine at 10 months of age. These authors have found that protective titers are increased according to the number of

78 Bol Med Hosp Infant Mex

Fortino Solórzano Santos

doses: 44% (one dose) vs. 77% (two doses) vs. 94% (three doses, p <0.001). After the dose of polysaccharide vaccine, the difference in antibody titers decreased significantly and was similar to the percentage of nasopharyngeal carriers after the last dose.8

Most research has focused on finding less-expensive schemes but with the same protective assurance for children because not all countries can support national campaigns for the cost of the proposed vaccination sche-mes. According to the continuously emerging international information, vaccination against Streptococcus pneumo-niae of two initial doses with a booster afterward as is currently applied in Mexico is a good practice that has achieved a higher coverage for the childhood population.

REFERENCES

1. CDC. Invasive pneumococcal disease in children 5 years after conjugate vaccine introduction—eight states, 1998–2005. MMWR 2008;57:144-148. Available at: http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5706a2.htm

2. Kyaw MH, Lynfield R, Schaffner W, Craig AS, Hadler J, Rein-gold A, et al. Effect of introduction of the pneumococcal con-

jugate vaccine on drug-resistant Streptococcus pneumoniae. N Engl J Med 2006;354:1455–1463.

3. Temime L, Boelle PY, Opatoswki L, Guillemot D. Impact of cap-sular switch on invasive pneumococcal disease incidence in a vaccinated population. PLoS One 2008;3:e3244. doi:10.1371/journal.pone.0003244.

4. Silva-Rosales NA, Tene CE, Cervantes-Kardash, Del Toro M. Comparación de la respuesta inmunológica frente a cepas de S. pneumoniae, evaluada por hemaglutinación, en niños inmunizados con vacuna neumocócica heptavalente (dos primovacunaciones con o sin refuerzo ). Bol Med Hosp Infant Mex 2012;69:97-103

5. Scott P, Rutjes AW, Bermetz L, Robert N, Scott S, Lourenço T, et al. Comparing pneumococcal conjugate vaccine schedules based on 3 and 2 primary doses: systematic review and meta-analysis. Vaccine 2011;29:9711–9721.

6. Fritzell B, Fletcher MA. Pneumococcal polysaccharide-protein (CRM197) conjugate vaccines, 7- or 9-valent, in the 2 + 1 schedule. Expert Rev Vaccines 2011;10:263–290.

7. Andrews N, Waight PA, Borrow R, Ladhani S, George RC, Slack MP, et al. Using the indirect cohort design to estimate the effectiveness of the seven valent pneumococcal conjugate vaccines in England and Wales. PLos One 2011;6:e28435. doi:10.1371/journal.pone.0028435.

8. Ota MO, Akinsola A, Townend J, Antonio M, Enwere G, Nsek-pong D, et al. The immunogenicity and impact on nasopha-ryngeal carriage of fewer doses of conjugate pneumococcal vaccine immunization schedule. Vaccine 2011;29:2999–3007.


maternal diet and vitamin D during pregnancy and association with bone health during childhood. Review of the literature

review article


Ana Cecilia Garza-Gisholt,1 Rodolfo Rivas-Ruiz,1,2 and Patricia Clark1,2

AbSTRACT

Deficiencies in maternal diet and low maternal plasma of vitamin D in pregnancy may influence the growth and bone mineral accrual of the offspring during fetal life and childhood. This review summarizes the evidence available from cohort studies that include information of maternal diet and concentrations of vitamin D during pregnancy associated with bone mass of the offspring. A literature search was conducted through MEDLINE and included studies from 2000 to 2009. The main associations found in the studies were related to maternal calcium intake and vitamin D concentrations. Several studies repor-ted a high prevalence of maternal vitamin D deficiency (varying from 15% to 66%) associated with increased risk of neonatal vitamin D deficiency [odds ratio (OR) 17.2, 95% CI 8.8-34.3)]. A strong positive association between maternal and cord blood serum vitamin D was found in two different studies (r = 0.70 and r = 0.755 p <0.001). Mothers who were deficient in vitamin D had offspring with lower whole body bone mineral content (BMC) (mean 1.04 kg ± 0·16 vs. 1.16 kg ± 0.17, p = 0.002). Adequate concentrations of maternal vitamin D are essential for calcium homeostasis and bone health of the newborn. High prevalence of maternal vitamin D insufficiency found in different populations can lead to problems of low BMC or, in severe cases, fetal rickets. Key words: pregnancy diet, vitamin D, bone mass.

1 Facultad de Medicina, Universidad Nacional Autónoma de México, México, D.F., México

2 Unidad de Epidemiología Clínica, Hospital Infantil de México Federico Gómez, México D.F., México

Corresponding author: Patricia Clark, MD, PhDUnidad de Epidemiología Clínica Hospital Infantil de México Federico GómezMéxico, D.F., México


INTRODuCTION

During the last decade there has been growing evidence in epidemiological studies indicating that osteoporosis (OP) and the risk of fractures may begin during intrauterine life due to adverse influences of several factors in early development.1 Initial studies have shown a relationship between measures of birth weight, infant weight and quantity of bone mass in adulthood. Furthermore, there is evidence that factors such as maternal lifestyle and vitamin D concentrations during pregnancy have a significant im-pact on newborn bone mineral content (BMC) and further development of fetal bone.2 It is possible that interventions

targeting the mother’s lifestyle during pregnancy may have an impact on the development of stronger bones that, if reinforced during childhood and adolescence, will allow the development of a higher reservoir of mineral content. This may ultimately delay the threshold of fracture.3

Skeletal growth is an anabolic process that depends on several factors, some of which are modifiable and others are not. The main non-modifiable factors include genetics, race, gender and hormonal factors. Modifiable factors include those relating to lifestyle of the mother and maternal nutrition during pregnancy. Therefore, newborn bone mass depends on the combination of these factors whose presence is variable in each person.4

During pregnancy, the fetus is totally dependent on the mother for acquisition of micronutrients required for bone mineralization. The primary bone-forming minerals are calcium, phosphorus and magnesium (at birth the infant’s skeleton contains 98%, 80% and 60%, respectively, of these minerals). Quantitatively, the greatest period of fetal mineral accretion takes place from mid-gestation and is maximal during the third trimester.5

Fetal bone mineralization is determined by placental mineral transfer, fetal bone mineral accretion and fetal bone resorption. Because effects on fetal bone are often


Ana Cecilia Garza-Gisholt, Rodolfo Rivas-Ruiz and Patricia Clark

brought through the mother, any disturbance in maternal mineral metabolism (maternal nutritional depletion or di-seases) or conditions that affect placental mineral transfer can affect fetal bone mineralization. Therefore, maternal nutritional status and dietary intake of calcium and other minerals during pregnancy could have a significant effect on fetal growth and development.6

On the other hand, maternal vitamin D deficiency during pregnancy is a recognized risk factor for rickets and osteomalacia in infancy. There is evidence that low maternal plasma of 25-OHD in pregnancy may influence the growth and bone mineral accrual of the offspring du-ring fetal life, infancy and childhood.7

The objective of this review is to summarize the eviden-ce available from cohort studies that include information of maternal diet and concentrations of vitamin D during pregnancy associated with bone health of the child.

A literature search was conducted through MEDLI-NE using the following keywords (lifestyle, maternal factors OR maternal vitamin D OR maternal diet during pregnancy) AND (newborn bone mass OR bone in infants). The search period included the years 2000 to 2009. Selection criteria for the studies included (1) published in English; (2) abstract available on-line; (3) referred to original work (instead of literature reviews); (4) studied humans; (5) included only factors during pregnancy and bone health of their offspring in analysis; and (6) cohort-type studies.

For this review, 15 studies were analyzed who met our inclusion criteria and were obtained in full text. Of these studies, nine referred to maternal concentrations of vitamin D and six to maternal diet. The majority of studies (13/15) were published after 2005 and only two were published between 2000 and 2005. Most of the studies originated from the UK and Australia (10/15). The rest of the studies were developed in Iran, Turkey, India, The Netherlands and the U.S. Sample size varied from 87 to 901.

Bone growth as the primary outcome was measured in nine of the studies with dual-energy x-ray absorptio-metry (DXA) to estimate bone mineral mass. Six were retrospective studies measuring bone mass of children ages 6 and 9 years old.8-13 The rest of the studies used different methods like fetal femur length and knee-heel length to estimate bone growth of the offspring.

In most of the studies the mothers were >16 years old and were followed from 17 weeks of gestation until de-

livery. Exclusion criteria were fetal anomalies, multiple pregnancy, maternal disease and intake of medications influencing bone metabolism, etc. All babies were born at term (≥37 gestation weeks).

Maternal Diet Results Table 1 summarizes the six studies that assessed maternal diet associated with bone mass of the offspring. Maternal diet was assessed in all of the six articles by food frequency questionnaires. The main results were the positive asso-ciations founded between calcium and dairy intake during pregnancy with higher body bone mineral density (BMD) and bone mineral content (BMC) of the child.

Children of mothers who had a higher intake of dairy products (milk and derivatives) and a high “prudent diet” characterized by increased intake of fruit, vegetables, whole wheat bread, and rice, and low intake of processed foods during pregnancy had higher bone mass (BMC r = 0.23 p = 0.001 and BM r = 0.15 p = 0.02); the association remains positive and significant even after adjustment for some confounding factors.9 Cole et al. concluded that the percentage of total variance in whole body BMD and BMC explained by maternal “prudent diet” in late pregnancy ranges from 2% to 6%. Another study concluded that a child in the “optimal” levels of dietary exposure (highest tertile of magnesium, potassium, protein and phosphorus intake) had significantly higher adjusted BMD at all sites (femoral neck 5.5%, lumbar spine 12% and total body 6.8%) compared to the remainder of the children.10

Calcium intake is one of the most common dietary fac-tors studied. Two different studies determined that greater maternal consumption of calcium and calcium-rich foods, especially milk and derivates (>3 servings/day) during pregnancy was associated with higher total body BMC in the children at 6 years old (β 0.11, p <0.001)8 and had a significant positive effect on fetal femur growth (β 0.077 ± 0.024, p = 0.001).14 These associations were statistically significant after adjustment for some confounders such as newborn size, age, gender, infant feeding, maternal energy and protein intake and parity. One more study concluded positive associations between early pregnancy calcium intake and spine BMC and BMD of the offspring (0.28 log mg/day; p < 0.02).15

Another relevant aspect of the maternal diet is the insufficient intake of some nutrients necessary for bone health, and a low intake of these in women during


Maternal diet and vitamin D during pregnancy and association with bone health during childhood. Review of the literature

pregnancy may have a negative effect on fetal skeletal mineralization. Two different studies found that total body BMD of the children were positively associated with

maternal intake of magnesium (β = 4.9, 2.5–7.3; g/cm2 x 103 p <0.001 and r2 = 0.27 p = 0.006),10,11 and maternal intake of potassium (β = 10.5, 4.9–16.0; g/cm2 x 103

Table 1. Maternal diet associated with bone mass of offspring

Author, country (year) Study design n Outcome in children Results

Ganpule A et al.8

Pune, India (2006)

Retrospective cohort 698 Total body and total spine BMC and BMD were mea-sured using DXA in the children at 6 years old

Both parents DXA measurements were positively correlated with the equivalent measurement in the children. (mother r = 0.36 and father r = 0.38, p <0.001)Children of mothers who had a higher frequency of calcium-rich food intake during pregnancy had higher total BMC (β 0.11, p <0.001)

Cole Z et al.9

Southampton, UK(2009)

Retrospective cohort 198 Measurements of bone mass using DXA at 9 years of age

A high “prudent diet” in late pregnancy, characterized by elevated intake of fruit, vegetables, whole wheat bread and rice, and low intake of processed foods, was associated with greater whole body and lumbar spine BMC (r= 0.23 p =0.001) and BMD (r = 0.15 p = 0.02) in the offspring after adjustment for confoun-ding factors

Godfrey K et al.15

Southampton, UK (2001)

Prospective cohort 145 Neonatal BMC and BMD using DXA in infants born at term

Positive associations between early pregnancy cal-cium intake and spine BMC and BMD (0.28 log mg/day p <0.02)Maternal intakes of protein, carbohydrate, fat, and green vegetables explained no variance in whole body BMC or BMD

Jones G et al.10

Tasmania, Australia(2000)

Retrospective cohort 173 BMC and BMD were mea-sured using DXA at the lumbar spine and femoral neck at 8 yr of age

After adjustment for confounders, total body BMD was positively associated with magnesium (r2 = 0.27 p = 0.006), phosphorus (r2 = 0.25 p = 0.054), potas-sium r2 = 0.25 p = 0.021) and protein (r2 = 0.25 p = 0.046) intakeA child at the “optimal” level of dietary exposures had significantly higher adjusted BMD at all sites (femoral neck 5.5%, lumbar spine 12% and total body 6.8%)

Chang S et al.14

Baltimore, MD, U.S.(2003)

Prospective cohort 350 Fetal femur length in utero Dairy intake had a significant positive effect on fetal femur growth after adjustment for gestational age, biparietal diameter, maternal age, height, and pre-pregnancy body mass index (β 0.077 ± 0.024, p <0.001)Fetal femur length was significantly lower in the lowest dairy-intake group (<2 servings/day) than in the highest dairy-intake group (>3 servings/day), and a dose-response relation was suggested in the intermediate dairy-intake group (2–3 servings/day; p = 0.089)

Tobias JH et al.11

Avon,South West England(2005)

Retrospective cohort 445 Total body BMC and BMD by DXA carried out at 9 years of age

Maternal magnesium intake was related to total body BMC (β = 4.9, 7.4–23.1; g) and BMD (β = 4.9, 2.5–7.3; g/cm2 p <0.001)Maternal potassium intake was related to spinal BMC (β = 1.8, 0.8–2.9; g) and BMD (β = 10.5, 4.9–16.0; g/cm2, p <0.001)A significant association was also observed between maternal folate intake and spinal BMC adjusted for bone area (β = 0.55, 0.16–0.94; g; p = 0.006)

BMD, bone mineral density; BMC, bone mineral content; DXA, dual-emission X-ray absorptiometry



p <0.001;11 and r2 = 0.25 p = 0.021).10 On the other hand, a positive association between phosphorus (r2 = 0.25 p = 0.054), protein (r2 = 0.25 p = 0.046) and folate (β = 0.55, 0.16–0.94 g; p = 0.006) maternal intake and BMD of the children were found after adjustment for confounders.10,11

Maternal Vitamin D ResultsTable 2 summarizes the nine studies of maternal vitamin D associated with bone mass of the offspring. In eight of these, maternal vitamin D samples were taken between 23 and 36 weeks of pregnancy, and only in one study the samples were taken at delivery. In most of the studies, the serum was assayed for 25-hydroxyvitamin D3, calcium, phosphorus and parathyroid hormone.

Adequate vitamin D concentrations during pregnancy are necessary to ensure appropriate maternal response to the calcium demands of the fetus and neonatal for bone development. As shown in Table 2, the prevalence of vi-tamin D deficiency in maternal samples varied from 15% to 66%. Otherwise, a significant correlation was observed between maternal and cord blood serum vitamin D (r = 0.70 and r = 0.755, p <0.001).16,17 One of the studies ob-served that maternal vitamin D deficiency increased the risk of neonatal vitamin D deficiency (OR 17.2, 95% CI 8.8-34.3).18

Morley et al. observed that babies of mothers in the low 25-(OH)D group (<28 nmol/liter) had a –2.7 mm smaller knee-heel length than babies of mothers with higher vi-

Table 2. Maternal vitamin D associated with bone mass of the offspring

Author, country (year) n Study design Measurements in the mother and the children

Results

Maghbooli Z et al.16 Tehran, Iran(2007)

552 Prospective cohort Maternal and cord blood samples were taken at delivery. Serum was as-sayed for 25-(OH)D3, calcium, phosphorus and parathyroid hormone

Prevalence of vitamin D deficiency in maternal sam-ples was 66.8%, and in the cord blood was 93.3% (<35 nmol/L)Positive correlation between maternal and cord blood serum concentrations of vitamin D (r = 0.706 p = 0.0001)Vitamin D concentrations in cord blood were lower in newborns of mothers with vitamin D deficiency (15.6 ± 7.2 vs. 20.2 ± 14.9 p = 0.009)Positive correlation between maternal alkaline phosphatase and birth weight (r = 0.14 p = 0.02)

Morley R et al.19

Melbourne, Australia(2006)

374 Prospective cohort Maternal vitamin D at 28-32 weeks gestation and knee-heel length at birth of the offspring

25-(OH)D concentration was less than 28 nmol/liter in 7.2% of the women at 28-32 weeksKnee-heel length was 4.3 mm lower (95% CI -7.3, -1.3) in infants of mothers with low 25-(OH)D After adjustment for gestation length, the difference was reduced to -2.7 (95% CI -5.4, -0.1)

Prentice A et al.7

Cambridge, UK(2009)

123 Prospective cohort Maternal blood sample was collected at 20 and 36 weeks gestation. Infant bir-th weight and bone mineral accretion by DXA

20% and 16% of the mothers had 25-OHD <80 nmol/L at 20 and 36 week of pregnancy, respectivelyNo significant relationship or trends in the data were observed between maternal 25-(OH)D concentration and birth weight, length, head circumference, BMC and BMD of the midshaft radius and whole body

Javaid K et al.12


198 Retrospective cohort Vitamin D status of the mother during late preg-nancy. Whole body and lumbar-spine BMC and BMD by DXA at 9 years old.

31% of mothers were regarded as vitamin D insufficient (11-20 µg/L), and 18% as deficient (<11 µg/L) in late pregnancyMothers with lower serum concentrations of 25-(OH)D had children with reduce whole-body BMC and BMD at 9 years (r = 0.21 and r = 0.12 p = 0.03)Deficient vitamin D mothers had offspring whose whole body BMC was significantly lower than those born to mothers who were vitamin D replete (mean 1.04 kg± 0.16 vs. 1.16 kg ± 0.17, p = 0.002)



Gale C et al.13


178 Retrospective cohort Serum measurement of 25-(OH)D during late preg-nancy and DXA of the child at 9 years old

50.4% of the women had 25-(OH)D >50 nmol/L, 28.3% had concentrations between 27.5-50 nmol/L and 21.2% had concentrations <27.5 nmol/LChildren whose mothers had higher 25-(OH)D (>75 nmol/L) concentrations had a significantly larger head circumference at age 9 years than those whose mothers had lower concentrations (<30 nmol/L), (mean 53.6 ± 1.43 vs. 52.6 ± 1.59, p = 0.012)

Dijkstra SH et al.21

Rotterdam, Netherlands(2007)

87 Prospective cohort Maternal vitamin D was collected at the end of the third trimester and umbili-cal cord blood at birth was taken to obtain vitamin D concentrations.

63.3% of the newborn infants of mothers with dark skin had vitamin D deficiency, compared with the control group that was 15.8%Vitamin D values in pregnant women and their new-born infants showed a positive correlation (r = 0.88 p <0.001)Newborn infants of mothers at risk of vitamin D de-ficiency showed higher mean alkaline phosphatase concentrations than controls, which suggests increa-sed bone turnover: 161 (124-213) vs. 177 (156-217) U/I p = 0.050)

Mahon P et al.20


424 Prospective cohort Maternal blood sample at 34 weeks was taken to measure 25-(OH)D. Fetal femur length and distal me-taphyseal cross-sectional area.

63.4% of the women were sufficient/borderline (>50 nmol/L), 30.7% were insufficient (25 to 50 nmol/L) and 5.9 % were deficient (<25 nmol/L) of vitamin DLower maternal 25-(OH)D concentration was not re-lated to fetal length but was positively associated with greater femoral metaphyseal cross-sectional area and higher femoral splaying index (r = -0.10 95% CI -0.20 to 0.00 and r = -0.11 95% CI -0.21 to -0.01), respectively

Akcakus M et al.17

Turkey(2006)

100 Prospective cohort Serum Ca, P, alkaline phosphatase and 25-(OH)D levels were measured of the mothers at birth in winter and their neonate.Whole body BMD and BMC by DXA at birth.

25-(OH)D levels of the neonates and the mothers were highly correlated (r = 0.755, p <0.05)93% of the neonates and 82% of their mothers had 25-(OH)D levels <10 µg/LWhole body BMC and whole body BMD were positi-vely correlated with birthweight (r = 0.910, p <0.05) and gestational age (r = 0.70 p <0.05) but not with serum 25-(OH)D

Bowyer L et al.18

Australia(2009)

901 Prospective cohort Serum 25-OHD, PTH, cal-cium, albumin, phosphate and alkaline phosphatase were measured in women at 23-32 weeks gestation and on the cord blood at delivery.

Vitamin D deficiency (<25nmol/L) was found in 15% of the women and in 11% of the neonatesMaternal vitamin D deficiency increased the risk of neonatal vitamin D deficiency (OR 17.2, 95% CI 8.8-34.3) and birth weight was lower among infants of deficient against sufficient mothers: (3245 g ± 545 vs. 3453 ± 555 p <0.001).

Table 2. Maternal vitamin D associated with bone mass of the offspring

Author, country (year) n Study design Measurements in the mother and the children

Results

tamin D concentrations. They speculated that moderately severe maternal vitamin D deficiency would result in reduced fetal circulation in 25-(OH)D and 1,25-(OH)2D concentrations and may lead to reduced osteoblastic activity, affecting long bone growth.19 Mahon et al. also observed that low maternal 25-(OH)D concentrations have a slight association with greater femur metaphyseal

cross-sectional area and femur splaying index at 19 and 34 weeks gestation, using high-resolution 3D ultrasound (r = –0.10 95% CI –0.20 to 0.00 and r = –0.11 95% CI –0.21 to –0.01 p<0.001, respectively).20

One study reported that mothers deficient in vitamin D during late pregnancy had offspring whose whole-body BMC was significantly lower than those born to mothers



who were vitamin D replete (mean 1.04 kg ± 0.16 vs. 1.16 kg ± 0.17, p = 0.002). This association between mothers with lower serum concentrations of 25-(OH)D and bone mineral accrual in their children persisted up to the age of 9 years old.12

Another important result was the association between vitamin D and other serum markers like parathyroid hormone, calcium, phosphorus and alkaline phosphatase. Dijkstra et al. found that newborn infants of mothers at risk of vitamin D deficiency showed higher mean alkaline phosphatase concentrations than controls, which suggested increase of bone turnover.21

DISCuSSION

Calcium and vitamin D are two of the most important nu-trients in the development of the skeletal system. Maternal diet and maternal concentrations of vitamin D are related to bone mineralization of the newborn and the child. Most of the studies were published after 2005, which point to a recent growing trend of investigations on the issue.

It is known that bone mass is determined by genetics 60-80% of the time;22 however, diet should be considered an important modifiable factor to promote bone accretion as well as many other benefits that a proper diet can pro-vide to a mother and her newborn. The studies reviewed showed that maternal diet in pregnancy had a small but consistent contribution toward bone mass in childhood.

Some studies determined that higher intakes of calcium and dairy products during pregnancy lead to improved bone accretion and growth. These studies, however, have found no hard data on the increase in BMD or BMC in infants whose mothers had calcium-rich dietary intake vs. calcium-deficient diets.9,14,15

The associations of bone outcome in children with es-timated maternal calcium intakes were weaker compared to those with milk and milk product intakes. This is the case of the study that concluded that mothers in the lowest dairy-intake group (<2 servings/day) had lower fetal fe-mur length than mothers in the highest dairy-intake group (>3 servings/day); however, the relationship between the growth of the fetal femur and its degree of mineralization is unknown.14

Some calcium-rich foods were also high in protein. Although the association with calcium-rich foods was independent of protein intake, protein quality may be an

important factor. Any causal association between calcium-rich foods and bone mass could reflect postnatal, rather than intrauterine, effects related to breast milk quality or postnatal diet.23 Other nutrients such as protein, phospho-rus, magnesium, potassium and some vitamins are also involved in growth and development of bone mass and must be present in adequate amounts. For this reason, several studies focused on the relationship between these nutrients and bone development.10,11 There is, however, insufficient evidence to date on the role of these various nutrients in bone development of the newborn. Future stu-dies are needed to address the mechanisms and long-term effects of nutrient intake during pregnancy on neonatal bone mass.

Evidence based on literature concerning the association between maternal vitamin D and newborn bone mass has increased in the last decade. Vitamin D concentrations are determined by serum concentrations of 25-(OH)D. In children and adolescents, vitamin D concentrations are considered: normal 25-(OH)D ≥20 ng/ml (50 mol/L), insufficient 25-(OH)D between 15 and 20 ng/ml (37.5 to 50 nmol/L) and deficient 25-(OH)D ≤15 ng/ml (37.5 nmol/L).24,25 Based on general information about vitamin D deficiency, it has been concluded that vitamin D insuffi-ciency is a global phenomenon, with an estimated 1 billon people worldwide having suboptimal levels of 25-(OH)D.26 There is evidence that maternal vitamin D deficiency during pregnancy may lead to impaired fetal growth and bone development. The majority of the reported studies were completed in populations at high risk of vitamin D deficiency.27

Positive associations have been reported between ma-ternal and cord blood serum vitamin D. Also, insufficient vitamin D in the mother is associated with smaller knee-heel length and less whole body BMC in the offspring. The association between mothers with lower serum con-centrations of 25-(OH)D and bone mineral accrual in their children persisted at 9 years of age.

The mechanisms by which maternal vitamin D status during pregnancy affects bone mass in the child remain unknown. It has been postulated that maternal vitamin D insufficiency during pregnancy leads to an impairment of placental calcium transport, perhaps mediated by pa-rathyroid hormone-related peptide (PTHrP) and thereby reduces the trajectory of intrauterine and subsequent childhood bone mineral accrual.12



It is generally accepted that maternal vitamin D status during pregnancy reflects the maternal and neonatal cal-cium homeostasis. Due to the strong relationship between concentrations of vitamin D with PTH, calcium, phospho-rus and albumin, it is important to measure these markers to determine if the association between maternal vitamin D with bone growth is independent of the biological markers.

Another source of variation in vitamin D concentrations is measure of sun exposure because skin exposure to UV-B is thought to be the major determinant in healthy vitamin D status. Also, it is important to report data on pigmentation and clothing habits and their possible association with vitamin D deficiency.28

Further studies are needed to provide more conclusi-ve evidence of the long-term consequences of fetal and neonatal vitamin D deficiency and bone development. The lack of evidence so far has led to contradictory recommendations in vitamin D supplementation during pregnancy in many countries. The test of these findings would be through a randomized controlled trial of vitamin D supplementation in early pregnancy.29

Our study found some limitations in the reviewed studies. Some of the studies measured the outcome in pediatric age rather than measuring bone mass in the newborn.8-13 This situation could weaken the associations and the conclusions because there are many environmental factors during life that are related to the status of bone. Despite adjustment for confounders, we cannot exclude the possibility of residual environmental confounding and causality cannot be assumed from these observational data.

Maternal intake was assessed only at entry into prenatal care, assuming that this level of intake remained somewhat consistent across gestation; this could increase the random error and diminish the strength of observed associations. On the other hand, many of the dietary nutrients are colli-near and single nutrients may potentiate or attenuate the effects of others, a reason why it is better to evaluate the complete diet rather than single nutrients.

The use of DXA to measure bone mass in pediatric age has been validated and widely used; however, DXA has technical limitations when used in children. This is because the reduced amounts of bone mineral lead to increased proportional precision error and variability between the proportion of fat and lean tissue could lead to accuracy errors in estimation of BMC by as much as 20%.30 Also in infants, variations in positioning may lead to error in

estimating bone area, making BMD data less robust.31

Other environmental factors in pregnancy that need to be considered are assessments of maternal lifestyle, body composition, and biochemical markers of the bone turno-ver in cord blood. All of these will help in obtaining more accurate estimates of the dietary bone mass associations. The assessment of maternal serum 25-hydroxyvitamin D and umbilical venous calcium concentrations would be helpful in evaluating intrapregnancy mechanisms for the association between maternal milk intake and childhood bone mass.32

Maternal diet and vitamin D concentrations are essential in growth and bone mineral accrual of the offspring during fetal life. Several studies have found a high prevalence of maternal vitamin D insufficiency during pregnancy associated with an increased risk of neonatal vitamin D deficiency and presence of lower bone mineral content in the offspring. Women with naturally dark skin, inadequate exposure to sunlight and living at higher latitudes have the highest risk for vitamin D deficiency.

Further information is urgently required to better cha-racterize the optimal intrauterine environment for future skeletal health. More studies are needed to provide con-clusive evidence of the long-term benefits of an adequate maternal diet as well as vitamin D concentrations on fetal bone development.

E-mail: [email protected]

REFERENCES

1. Cooper C. Epidemiology of osteoporotic fracture: looking to the future. Rheumatology (Oxford) 2005;44(suppl 4):iv36-iv40.

2. Javaid MK, Cooper C. Prenatal and childhood influences on osteoporosis. Best Pract Res Clin Endocrinol Metab 2002;16:349-367.

3. Cooper C, Fall C, Egger P, Hobbs R, Eastell R, Barker D. Growth in infancy and bone mass in later life. Ann Rheum Dis 1997;56:17-21.

4. Namgung R, Tsang R. Factors affecting newborn bone mineral content: in utero effects on newborn bone mineralization. Proc Nutr Soc 2000;59:55-63.

5. Prentice A. Micronutrients and the bone mineral content of the mother, fetus and newborn. J Nutr 2003;133(suppl 2):1693S-1699S.

6. Abrams S. In utero physiology: role in nutrient delivery and fetal development for calcium, phosphorus, and vitamin D. Am J Clin Nutr 2007;85(suppl):604S-607S.



7. Prentice A, Jarjou L, Golberg G, Bennett J, Cole TJ, Schoen-makers I. Maternal plasma 25-hydroxyvitamin D concentration and birthweight, growth and bone mineral accretion of Gam-bian infants. Acta Pædiatr 2009;98:1360-1362.

8. Ganpule A, Yajnik CS, Fall CH, Rao S, Fisher DJ, Kanade A, et al. Bone mass in Indian children—relationships to maternal nutritional status and diet during pregnancy: the Pune Maternal Nutrition Study. J Clin Endocrinol Metab 2006;91:2994-3001.

9. Cole ZA, Gale CR, Javaid MK, Robinson SM, Law C, Boucher BJ, et al. Maternal dietary patterns during pregnancy and childhood bone mass: a longitudinal study. J Bone Miner Res 2009;24:663-668.

10. Jones G, Riley MD, Dwyer T. Maternal diet during pregnancy is associated with bone mineral density in children: a longitudinal study. Eur J Clin Nutr 2000;54:749-756.

11. Tobias JH, Steer CD, Emmett PM, Tonkin RJ, Cooper C, Ness AR, ALSPAC study team. Bone mass in childhood is related to maternal diet in pregnancy. Osteoporos Int 2005;16:1731-1741.

12. Javaid MK, Crozier SR, Harvey NC, Gale CR, Dennison EM, Boucher B, et al. Maternal vitamin D status during pregnancy and childhood bone mass at age 9 years: a longitudinal study. Lancet 2006;367:36-43.

13. Gale CR, Robinson SM, Harvey NC, Javaid MK, Jiang B, Martyn CN, et al. Maternal vitamin D status during pregnancy and child outcomes. Eur J Clin Nutr 2008;62:68-77.

14. Chang SC, O’Brien KO, Sculman NM, Caufield LE, Mancini J, Witter FR. Fetal femur length is influenced by maternal dairy intake in pregnant African American adolescents. Am J Clin Nutr 2003;77:1248-1254.

15. Godfrey K, Walker-Bone K, Robinson S, Taylor P, Shore S, Wheeler T, et al. Neonatal bone mass: influence of parental birthweight, maternal smoking, body composition, and activity during pregnancy. J Bone Miner Res 2001;16:1694-1703.

16. Maghbooli Z, Hossein-Nezhad A, Shafaei AR, Karimi F, Madani FS, Larijani B. Vitamin D status in mothers and their newborns in Iran. BMC Pregnancy Childbirth 2007;7:1. doi:10.1186/1471-2393-7-1

17. Akcakus M, Koklu E, Budak N, Kula N, Kurtoglu S, Koklu S. The relationship between birthweight, 25-hydroxyvitamin D concentrations and bone mineral status in neonates. Ann Trop Paediatr 2006;26:267-275.

18. Bowyer L, Catling-Paull C, Diamond T, Homer C, Davis G, Craig ME. Vitamin D, PTH and calcium levels in pregnant women and their neonates. Clin Endocrinol 2009;70:372-377.

19. Morley R, Carlin JB, Pasco JA, Wark JD. Maternal 25-hydro-xyvitamin D and parathyroid hormone concentrations and offspring birth size. J Clin Endocrinol Metab 2006;91:906-912.

20. Mahon P, Harvey N, Crozier S, Inskip H, Robinson S, Arden N, et al. Low maternal vitamin D status and fetal bone deve-lopment: cohort study. J Bone Miner Res 2010;25:14-19.

21. Dijkstra SH, van Beek A, Janssen JW, de Vleeschouwer LH, Huysman WA, van der Akker EL. High prevalence of vitamin D deficiency in newborn infants of high-risk mothers. Arch Dis Child 2007;92:750-753.

22. Bonjour JP, Chevalley T, Ferrari S, Rizzoli R. The importance and relevance of peak bone mass in the prevalence of osteo-porosis. Salud Publica Mex 2009;51(suppl 1):S5-S17.

23. Prentice A, Schoenmakers I, Laskey MA, Bono S, Ginty F, Goldberg GR. Symposium on ‘Nutrition and health in children and adolescents.’ Session 1: Nutrition in growth and develop-ment. Nutrition and bone growth and development. Proc Nutr Soc 2006;65:348-360.

24. Misra M, Pacaud D, Petryk A, Collett-Solberg PF, Kappy M, Drug and Therapeutics Committee of the Lawson Wilkins Pediatric Endocrine Society. Vitamin D deficiency in children and its management: review of current knowledge and recom-mendations. Pediatrics 2008;122:398-417.

25. Huh SY, Gordon CM. Vitamin D deficiency in children and adolescents: epidemiology, impact and treatment. Rev Endocr Metab Disord 2008;9:161-170.

26. Saintonge S, Bang H, Gerber LM. Implications of a new defi-nition of vitamin D deficiency in a multiracial US adolescents population: The National Health and Nutrition Examination Survey III. Pediatrics 2009;123:797-803.

27. Specker BL. Does vitamin D during pregnancy impact offspring growth and bone? Proc Nutr Soc 2012;71:38-45.

28. Hewison M, Adams JS. Vitamin D insufficiency and skeletal development in utero. J Bone Miner Res 2010;25:11-13.

29. Specker BL. Do North American women need supplemental vitamin D during pregnancy or lactation? Am J Clin Nutr 1994;59(suppl):484S-491S.

30. Specker BL, Johannsen N, Binkley T, Finn K. Total body bone mineral content and tibial cortical bone measures in preschool children. J Bone Miner Res 2001;16:2298-2305.

31. Binkovitz LA, Henwood MJ. Pediatric DXA: technique and interpretation. Pediatr Radiol 2007;37:21-31.

32. Hollis BW, Wagner CL. Nutritional vitamin D status during pregnancy: reasons for concern. CMAJ 2006;174:1287-1290.


original research article


Servicio de Oftalmología, Hospital Infantil de México Federico Gómez, México, D.F., México

Correspondence: Dr. Marco A Ramírez-OrtizServicio de OftalmologíaHospital Infantil de México Federico Gómez México, D.F., MéxicoE-mail: [email protected]


INTRODuCTION

Performing a corneal transplant (CT) or penetrating keratoplasty (PKP) in children represents a challenge for the ophthalmologist because there are many factors that may hinder a favorable outcome. Among the factors involved in the failure of a PKP in this age group are the increased inflammatory response, rapid vascularization of the cornea, if there is associated glaucoma, congenital anomalies associated with the iris and pupil, difficulty in the surgical technique (low scleral rigidity), donor cornea

Visual outcome in pediatric patients with corneal transplantation: results of 10 years’ experienceMayeli Muñoz-Ocampo, Tania Yaneth Valderrama-Atayupanqui, Oswaldo Manuel Aguirre-Luna, Manuel Rodríguez-Almaraz, and Marco A Ramírez-Ortiz

AbSTRACT

background. Pediatric corneal transplant represents an ophthalmological challenge due to a high rate of graft failure. In comparison with adolescents and adults, children have a prognosis of less vision. The aim of this study was to evaluate visual results after pediatric penetrating keratoplasty (PPK) and to identify factors associated with graft rejection.methods. We carried out a prospective and descriptive study. Visual outcome was analyzed according to age at the time of surgery, visual acuity, corneal disease before PPK, development of graft rejection, glaucoma, previous dry eye and psychomotor developmental delay (PDD).Results. There were 47 PPK procedures performed in 39 patients (eight bilateral) between March 2001 and March 2011. Keratoconus was the most common corneal disease with the best visual outcome after PPK. Twenty nine patients (62%) had visual improvement, 23.4% remained visually unchanged and 14.8% decreased their initial visual acuity. Twenty two eyes (46.8%) presented graft rejection and of these, 13 had complete graft rejection resolution after treatment. Patients with previous history of PDD, congenital glaucoma and severe dry eye had unresolved graft rejection. Patients <6 years with anterior chamber cleavage syndrome and hereditary corneal dystrophies were associated with poorer final visual acuities.Conclusions. Patients may improve their visual acuities with PPK. Children <6 years with history of systemic and ocular congenital eye diseases may represent those patient with the worst prognosis.Key words: corneal transplantation, penetrating keratoplasty, graft rejection, visual acuity

with a diameter ≥8 mm, if there is mental retardation, the patient's residence (near or far from the hospital) and poor adherence to treatment.1 Because of this, these patients have a high graft failure rate and a poorer visual prognosis compared with adolescents and adults.

The main indication for PKP in patients <6 years of age is to prevent the development of amblyopia.2 From this, stems the importance of early visual stimulation,3 adequate follow-up after surgery, adequate visual rehabilitation and a good physician/patient relationship.

Because PKP is a rare pediatric procedure, there is scarce information in the international literature on visual prognosis. During 2010, 1591 corneas were transplanted in Mexico of which <1% were in patients <6 years of age.4 In 2001, in the Hospital Infantil de Mexico Federico Go-mez (HIMFG) the first successful PKP was performed in a 9-year-old patient with a diagnosis of keratoconus. In 2004, our institution registered with the National Trans-plant Center (CENATRA), the first eye bank dedicated to the Mexican pediatric population. This paper describes the anatomic and functional results of PKP of 10 years’ expe-


Mayeli Muñoz-Ocampo, Tania Yanet Valderrama-Atayupanqui, Oswaldo Manuel Aguirre-Luna, Manuel Rodríguez-Almaraz, and Marco A Ramírez-Ortiz

rience and analyzed the prognostic factors associated with appropriate changes in CT in patients <18 years of age.

mATERIALS AND mETHODS

We included all patients who underwent PKP during the period from March 2001–March 2011 in the HIMFG and who were <16 years of age at the time of transplantation. All patients underwent a complete ophthalmologic exa-mination that consisted of measuring visual acuity (VA), slit lamp examination, indirect ophthalmoscopy and, in selected cases, a B-mode ultrasound to evaluate structures of the posterior pole.

Visual acuity measurement was done preoperatively and during all ophthalmological examinations. This measurement was assessed with the Snellen method in preschoolers >6 years of age with the HOTV method and in infants and patients with mental retardation with Teller cards. For statistical analysis, values were converted to LogMAR scale according to the following: not assessable = 6, no light perception = 5, light perception = 4, counting fingers = 3, 20/400 = 2, 20 / 200 = 1, 20/160 = 0.9, 20/125 = 0.8, 20/100 = 0.7, 20/80 = 0.6, 20/63 = 0.5, 20/50 = 0.4, 20/40 = 0.3, 20/32 = 0.2, 20/25 = 0.1, 20/20 = 0. Visual improvement was defined as the gain of two or more lines of vision; unchanged VA as that which did not change, as that declined or improved only one line of vision, and worsening of VA as that which decreased in two or more lines of vision.

We also evaluated the patient’s place of origin. Mexico City and the State of Mexico were considered as cities near the hospital and all other surrounding states as not. In terms of immediate postoperative complications iden-tified, there was leakage of aqueous humor through the surgical wound, dehiscence of sutures and corneal abs-cess. Regarding history prior to the transplant, patients with severe dry eye, glaucoma, and congenital or delayed psychomotor development were identified.

CT is indicated for cases of degenerative diseases such as keratoconus and for congenital corneal defects such as congenital hereditary endothelial dystrophy, congenital malformations of the anterior segment, scars caused by ocular trauma or ocular infections such as herpetic kera-titis. All patients had VA ≤20/63 prior to transplantation.

PKP was performed in all patients under general anesthesia after IV administration of 20% mannitol. Con-

junctival scleral Flieringa rings were placed and fixed. Hessburg-Barron suction drills were used to remove the diseased cornea. The diameters of the recipient bed and donor cornea ranged between 7.5 and 8.5 mm, respecti-vely. Before removal of the diseased cornea, viscoelastic solution (Healon, Alcon Laboratories, Forth Worth, TX) was placed in the anterior chamber and remained during suturing of the graft. It was subsequently exchanged for balanced salt solution. Finally, the donor cornea was sutured with simple interrupted 10-0 nylon suture. After surgery, moxifloxacin drops were applied topically, topical prednisolone acetate was prescribed every 2 h for 1 month with dose reduction and topical antibiotics every 3 h for 2 weeks. Also, timolol maleate 0.5%, one drop every 12 h for 1 month, was prescribed in patients with increased intraocular pressure postoperatively.

Patients with a history of herpetic keratitis or acute corneal rejection were treated with topical immunosup-pressants every 6 h (ophthalmic cyclosporine 0.05%). All procedures were performed by three experienced surgeons. Corneal tissue was transplanted at least <7 days after its collection. In all patients, the sutures be-gan to be removed from the sixth month after surgery. Corneas were obtained by altruistic donation of public hospitals in Mexico. Half of these were obtained from donations at our hospital (Figure 1). In all cases, age of

HIMFG: Hospital Infantil de México Federico Gómez; HGM: Hospital General de México; INP: Instituto Nacional de Pediatría; INNyN: Instituto Nacional de Neurología y Neurocirugía

Figure 1. Distribution of the hospital centers where corneal tissues were obtained for transplant.


Visual outcome in pediatric patients with corneal transplantation: results of 10 years’ experience

the donors ranged between 3 and 50 years of age. After collection, corneas were preserved in Optisol-GS solution (Bausch and Lomb) and stored in the Eye Bank of our hospital at 4°C. All corneas were evaluated with a viral panel to rule out transmissible infections of the donor tissue as well as investigating the history of the donor. Before PKP is carried out, endothelial cell count was done using the specular microscope (Eye Bank Kerato Analyser and Software, Konan Medical Inc, Hyogo Japan) to verify the viability of the tissue that is >2500 endothelial cells present per mm2.

Corneal rejection was defined as corneal opacity in the transplanted tissue secondary to an immune response. It was characterized by the presence of any of the following signs: endothelial deposits, corneal edema, subepithelial infiltrates, Khodadoust line and cellularity in the anterior chamber. Corneal rejection was considered to be that which is reversible with drug treatment. This consisted of prescribing topical steroids every hour and transseptal steroids each week, depending on patient response. In some patients, IV administration of methylprednisolone was necessary.

Data analysis was performed using descriptive sta-tistics with the statistical package Stata 7.0 (Stata Corp, College Statation TX) and graphs with Excel (Microsoft, Redmond, WA).

The study was carried out with ethical standards in accordance with the Declaration of Helsinki. Patient iden-tification was coded in order to maintain confidentiality.

RESuLTS

There were 49 penetrating keratoplasties performed in 39 patients (eight bilateral). Two patients were excluded because their follow-up was <6 months. Gender ratio was 2.5:1 (male:female). Average age at time of surgery was 10.61 years (range: 10 months–17 years, standard deviation [SD] 4.85). Average follow-up was 147 weeks (range: 26–491 weeks, SD 96 weeks). The most common cause of PKP was keratoconus in 63.83% (30 eyes), corneal dystrophy followed by 12.77% (6 eyes) herpetic keratitis in 10.64% (5 eyes), anterior segment dysgenesis in 4.26% (2 eyes) and trauma in 4.26% (2 eyes). The least common cause was corneal ulcer in 2.13% (one eye) and other causes occurred in 2.13% (one eye) (Figure 2). Visual improvement was observed in a total of 61.7% patients.

There were no changes in VA in 23.4% and only 14.8% had decreased VA (Table 1). Regarding place of residence, 71.87% of patients living in the metropolitan area recorded visual improvement (25 eyes), 25% had no change in VA (9 eyes) and only 3.1% (one eye) had decreased VA. Mo-reover, 50% of patients residing outside the metropolitan area had improvement (6 eyes), 25% remained unchanged and 25% had decreased VA.

Of a total of 47 PKP procedures, 22 patients develo-ped rejection (46.80%): 27.2% occurred in patients <6 years of age, 13.63% in children aged 6–8 years, 13.63% in children aged 8–10 years, 13.63% in children 10–12 years and in 31.81% in those >12 years of age (Table 2). Regarding diagnosis, 54.5% of the patients with rejection had keratoconus, corneal dystrophy 18%, herpetic kera-

Figure 2. Corneal diseases in 47 patients who underwent corneal transplant.

Table 1. Results of visual acuity after corneal transplant in 47 pe-diatric patients who had penetrating keratoplasty

Final visual acuityDiagnosis Better Same Worse Total

Keratoconus 22 5 3 30Corneal trauma 2 0 0 2Corneal dystrophy 1 4 1 6Corneal herpes 3 1 1 5Dysgenesis 0 0 2 2Corneal ulcer 0 1 0 1Others 1 0 0 1Total 29 11 7 47


Mayeli Muñoz-Ocampo, Tania Yanet Valderrama-Atayupanqui, Oswaldo Manuel Aguirre-Luna, Manuel Rodríguez-Almaraz, and Marco A Ramírez-Ortiz

titis 9%; mesodermal dysgenesis 9%, trauma and ulcers 4.5% each. Corneal rejection was successfully resolved with medical treatment in 60% of patients. Three patients with psychomotor developmental delay showed rejection: one patient with congenital glaucoma and two eyes with diagnosis of dry eye. One of the patients appropriately re-solved the rejection and the others did not show a favorable response. All patients with transplant rejection showed complete or partial opacification of the corneal graft. Du-ring surveillance, no patient developed ocular perforation or endophthalmitis associated with the procedure.

DISCuSSION

One of the most important objectives of corneal trans-plantation in children is improvement in VA. Therefore, it is of great importance to recognize the factors that may influence visual prognosis and early management of amblyopia. Ganekal et al. reported that the most common cause of moderate or poor visual results of PKP in children is amblyopia, which occurs in 80% of cases.5 Amblyo-pia develops in patients who have transparency of the affected cornea prior to 7 years of age. This is the reason why transplants performed in infants and toddlers have a poor visual prognosis because many patients are referred when there is already an established deep amblyopia. In addition, these patients have an increased risk of rejection as observed in our study.

Limaiem et al. in their study reported that about half of transplanted corneas lost their transparency after a year of follow-up.6 The importance of communication with the patient’s family and compliance with treatment as well as careful selection and optical correction are essential to maintain graft transparency.7

In our study, keratoconus proved to be the most com-mon surgical indication for PKP in pediatric patients.

Patel et al. reported a frequency of 67%,8 similar to what we reported. These were the patients with better visual prognosis. In contrast, patients with mesodermal dys-genesis had the highest unresolved rejection rate in our study. Yang et al. found that in dysgenesis such as Peters’ anomaly, a large button >8 mm and vascularization in corneal stroma were predictive of rejection, independent of each other.9

Corneal dystrophies, in which the visual prognosis is very poor as reported by Dandona et al.,10 also have a high association of rejection because of structural charac-teristics of the eye and the diseases themselves. In these conditions, graft survival is limited. Of these two, the prognosis for dysgenesis is poorer than for dystrophies.

The influence of patient’s place of residence according to the visual results shows a better visual prognosis for patients residing in the metropolitan area, probably be-cause they have closer medical surveillance. There were 22 rejections of which nine (40%) could not be resolved. Unresolved rejection represents 19% of total procedures performed. This is consistent with that reported by authors of other similar series.8-11 Younger patients presented rejection with greater frequency and a lower rate of reso-lution. Factors associated with unresolved rejection are the presence of psychomotor developmental delay, history of congenital glaucoma, hereditary corneal dystrophy and mesodermal dysgenesis. Patients with these conditions showed a high percentage of rejection that could not be resolved with medical treatment.

Therefore, the presence of these diseases should be an important precedent in the decision of whether or not to perform a corneal transplant in pediatric patients. The results of this study provide guidance as to which types of patients should be reconsidered for PKP because there is a high risk of complications and tissue rejection. The-refore, a careful selection and evaluation of the patient to be submitted to PKP should be done, as reported by Javadi et al.12 With regard to where donor corneas were obtained, we can see that the number of donations as well as the number of hospitals where the donor programs exist is still limited because 53% of the corneas were obtained in our own institution.

Our study has limitations because it did not consider aspects such as measurement of intraocular pressure and its evaluation during different stages of pre- and postoperative evolution as causes associated with transplant failure.

Table 2. Corneal rejection in different age groups

Age (years) Corneal rejection resolved

Corneal rejection unresolved

Total

<6 2 4 66–8 0 3 38–10 2 1 310–12 3 0 3>12 6 1 7Total 13 9 22


Visual outcome in pediatric patients with corneal transplantation: results of 10 years’ experience

There are other factors not taken into consideration for this study, and its importance has been proven in graft rejection, such as treatment adherence, diameter of the implant, size of donor button and the time when sutures were removed.

We may conclude that pediatric patients with certain diseases of the cornea can receive visual benefits from PKP. However, congenital conditions and related eye di-seases such as glaucoma and psychomotor developmental delay in patients <6 years of age can negatively influence evolution of the transplant. A larger number of patients need to be analyzed in order to accurately identify the importance of each of these variables.

REFERENCES

1. Al-Ghamdi A, Al-Rajhi A, Wagoner MD. Primary pediatric keratoplasty: indications, graft survival, and visual outcome. J AAPOS 2007;11:41-47.

2. Reidy JJ. Penetrating keratoplasty in infancy and early child-hood. Curr Opinion Ophthalmol 2001;12:258-261.

3. McClellan K, Lai T, Grigg J, Billson F. Penetrating kerato-plasty in children: visual and graft outcome. Br J Ophthalmol 2003;87:1212-1214.

4. Centro Nacional de Trasplantes. Estadísticas. Available at: www.cenatra.salud.gob.mx.

5. Ganekal S, Gangangouda C, Dorairaj S, Jhanji V. Early outco-mes of primary pediatric keratoplasty in patients with acquired, atraumatic corneal pathology. J AAPOS 2011;15:353-355.

6. Limaiem R, Chebil A, Baba A, Ben Youssef N, Mghaieth F, El Matri L. Pediatric penetrating keratoplasty: indications and outcomes. Transplant Proc 2011;43:649-651.

7. Comer RM, Daya SM, O'Keefe M. Penetrating keratoplasty in infants. J AAPOS 2001;5:285-290.

8. Patel HY, Ormonde S, Brookes NH, Moffatt LS, McGhee CN. The indications and outcome of paediatric corneal transplantation in New Zealand: 1991-2003. Br J Ophthalmol 2005;89:404-408.

9. Yang LL, Lambert SR, Drews-Botsch C, Stulting RD. Long-term visual outcome of penetrating keratoplasty in infants and children with Peters anomaly. J AAPOS 2009;13:175-180.

10. Dandona L, Naduvilath TJ, Janarthanan M, Ragu K, Rao GN. Survival analysis and visual outcome in a large series of cor-neal transplants in India. Br J Ophthalmol 1997;81:726-731.

11. García-Félix F, Calderón-Burruel DI, Tlacuilo-Para JA. Tras-plante corneal pediátrico. Rev Mex Oftalmol 2008;82:24-27.

12. Javadi MA, Baradaran-Rafii AR, Zamani M, Karimian F, Zare M, Einollahi B, et al. Penetrating keratoplasty in young chil-dren with congenital hereditary endothelial dystrophy. Cornea 2003;22:420-423.


Comparison of the immune response against strains of S. pneumoniae, assessed by hemagglutinaton, in children immu-nized with heptavalent conjugated pneumococcal vaccine (two primary vaccinations with or without reinforcement)

resarch article


Norma Angélica Silva-Rosales,1 Carlos Enrique Tene,2 Víctor Hugo Cervantes-Kardasch,2 and Mario Del-Toro2

AbSTRACT

background. Different patterns of heptavalent conjugated pneumococcal vaccine immunization have proven effective. Although vaccine patterns of two or three primary vaccinations with their respective additional reinforcement are recommended, there are still children with schemes only two doses of primary vaccination without reinforcement. The aim of this study was to compare the immune response against S. pneumoniae in children submitted to different immunization schemes with heptavalent conjugated pneumococcal vaccine (two primary vaccinations without or with booster). methods. We conducted an observational, cross-sectional study comparing the immune response between group A and group B, analyzing the weak immune response with positive hemagglutination dilution ≤1:2. Odds ratio (OR) and Fisher’s exact test were used.Results. There were no clinical differences between group A (n = 14) and group B (n = 15). There was a higher proportion of weak immune response in group A (57% vs. 13%, OR 8.7 (95% CI 1.3–53.8, p = 0.017).Conclusions. Weak immune response against S. pneumoniae is higher in schemes with two primary vaccinations with pneumococcal vaccine and no boost than when using two dose primary series with booster.Key words: S. pneumoniae, heptavalent conjugated pneumococcal vaccine, vaccination, hemagglutination, immune response, immunization.

1 Unidad de Medicina Preventiva, Clínica Hospital Dr. Miguel Trejo Ochoa, Instituto de Seguridad y Servicios Sociales de los Trabajadores del Estado (ISSTE), Colima, Mexico

2 Facultad de Medicina, Universidad de Colima, Colima, Mexico

Correspondence: Dr. Carlos Enrique Tene PérezFacultad de Medicina Universidad de Colima Colima, MexicoE-mail: [email protected]


INTRODuCTION

Streptococcus pneumoniae infections have a high inciden-ce in children. Studies to demonstrate the effectiveness of heptavalent pneumococcal vaccine schemes are based on two or three doses of a primary vaccination with the respective reinforcement.1 Thus, the efficacy and immunogenicity of a primary scheme of three doses of heptavalent pneumococcal vaccine plus boosters at 15 and 24 months of age are >93.9% for vaccine serotypes against pneumococcal disease in children.2 Studies have shown

protection against pneumococcal serotypes included in heptavalent vaccine using a two-dose primary vaccination plus a booster at 13 months of age.3 This scheme has been adopted in some countries with financial constraints inten-ded to ensure the protection of children but with limited resources to absorb the cost of a four-dose vaccination schedule. Although in Mexico schemes of three and four doses have been used in our environment, most children receive two doses as a primary scheme, even without the application of a third booster dose. The purpose of this study was to compare the immune response (IR) against strains of S. pneumoniae in 2-year-old children using two-dose primary vaccination with or without a booster of heptavalent vaccine.


Using an analytical cross-sectional design,4 2-year-old children were included in the study who were immunized with two (at the second and fourth month of life) or three (at the second, fourth and 12th month of life) doses of heptavalent pneumococcal vaccine. Not included in the study were children who attend day care or those who were


Comparison of the immune response against strains of S. pneumoniae, assessed by hemagglutinaton, in children immunized with heptavalent conjugated pneumococcal vaccine (two primary vaccinations with or without reinforcement)

diagnosed with an acute illness at the time of interview. To locate children with complete vaccination schedules and who had been immunized at the appropriate time, nominal censuses were used and the Universal Immuni-zation Program (ProVac) of a clinic/secondary hospital care in urban areas of the municipality of Villa de Alvarez, Colima. According to these data, we conducted a home visit to confirm information. We reviewed the National Health Card to verify the correlation of the application dates recorded in the referenced sources. Parents provided informed consent for their childrens’ participation in the study. Each participant had a detailed history taken, which included medical and pathological history, gestational age and birth weight. Also recorded were the length of time the child was breastfed, attendance at day care and data in regard to home conditions such as overcrowding. Similarly, we recorded the level of parental education, occupation and history of smoking. Additionally, anthro-pometric measurements were taken that included weight, height, and head and abdominal circumference. Two mL of blood was obtained by venipuncture and centrifuged at 3000 rpm for 5 min. Serum samples were collected from May to August 2010 and were centrifuged and frozen at -20°C until the time of measurement. The study variable was the immune response shown by both groups (two primary vaccinations with or without booster).

Vaccination schedules The first group was administered two doses of primary vaccination at 2 and 4 months of age (group A). The se-cond group was administered two doses of vaccine at 2 and 4 months of age and a booster dose at 12 months of age (group B).

Immune response Weak immune response (WIR) was determined when there was a positive hemagglutination dilution ≤1:2 and adequate immune response if hemagglutination was po-sitive at a dilution ≥1:4. This response was measured by the hemagglutination technique.

Hemagglutination technique Different serum dilutions of each participant were in contact with pneumococcal red cell reagent antigens. This allowed detection of the degree of dilution that showed an antigen–anti-body reaction (antibodies against participating antigen reagent).

Preparation of the reagentA 5-mL sample of venous blood from a healthy subject with blood type O positive was placed in an EDTA tube for subsequent centrifugation. Next, 2 mL was separated from erythrocytes obtained and washed with 2 mL of isotonic saline (NaCl 0.9%) solution. The solution was centrifuged at 3000 rpm for 5 min on three consecutive occasions. Later, there was a suspension of erythrocytes at 50% with 0.9% NaCl (0.5 mL of red cells in 0.5 mL of 0.9% NaCl). After washing, 0.1 mL of erythrocytes was mixed with 0.6 mL of 0.9% NaCl plus 0.25 mL of 0.9% NaCl. Of the preceding preparation, 0.1 mL was taken and mixed with 1.25 mL of 23-valent pneumococcal vaccine. The latter had been kept at a temperature of 4-8°C in a regulated refrigerator to safeguard and preserve the bio-logical products.5 The preparation was allowed to stand and was then mixed and centrifuged, discarding any excess, and was then resuspended with 0.5 mL of 0.9% NaCl. With the above, a reagent was obtained with sensitized erythrocytes with 23-valent pneumococcal vaccine, which was used the same day that blood samples were analyzed for the study subjects. These were used as negative control erythrocytes of healthy subjects. Absence of hemagglutination was confirmed by exposing control with the serum of study subjects.

Dilutions To observe the differences in the degree of antibody, diffe-rent dilutions were made. In nine vials of reagent red cells (2.5 µL), progressively higher dilutions were prepared of serum from each study subject (from 1:1 to 1:256). Each dilution was subjected to centrifugation at 3000 rpm for 5 min. From each dilution obtained, a drop was taken to deposit on the slide and observed under a microscope at a 40X magnification.

Evaluation of the immune responseIR was evaluated by checking which of the serum dilutions showed hemagglutination with the reagent of sensitized erythrocytes. WIR was considered present if the hema-gglutination was positive at analyzed serum dilutions ≤1:2. Adequate IR was considered if the hemagglutination was positive at dilutions ≥1:4 (Figure 1).

Sample size Sample size was calculated using the formula of inde-pendent sample means4 based on a study that quantified the pneumococcal antibody titers after three doses of the


Norma Angélica Silva-Rosales, Carlos Enrique Tene, Víctor Hugo Cervantes-Kardasch, and Mario Del-Toro

heptavalent vaccine.6 Alpha 0.05, beta 0.2 and mu 1 and 0 to 10.5 mu and 7, respectively, with a sigma 4.0 were considered.

Statistical analysis Descriptive statistics included median and interquartile range for the general description of the quantitative charac-teristics evaluated within each group of the immunization schedule, as is the case of having evaluated the bias and kurtosis values for each group. Ratios were calculated, and average and percentages depending on the nature of each of the variables studied. A comparison of the proportion of children with WIR between vaccination groups was performed using the Fisher exact test. χ2 was used for qualitative evaluation of the variables shown; p <0.05 was considered statistically significant with a confidence interval of 95%. Statistical analysis was performed using SPSS (v.17.0).

RESuLTS

There were 29 children included in the study (14 females and 15 males). Table 1 presents their clinical characteris-tics. Two doses of primary vaccination without booster were applied to 14 children (Group A) and two doses of primary vaccination with booster to 15 children (Group B). No patient was excluded from the study. Data were obtained for all children. The prevalence of WIR was 34% (n = 10) in the two groups. The proportion of chil-dren with WIR was lower in the group submitted to the two-dose of primary vaccination with booster compared with the group submitted to the two-dose of a primary vaccination without booster, i.e., 2/15 (13.3%) vs. 8/14

(57.1%), respectively (p = 0.017) (Figure 2). The history of having been immunized with a two-dose schedule of pneumococcal heptavalent vaccine without booster was a risk factor for WIR compared with a history of two-dose with booster (OR = 8.7, 95% CI 1.3-53.8, p = 0.017). There was no significant difference regarding gender dis-tribution (F/M ratio) between the different immunization schedules. No differences were found in groups A and B with respect to the following parameters: birth weight (p = 0.27), birth length (p = 0.62), current weight (p = 0.8), current height (p = 0.1) (Table 1), age (p = 0.66), duration of pregnancy (p = 0.11), number of persons who sleep in the same room (p = 0.2) and the duration of breastfeeding (p = 0.47) (Table 2). The proportion of first-born children was higher in the group of children treated with the three- dose immunization schedule (p = 0.48) (Table 1).

DISCuSSION

The results of this study support the conclusion that the IR is higher in children who had the pneumococcal vaccination series of two-dose of a primary vaccination with booster (at the second, fourth and 12th month of life) compared with those who were exposed to two doses without booster (at the second and fourth month of life). The variable of interest of this study was the different IR to two pneumococcal vacci-nation schedules. The elapsed time from the last dose of vaccine and antibody measurement allows evaluating the

A B

Figure 1. Evaluation of the immune response of antibodies to pneumococcal polysaccharide antigens. (A) Presence of hema-gglutination. (B) Absence of hemagglutination. In this case, it was considered that the subject had a weak immunological response by hemagglutination present only up to the first dilution (1:2).

Figure 2. Immune response against S. pneumoniae in children undergoing different schemes of immunization with heptavalent vaccine.

Schemes of two-dose of primary vaccination



usefulness of applying a booster.3 As is known, a higher secondary response can be induced by administering a booster dose because it generates a faster and more intense immune response than that which occurs in the primary infection, in addition, there is a greater amount of memory and effector cells against a specific antigen.7 Thus, when the organism has previously been in contact with a particular antigen, anamnestic or secondary res-ponse appears, which is mediated by IgG or IgA.7 It has been described in adults that pneumococcal antibody le-vels decline within 6 years following the implementation of the first dose.8 Therefore, a booster dose is necessary, particularly in patients at high risk of pneumococcal infection. Such reinforcement increases antibody levels at least 1.4 times in ~55% of adult cases who were not previously vaccinated and those who were 5.5–9 years before administration of the vaccine.8 A previous study mentioned that with two-dose of a primary vaccination without booster schemes, children may not achieve the protection against certain specific pneumococcus antigens. This would make them susceptible to infection by specific strains of this microorganism.9 Another study documented that, in premature infants and in term infants, antibody titers decrease during the first year of life even if three

doses are applied as a first-time shot.10 However, in the present study, except for a child who was immunized with two doses, both vaccination schedules (two doses with or without booster) continued to evoke an immune response, although to different degrees, but without the application of the reinforcement as in the case of the two-dose group. The effectiveness of the vaccine used in the groups of children studied also show evidence of health adherence to quality standards required at the time of application of this vaccine during the cold chain process.5 Degree of parental participation is important, not only to this type of study but also to vaccination programs whose degree of coverage should be increased. In the case of pneumo-coccal conjugate vaccine in children <2 years of age it is only 46.1%.11,12 In our setting, involvement of parents and children is provided by the direct and continual work of nurses within the framework of the ongoing program of universal vaccination of the various health institutions and community context. Previous studies have documented that the importance of community participation is achieved through health education to promote individual behavior change, along with public policies that support effective vaccination schedules.13 On the other hand, the influence of other factors involved in adequate immune response

Table 1. Comparison of the clinical characteristics of children submitted to different immunization schemes against Streptococcus pneu-moniae with heptavalent pneumococcal vaccine

Characteristics* Two-dose of primary vaccinationOR 95% CI p

Without booster (n = 14)

With booster (n = 15)

Gender (F/M) 7/7 7/8 1.14 0.3–4.9 0.858Birth method(cesarean/vaginal)

9/5 11/4 0.65 1.3–3.2 0.599

First-born (Y/N) 5/9 11/4 0.20 0.04–0.98 0.048a

Weight Birth (g) 3300

(3975–3512)3400

(3025–3825)0.27

Present (kg) 11.7(10.7–13.5)

12(11.4–13.9)

0.80

Length Birth (cm) 51

(50–51.7)51

(49–53)0.62

Present (cm) 88(84.5–94.5)

87.5(82.5–92.5)

0.10

*Quantitative values are expressed as median (interquartile range). Between-group comparisons were done with Mann–Whitney U test with the exception of delivery method that was compared with Fisher exact test.aStatistically significant.


Norma Angélica Silva-Rosales, Carlos Enrique Tene, Víctor Hugo Cervantes-Kardasch, and Mario Del-Toro

in different populations has been demonstrated.1 Our study showed no differences between groups regarding somatometric factors or risk factors for pneumococcal infection such as overcrowding, smoking history, pre-maturity, lack of breastfeeding, among others. Nor was it found that these factors could influence the results of the immune response. An unexpected finding was that there was a higher proportion of firstborn immunized with the three-dose schedule. This should be explored in future studies. Although measurement of specific antibodies against each of the serotypes included in a vaccine is the most accepted form of assessing their ability to evoke an immune response, the measurement technique used in this study also has a high degree of sensitivity.14 The precipitation phenomenon was docu-mented for decades and is the basis for many current immunochemical techniques.14 These reactions allow antigen detection through the use of coated particles of antigens or antibodies15 and have been used in different clinical stages.16,17 In the laboratory technique used here, direct agglutination was a classic reaction characterized by the agglomeration of cells (in this case erythrocytes) using specific antibodies. Usefulness of the latex agglu-tination test for serotyping strains of S. pneumoniae in clinical samples from patients with invasive disease has been shown because of the high discriminatory power (92.5%).18 The laboratory technique used in this study is semiquantitative and may be considered when

economic resources are limited or when countries do not have the appropriate reagents to evaluate immune response by ELISA. The prospects of the study include evaluating the effectiveness of immunization schedules and follow-up on titers attained by either immunization scheme to quantify the duration of the immune response induced by the vaccine based on the date of the last dose of application, which was not considered in this study. On the other hand, economic costs should be explored against potential benefits of each immunization sche-me, not only considering the ideal clinical context but also external factors such as limited financial resources at the governmental level. Finally, the desirability of continuing promotion of compliance coverage with the minimum required protection against pneumococcus should be discussed or the inclination to seek a higher immune response when the clinical and economic con-text allows. In regard to children who show WIR, the possibility of completing the scheme with a booster of the heptavalent pneumococcal vaccine at 2 years of age to increase the immune response and, consequently, provide protection from infections should be assessed.

AcknowledgementsThe present study was supported by CONACyT graduate scholarship for the first author. We thank the support of Dra Virginia Nuncio and nurses Berenice Mendoza y Elsa Cuevas.

Table 2. Comparison of the clinical characteristics of children submitted to different immunization schemes against Streptococcus pneu-moniae with heptavalent pneumococcal vaccine

Characteristics*

Two-dose of primary vaccination

OR 95% CI pWithout booster(n = 14)

Without booster(n = 15)

Age(months)

26(26-28)

25(24-28)

0.66

Duration of pregnancy (gestation weeks) 39(38-40)

40(38-40)

0.11

Maternal breastfeeding (months) 5 4 0.47No. of persons who sleep in the same room 2

(1–3)2

(1–3)0.20

Immunological response (weak/adequate)** 8/6 2/13 8.7 (1.3–53.8) 0.017a

*Quantitative values are expressed as median (interquartile range). Between-group comparisons were done with Mann–Whitney U test with the exception of immunological response that was compared with Fisher exact test.**Immunological response was considered weak when hemagglutination was only perceived at 1:2 dilution. In contrast, adequate hema-gglutination is considered as >1:2. aStatistically significant.



REFERENCES

1. Guevara M, Barricarte A, Pérez B, Arriazu M, García Cenoz M, Castilla J. La vacuna neumocócica conjugada heptava-lente (Prevenar™). Diferencias en su efectividad en distintas poblaciones. An Sis Sanit Navar 2008;31:171–192.

2. Black S, Shinefield H, Fireman B, Lewis E, Ray P, Hansen JR, et al. Efficacy, safety and immunogenicity of heptavalent pneumococcal conjugate vaccine in children. Northern Califor-nia Kaiser Permanente Vaccine Study Center Group. Pediatr Infect Dis J 2000;19:187–195.

3. Käyhty H, Åhman H, Eriksson K, Sörberg M, Nilsson L. Im-munogenicity and tolerability of a heptavalent pneumococcal conjugate vaccine administered at 3, 5 and 12 months of age. Pediatr Infect Dis J 2005;24:108–114.

4. Dawson B, Trapp R. Basic and Clinical Biostatistics. USA: McGraw-Hill; 2006.

5. Vesta L, González A, Coronel DL, Aldama O, Gómez CM, Desentis JF, et al. Manual de vacunación 2008–2009. México, DF: Centro Nacional para la Salud de la Infancia y la Adolescencia; 2008.

6. Lee H, Nahm MH, Burton R, Kim KH. Immune response in infants to the heptavalent pneumococcal conjugate vaccine against vaccine-related serotypes 6A and 19A. Clin Vaccine Immunol 2009;16:376–381.

7. Abbas AK, Lichtman AH, Pillai S. Inmunología Celular y Mo-lecular. Madrid: Elsevier; 2008.

8. Davidson M, Bulkow LR, Grabman J, Parkinson AJ, Chamblee C, Williams WW, et al. Immunogenicity of pneumococcal re-vaccination in patients with chronic disease. Arch Intern Med 1994;154:2209–2014.

9. Lockhart SP, Hackell JG, Fritzell B. Pneumococcal conjugate vaccines: emerging clinical information and its implications. Expert Rev Vaccines 2006;5:553–564.

10. Ruggeberg JU, Collins C, Clarke P, Johnson N, Sinha R, Ever-est N, et al. Immunogenicity and induction of immunological memory of the heptavalent pneumococcal conjugate vaccine in preterm UK infants. Vaccine 2007;25:264–271.

11. Sánchez L, Pérez D, Alfonso L, Castro M, Sánchez LM, Van der Stuyft P, et al. A community education strategy to promote participation in dengue prevention in Cuba. Rev Panam Salud Publica 2008;24:61–69.

12. Instituto Nacional de Salud Pública. Encuesta Nacional de Cobertura del Esquema de Vacunación 2008.

13. Beltrán L. Comunicación para la salud del pueblo. Una revisión de conceptos básicos. Estudios sobre las Culturas Contem-poráneas 2010;31:17–65.

14. Henry JB, Todd JC, Sanford AH, Davidsohn I. Diagnóstico y Tratamiento Clínicos por el Laboratorio. Barcelona: Salvat; 1988.

15. Kabat EA. Antibodies responsible for allergic reactions and the difficulties involved in studying them. Int Arch Allergy Appl Immunol 1961;18:1–2.

16. Yoshida R, Igarashi M, Ozaki H, Kishida N, Tomabechi D, Kida H, et al. Cross-protective potential of a novel monoclonal antibody directed against antigenic site B of the hemagglutinin of influenza A viruses. PLoS Pathog 2009;5:e1000350.

17. Effler PV, Bogard AK, Domen HY, Katz AR, Higa HY, Sasaki DM. Evaluation of eight rapid screening tests for acute leptos-pirosis in Hawaii. J Clin Microbiol 2002;40:1464–1469.

18. Sanz JC, Culebras E, Ríos E, Rodríguez-Avial I, Wilhelmi I, Ramos B, et al. Direct serogrouping of Streptococcus pneu-moniae strains in clinical samples by use of a latex aggluti-nation test. J Clin Microbiol 2010;48:593–595. doi:10.1128/JCM.01651-09.


Prevalence of vitamin D receptor gene polymorphisms in mexican children with chronic kidney disease

research article


Elba Onelida Medina-Hernández,1 Benjamín Antonio Rodríguez-Espino,1 Ana María Hernández-Sánchez,1 Lourdes Matilde Ortiz-Vázquez,1 Perla Oropeza,1 Daniel Díaz,1 Rubén Aldana-Vergara,1 Francisco Velásquez-Forero,1 Olynka Vega,2 Ricardo Correa-Rotter,2 and Mara Medeiros1

AbSTRACT

background. The possible influence of vitamin D receptor (VDR) gene polymorphisms on the regulation of the calcium–parathyroid hor-mone–vitamin D axis is particularly important in end-stage renal disease (ESRD) patients due to alterations in bone mineral metabolism. The aim of the study was to describe the frequency of VDR gene polymorphisms rs7975232 (ApaI), rs731236 (TaqI), rs1544410 (BsmI) and their relationship with serum calcium, phosphate, alkaline phosphatase and parathyroid hormone in children with ESRD.methods. Thirty one patients were included in the study. Blood samples were drawn for biochemical determinations and DNA extraction. VDR genotypes were analyzed as restriction fragment length polymorphisms using ApaI, BsmI and TaqI.Results. Mean age of the patients was 15.6 ± 3.6 years. For ApaI, seven patients were AA (22.58%), 18 patients were Aa (58.06%) and six patients were aa (19.35%). For BsmI, 14 patients were BB (45.16%) and 17 were Bb (54.83%). Patients who were homozygous for BB had higher serum calcium concentrations than Bb patients (p = 0.04). For TaqI, 19 patients were TT (61.3%), 11 were Tt (35.48%) and one was tt (3.22%). Those with t allele (Tt or tt) had serum calcium concentrations significantly lower than TT patients.Conclusions. Genotype and allele frequency of the VDR gene is reported in Mexican patients with ESRD. Those with BB or TT genotype had higher serum calcium concentrations.Keywords: vitamin D receptor, gene polymorphism, renal transplantation, serum calcium, end-stage renal disease.

1 Laboratorio de Investigación en Nefrología y Metabolismo Mineral Óseo, Hospital Infantil de México Federico Gómez, Mexico, D.F., Mexico

2 Departamento de Nefrología, Instituto Nacional de Ciencias Médicas y la Nutrición Salvador Zubirán

México, D.F., México

Correspondence: Dra. Mara Medeiros DomingoLaboratorio de Investigación en Nefrología y Metabolismo Mineral Óseo Hospital Infantil de México Federico Gómez Mexico, D.F., MexicoE-mail: [email protected]


INTRODuCTIONChronic kidney disease (CKD) has multiple effects on bone mineral metabolism from the early stages of the disease.1 This entity is known as mineral and bone disorders, chronic kidney disease (CKD-MBD) and manifests as one or more of the following characteristics: 1) metabolic alterations in calcium, phosphorus, vitamin D and parathyroid hormone

(PTH), 2) alterations in histology, linear growth or bone strength and 3) vascular or soft tissue calcifications.1 The extent of bone disease tends to be associated with the severity and duration of renal disease. If these changes are left untreated during childhood in a timely manner, delays in bone maturation or bony deformities may occur.2 The main cause of death in patients with CKD includes cardiovascular disease in both children as well as adults.3 Treatment of CKD-MBD affects the progression of vas-cular damage.3-5

Homeostasis of calcium and phosphorus involve the parathyroid gland, intestine, kidney and bone, which are the major bodily reservoirs of calcium and phosphorus.6 Vitamin D exists as an ergocalciferol (vitamin D2) when it occurs in plants or cholecalciferol (vitamin D3) in animal tissues.7 Both are biologically inactive (pro-hormones) and must be hydrolyzed in the liver as carbon 25. Once hydrolyzed, they give rise to 25-hydroxyvitamin [25(OH)D3], which is the most abundant metabolite of vitamin D.8 25(OH)D3 when transformed into 1,25 dihydroxychole-calciferol or calcitriol (active vitamin D) then acts in its


Prevalence of vitamin D receptor gene polymorphisms in Mexican children with chronic kidney disease

physiological role as a hormone.9 This occurs mainly in the proximal renal tubules by the action of the enzyme 1α-hydroxylase (CYP27B1). The effects of calcitriol are regulated by binding to its specific nuclear steroid receptor known as vitamin D receptor (VDR). VDR is located in different cells of the organism, both in the kidneys as well as in other target tissues including parathyroid gland, bone, heart, intestine, endothelial cells, lymphocytes, megakar-yocytes, pneumocytes, etc.10-12

Calcitriol-VDR complex translocates to the nucleus and forms a heterodimer with the retinoic X receptor that binds to response elements in vitamin D and stimulates the transcription of various genes. In the bone, VDR acti-vation increases the expression of fibroblast growth factor (FGF23) and stimulates resorption of bone calcium depo-sits. In the parathyroid gland VDR blocks the transcription of the PTH gene and in increases calcium absorption in the intestine.6 It has also been reported that VDR modulates the transcription of genes that alter histones.13

VDR gene is located on chromosome 12 (12q13.11) with 11 exons and four polymorphic regions.14,15 The deleterious mutations in the VDR gene cause calcitriol-resistant rickets, a rare monogenic disease.16 We also know that there are several polymorphisms detected by restric-tion enzymes: BsmI (for rs1544410), ApaI (for rs7975232) and TaqI (for rs731236).17 These polymorphisms are lo-cated in the 3’ region of intron 9 and exon 10 of the VDR gene (Ensembl: ENSG00000111424).

The possible influence of polymorphisms of the gene that encode the VDR on the regulation of the calcium/parathyroid hormone (PTH)/vitamin D axis is particularly important in patients with CKD in which alterations have been described, in both parathyroid VDR content as well as in its functionality, which modify the transcriptional activity of this gene.15

Available information on the influence of these po-lymorphisms and bone density varies depending on the series consulted. In the case of BsmI, the wild-type allele is associated with higher values of bone mass.17

It has been reported that, in patients on hemodialysis who are homo- and heterozygous for the b allele have higher levels of PTH than homozygous BB patients18 and BB carriers require less parathyroidectomies.19 VDR po-lymorphisms have also been associated with autoimmune diseases such as multiple sclerosis and type 1 diabetes mellitus, as well as other acquired diseases such as hyper-

tension, cancer, remineralization and bone density. 14,16,20-22 The objective of this study was to describe the frequency of polymorphisms rs7975232 (ApaI), rs731236 (TaqI) and rs1544410 (BsmI) in the VDR and its relation to some biochemical markers (PTH, phosphorus, serum calcium) in children with CKD.

mETHODS

Patients Pediatric patients23 with end-stage renal disease (ESRD) were invited to participate. Patients were awaiting kidney transplant and were treated at the Department of Nephro-logy from November 2009 to February 2011. The study was approved by ethics and research committees of the Hospital Infantil de México Federico Gómez (HIMFG). We obtained informed consent/assent from all participating patients and their guardians.

Clinical examination was done and blood samples were taken to determine intact parathyroid hormone (iPTH), serum calcium corrected for the amount of albu-min, serum phosphorus, total alkaline phosphatase and bone fraction. Another sample was also obtained from peripheral blood (3 ml) in a tube containing EDTA to obtain DNA. For this we used the commercial kit QIA-amp DNA Blood Mini- Kit (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations. De-termination of the concentration of DNA was performed with a spectrophotometer (NanoDrop 1000). Working solutions were prepared with a DNA concentration of 100 ng in 1 µl of water.

For genotype analysis, we used polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). We used the NCBI dbSNP Build 13524 database for the location and sequence of the single nucleotide po-lymorphisms (SNP): rs7975232, rs731236 and rs1544410 (3’ region of intron 9 and exon 10 of the VDR gene).

Oligonucleotides for PCR The design of the primers was performed with the Pri-mer3 program.25,26 For the design, we used the sequence of the VDR gene as reference (ENSG00000111424) of ENSEMBL,27 the European Bioinformatics Institute (EBI), the European Molecular Biology Laboratory (EMBL) and the Wellcome Trust Sanger Institute (WTSI) (Table 1).


Elba Onelida Medina-Hernández, Benjamín Antonio Rodríguez-Espino, Ana María Hernández-Sánchez, Lourdes Matilde Ortiz-Vázquez, Perla Oropeza, Daniel Díaz, Rubén Aldana-Vergara, Francisco Velásquez-Forero, Olynka Vega, Ricardo Correa-Rotter, and Mara Medeiros

Restriction Endonucleases for RFLP ApaI enzymes were used (rs7975232) and TaqI (rs731236) in the Fermentas FastDigest kits (Thermo Fisher Scientific, Pittsburgh, PA) and BsmI (rs1544410) from New England Biolabs, Inc. (Beverly, MA) (Table 2).

For resolution of the digestion products, we carried out electrophoresis on the agarose gel at 3.5% in Tris-borate EDTA (1X TBE) buffer with a molecular weight marker of 100 base pairs (bp) (GeneRuler, Fermentas, Thermo Fisher Scientific) (Figures 1 and 2).

Statistical Analysis Frequency and percentage of each of the polymorphisms was recorded. Hardy-Weinberg equilibrium (HWE) was performed with χ2.28 We recommend the application of this test when genetic polymorphism studies are carried out because it allows the identification of a representati-ve sample. The proportion of genotypes of a population remains constant if the sample size is appropriate and if no mutations exist, no genes are introduced or lost, and no selection of genotypes occur.

Figure 2. PCR-RFLP for SNP rs1544410 with the restriction enzyme BsmI. Gel electrophoresis of agarose in 3.5% stained with ethidium bromide. PM: molecular weight marker of 100 bp. Below illustrates three possible genotypes resulting from restriction enzyme:• Homozygous wild bb: total cut (two bands)• Homozygous mutant BB: partial cut (one band)• Heterozygous Bb: partial cut (three bands)

Figure 1. Agarose gel electrophoresis in 2% of PCR products. Ethidium bromide staining. PM: molecular weight marker of 100 base pairs (bp). Lanes 1, 3, 5: rs7975232/rs731236 (ApaI/TaqI). Lanes 2 and 4: rs1544410 (BsmI).

Table 1. Description of the oligonucleotides designed by PCR

Polymorphism Sense sequence(5´–3´)

Antisense sequence(5´–3´)

Length (bp) Temp. (°C)

rs7975232 gtctggatcctaaatgcacgg gatcatcttggcatagagcagg 325 60

rs731236 gtctggatcctaaatgcacgg gatcatcttggcatagagcagg 325 60

rs1544410 gaaatacctactttgctggtttgc tataggcagaaccatctctcagg 277 60

PCR, polymerase chain reaction.

Table 2. Recognition sequences of the restriction enzymes

Enzyme(SNP)

Recognition sequence and cut* Base change Ancestral allele

ApaI(rs7975232)

5´…G G G C C ↓ C…3´3´… C

↑ C C G G G…5´

G>T G

TaqI(rs731236)

5´…T ↓ C G A …3´3´…A G C

↑T …5´

C>T T

BsmI (rs1544410) 5´… G A A T G C N ↓ …3´3´… C T T A C

↑ G N…5´

A>G G

*Restriction site is indicated by arrows.



Comparison of the values of calcium, phosphorus, total alkaline phosphatase, and bone fraction for ApaI and TaqI genotype was assessed with the Kruskal–Wallis test. For BsmI, we used the Mann–Whitney test or Student t test according to the distribution of variables, comparing BB homozygotes with heterozygotes.

RESuLTS

We included 31 pediatric patients with ESRD. Average age of the patients was 15.6 ± 3.6 years (Table 3). For the genotype, for SNP rs7975232 (ApaI enzyme) seven pa-tients (22.58%) were homozygous AA mutant, 18 patients (58.06%) were heterozygotes, and six patients (19.35%) were homozygous wild-type aa. We found χ2 = 0.82 (Table 4). Homozygous mutant (AA) patients for this SNP showed higher numbers of PTH compared with homozygous wild-type (aa) patients but without statistical significance. There were also no differences in the concentrations of calcium, phosphorus and alkaline phosphatase (Table 5).

The observed genotypes for SNP rs1544410 (BsmI enzyme) were as follows: 14 patients (45.16%) were homozygous mutant BB and 17 patients (54.83%) were heterozygotes. We did not find any bb homozygotes (Table 4). BB patients showed serum calcium concentrations greater than average (9.4 ± 1.3 mg/dL) compared with genotype Bb, with calcium concentrations of 8.3 ± 1.38 mg/dL (p = 0.04). No differences were found between the other variables studied (Table 6).

Genotypes for the SNP rs731236 (TaqI enzyme) revea-led 19 patients (61.3%) who were homozygous mutant TT, 11 patients (35.48%) were heterozygotes and only one case (3.22%) was homozygous wild-type (Table 4). Individuals with allele t presented serum calcium concentrations that were significantly lower than TT homozygotes (Table 7).

Table 3. Demographic characteristics of 31 patients with ESRD

Average age ± SD (years) 15.6 ± 3.6Gender Male (%) 16 (52%) Female (%) 15 (48%)Replacement therapy PD (%) 18 (58%) HD (%) 8 (26%) Predialysis (%) 5 (16%)

ESRD, end-stage renal disease; PD, peritoneal dialysis; HD, hemodialysis.

Table 4. Frequency of genotypes and alleles of the receptor gene of vitamin D in Mexican children

Genes n %

rs7975232 (ApaI)Genotypes

AA 7 23Aa 18 58Aa 6 19

AllelesA 32 51.6A 30 48.4

rs1544410 (BsmI)Genotypes

BB 14 45Bb 17 55Bb — —

AllelesB 45 72.5B 17 27.5

rs731236 (TaqI)Genotypes

TT 19 61Tt 11 36

Table 5. Relation of the rs7975232 (ApaI) polymorphism with the biochemical parameters

Parameter AAn = 7

Aan = 18

aan = 6

p

iPTH (pg/mL) 463(122–1312)

118(41–432)

142(68–375)

0.36

TAP (μg/dL) 313(208–557)

209(135–321)

312(209–574)

0.23

BSAP (%) 94.8(69.2–97)

91.3(69.3–97)

91.5(60–95)

0.89

Calcium (mg/dL) 9.2(8.4–9.5)

7-8-9.7 9.6 0.91

Phosphorus (mg/dL) 5.4(4.4–5.6)

5.9(4–7.7)

4.8(4–6.6)

0.54

Values expressed as median (25th and 75th percentile).iPTH, intact parathyroid hormone; TAP, total alkaline phosphatase; BSAP (%), bone-specific alkaline phosphatase.p values obtained using Kruskal–Wallis test.

DISCuSSION

Frequencies of VDR polymorphisms found in Mexican children with ESRD differ from those reported for other ethnic populations. For ApaI, it has been reported for the


Elba Onelida Medina-Hernández, Benjamín Antonio Rodríguez-Espino, Ana María Hernández-Sánchez, Lourdes Matilde Ortiz-Vázquez, Perla Oropeza, Daniel Díaz, Rubén Aldana-Vergara, Francisco Velásquez-Forero, Olynka Vega, Ricardo Correa-Rotter, and Mara Medeiros

Caucasian population to be 37% AA, 39% for aa and 23% for Aa, whereas 58% of the patients in our study were heterozygous.29

Yokoyama et al. studied 129 Japanese patients and found that ApaI polymorphism shows a negative associa-tion with the progression of hyperparathyroidism. PTH levels in the aa group were almost twice those of the AA and Aa groups (p ≤0.04).30 We found no difference in the biochemical parameters studied in Mexican children with the ApaI genotype.

BB genotype is reported in 15% of the Caucasian population, whereas in Japan it was only 1 to 2%.17 In our study we found genotype BB in 45% of patients and genotype Bb in 55% of patients, which was predominant. No patient had the wild-type allele. This may be due to the fact that the sample size was small. In a previous study by Avila et al. of 197 Mexican women undergoing dialysis, the authors reported a bb genotype frequency of 64%. Women with the B allele had more osteopenia than those with the wild-type allele.31

In a study conducted by Sainz et al. in 100 healthy prepubertal females of Mexican-American descent with ages between 6.7 and 11.7 years who were recruited from schools in Los Angeles, these authors found that the most common genotypes were Aa (55%), Bb (42%) and TT (54%). Genotypes aa and bb were more frequent than AA and BB (24 and 21% and 44 and 14%, respectively). This was similar to that reported previously in a French population and in subjects of European descent in Australia and the U.S. Females with aa or bb mutant genotype had higher bone density than those homozygous for the wild-type AA or BB allele.32

The most common genotypes found in Mexican pe-diatric patients with ESRD were as follows: for SNP rs7975232 (ApaI), the heterozygous genotype Aa in 58%; for the SNP rs1544410 (BsmI), the heterozygote Bb geno-type in 55%; and for the SNP rs731236 (TaqI), the mutant homozygous TT genotype was found in 61%.

Patients with homozygous mutant genotype BB for the SNP rs1544410 showed serum calcium levels significantly higher than those with genotype Bb. Patients with wild-type allele t for SNP rs731236 (Tt or tt) had significantly lower calcium levels than those with mutant genotype TT.

AcknowledgmentsFunding for this study was received from Fondos Federales HIM/2010/006. D.D.B. received support in the form of a scholarship from PUIS-UNAM.

REFERENCES

1. Moe S, Drüeke T, Cunningham J, Goodman W, Martin K, Olgaard K, et al. Definition, evaluation, and classification of renal osteodystrophy: a position statement from Kidney Disease: Improving Global Outcomes (KDIGO). Kidney Int 2006;69:1945-1953.

Table 6. Relation of the rs1544410 (BsmI) polymorphism with the biochemical parameters

Parameter BBn = 14

Bbn = 17

p

iPTH (pg/mL) 134(40.4–505)

220(58–642)

0.56

TAP (μg/dL) 277(193–394)

220(134–329)

0.46

BSAP (%) 90.4(66–95)

94.5(83–98)

0.27

Calcium (mg/dL) 9.4 ± 1.3 8.3 ± 1.38 0.04Phosphorus (mg/dL) 5.4 ± 1.5 5.4 ± 1.6 0.96

Values expressed as median (25th and 75th percentile) or average ± standard deviation.iPTH, intact parathyroid hormone; TAP, total alkaline phosphatase; BSAP (%), bone-specific alkaline phosphatase.p values obtained using Mann–Whitney U test or Student t test according to the distribution of the variables.

Table 7. Relation of the rs731236 (TaqI) polymorphism with the biochemical parameters

Parameter TTn = 19

Ttn =11

Ttn = 1

p

iPTH (pg/mL) 200(45–463)

99(39–1239)

78.5 0.84

TAP (μg/dL) 246(193–361)

280.5(116.6–512)

241 0.99

BSAP (%) 93(67.4–96.7)

92.3(70–97.6)

89 0.77

Calcium (mg/dL) 9.4(8.8–9.8)

7.9(6.6–9.1)

8.7 0.04

Phosphorus (mg/dL) 5.2(4–6.1)

6.2(4–7)

4.2 0.43

Values expressed as median (25th and 75th percentile).iPTH, intact parathyroid hormone; TAP, total alkaline phosphatase; BSAP (%), bone-specific alkaline phosphatase.p values obtained using Kruskal–Wallis test.



2. Klaus G, Watson A, Edefonti A, Fischbach M, Rönnholm K, Schaefer F, et al. Prevention and treatment of renal osteodys-trophy in children on chronic renal failure: European guidelines. Pediatr Nephrol 2006;21:151-159.

3. Moe SM, Chen NX. Mechanisms of vascular calcification in chronic kidney disease. J Am Soc Nephrol 2008;19:213-216.

4. Hruska KA, Choi ET, Memon I, Davis TK, Mathew S. Cardio-vascular risk in chronic kidney disease (CKD): the CKD-mineral bone disorder (CKD-MBD). Pediatr Nephrol 2010;25:769-778.

5. Bover J, Cozzolino M. Mineral and bone disorders in chronic kidney disease and end-stage renal disease patients: new insights into vitamin D receptor activation. Kidney Int Suppl 2011;1:122-129.

6. Mejía N, Roman-García P, Miar AB, Tavira B, Cannata-Andía JB. Chronic kidney disease—mineral and bone disorder: a complex scenario. Nefrologia 2011;31:514-519. doi:10.3265/Nefrologia.pre2011.Jun.10926.

7. Reichel H, Koeffler HP, Norman AW. Production of 1 alpha,25-dihydroxyvitamin D3 by hematopoietic cells. Prog Clin Biol Res 1990;332:81-97.

8. Portale AA, Miller WL. Human 25-hydroxyvitamin D-1alpha-hydroxylase: cloning, mutations, and gene expression. Pediatr Nephrol 2000;14:620-625.

9. Velásquez-Forero F, García P, Triffitt JT, Llach F. Prostaglandin E1 increases in vivo and in vitro calcitriol biosynthesis in rabbits. Prostaglandins Leukot Essent Fatty Acids 2006;75:107-115.

10. Silvagno F, De Vivo E, Attanasio A, Gallo V, Mazzucco G, Pescarmona G. Mitochondrial localization of vitamin D receptor in human platelets and differentiated megakaryocytes. PLoS One 2010;5:e8670. doi:10.1371/journal.pone.0008670.

11. Cozzolino M, Mazzaferro S, Messa P. New insights into the role of calcium-sensing receptor activation. J Nephrol 2011;24(suppl 18):S38-S41. doi: 10.5301/JN.2011.7760.

12. Haussler MR, Jurutka PW, Mizwicki M, Norman AW. Vitamin D receptor (VDR)-mediated actions of 1α,25(OH)(2)vitamin D(3): genomic and non-genomic mechanisms. Best Pract Res Clin Endocrinol Metab 2011;25:543-559.

13. Pereira F, Barbáchano A, Singh PK, Campbell MJ, Muñoz A, Larriba MJ. Vitamin D has wide regulatory effects on histone demethylase genes. Cell Cycle 2012;11:1081-1089.

14. Ranganathan P. Genetics of bone loss in rheumatoid arthri-tis—role of vitamin D receptor polymorphisms. Rheumatology (Oxford) 2009;48:342-346.

15. Jofre R. Polimorfismos del gen del receptor de la vitamina D (VDR) y función paratiroidea. Nefrología 2001;21(suppl 1):51-55.

16. Uitterlinden AG, Fang Y, Van Meurs JB, Pols HA, Van Leeuwen JP. Genetics and biology of vitamin D receptor polymorphisms. Gene 2004;338:143-156.

17. Gómez Alonso C, Naves Díiaz ML, Díaz-Corte C, Fernán-dez Martín JL, Cannata Andía JB. Vitamin D receptor gene

(VDR) polymorphisms: effect on bone mass, bone loss and parathyroid hormone regulation. Nephrol Dial Transplant 1998;13(suppl 3):73-77.

18. Nagaba Y, Heishi M, Tazawa H, Tsukamoto Y, Kobayashi Y. Vitamin D receptor gene polymorphisms affect secondary hyperparathyroidism in hemodialyzed patients. Am J Kidney Dis 1998;32:464-469.

19. Borràs M, Torregrossa V, Oliveras A, Almirall J, Marco MP, Betriu A, et al. BB genotype of the vitamin D receptor gene polymorphism postpones parathyroidectomy in hemodialysis patients. J Nephrol 2003;16:116-120.

20. Valdivielso JM, Fernandez E. Vitamin D receptor polymor-phisms and diseases. Clin Chim Acta 2006;371:1-12.

21. Swapna N, Vamsi UM, Usha G, Padma T. Risk conferred by FokI polymorphism of vitamin D receptor (VDR) gene for essential hypertension. Indian J Hum Genet 2011;17:201-206.

22. Suh KT, Eun IS, Lee JS. Polymorphism in vitamin D receptor is associated with bone mineral density in patients with ado-lescent idiopathic scoliosis. Eur Spine J 2010;19:1545-1550.

23. American Academy of Pediatrics. Council on Child and Adoles-cent Health. Age limits of pediatrics. Pediatrics 1988;81:736.

24. Single Nucleotid Polymorphism data base. Available at: http://www.ncbi.nlm.nih.gov/projects/SNP/

25. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 2000;132:365-386.

26. Primer 3 (v. 0.4.0.). Primer designer. Available at: http://frodo.wi.mit.edu/

27. Ensembl genome browser. Available at: http://www.ensembl.org/index.html

28. Rodriguez S, Gaunt TR, Day IN. Hardy-Weinberg equilibrium testing of biological ascertainment for Mendelian randomization studies. Am J Epidemiol 2009;169:505-514.

29. Ingles SA, Haile RW, Henderson BE, Kolonel LN, Nakaichi G, Shi CY, et al. Strength of linkage disequilibrium between two vitamin D receptor markers in five ethnic groups: implications for association studies. Cancer Epidemiol Biomarkers Prev 1997;6:93-98.

30. Yokoyama K, Shigematsu T, Tsukada T, Ogura Y, Takemoto F, Hara S, et al. Apa I polymorphism in the vitamin D receptor gene may affect the parathyroid response in Japanese with end-stage renal disease. Kidney Int 1998;53:454-458.

31. Avila M, Prado C, Ventura MJ, Mora C, Briones D, Valdez H, et al. Vitamin D receptor gene, biochemical bone markers and bone mineral density in Mexican women on dialysis. Nephrol Dial Transplant 2010;25:2259-2265.

32. Sainz J, Van Tornout JM, Loro ML, Sayre J, Roe TF, Gilsanz V. Vitamin D-receptor gene polymorphisms and bone density in prepubertal American girls of Mexican descent. N Engl J Med 1997;337:77-82.


Direct medical costs of treating mexican children under 2 years of age with respiratory syncytial virus

research article


Joaquín F. Mould-Quevedo,1 Iris Contreras-Hernández,2 Silvia Martínez-Valverde,3 Miguel A. Villasís-Keever,4 Víctor M. Granados-García,5 Guillermo Salinas-Escudero,3 and Onofre Muñoz-Hernández3

AbSTRACT

background. Respiratory syncytial virus (RSV) is the most frequent etiologic agent causing lower respiratory tract infection in children <2 years of age. Between 0.5 and 3% of patients will require hospitalization. The aim of this study was to estimate the direct medical cost of treating children <2 years old with suspicion of RSV at the Instituto Mexicano del Seguro Social (IMSS). methods. Direct medical costs were estimated from an institutional perspective. Medical records were reviewed from patients <2 years of age who attended emergency services in second-level hospitals including subjects who required hospitalization. Estimated costs were obtained with the microcosting technique using the institutional costs from IMSS (year 2010). Costs were reported in USD (year 2011). Results. When analyzing total medical costs, outpatient management yielded a cost of $230.0 ± $10.30 U.S. dollars (USD), whereas hospitalized patients exhibited an average cost of $8,313.20 ± $595.30 USD. The main components of outpatient management costs were emergency visits, specialist consultations and diagnostic testing (41.6%, 32.7% and 10.7% of the total cost, respectively). In the case of hospitalized patients, intensive care unit cost (89.3%) and overall hospitalization cost (6.5%) represented 95.7% of the total cost. Conclusions. RSV is a disease that represents a significant economic burden for health care institutions, although most patients are treated on an outpatient basis. Key words: direct medical costs, respiratory syncytial virus, microcosting.

1 Health Economics and Outcomes Research Director, Latin Ame-rica and Primary Care Products, Pfizer Laboratories, Mexico, D.F., Mexico

2 Hospital General de Zona 1-A “Venados”, Instituto Mexicano del Seguro Social (IMSS), Mexico, D.F., Mexico

3 Centro de Estudios Económicos y Sociales en Salud (CEESES), Hospital Infantil de México Federico Gómez, Mexico, D.F., Mexico

4 Unidad en Investigación en Epidemiología Clínica, Hospital de Pediatría, Centro Médico Nacional Siglo XXI, IMSS, Mexico, D.F., Mexico

5 Unidad de Investigación de Economía de la Salud, IMSS, México, D.F., México


INTRODuCTION

Respiratory syncytial virus (RSV) is the most frequent etiologic agent that causes lower respiratory tract infection in children <2 years of age.1 It is generally a benign disea-se; however, between 0.5 and 3% of patients will require hospitalization.2 Between 30% and 40% of children will have a lower respiratory tract infection,2-5 and it is consi-dered to be the principal cause of bronchiolitis (60-80%) and pneumonia (20-40%) in infants, which represent the most common clinical presentations.6

There are reports of epidemiological surveillance in Mexico that make it possible to determine that circulation of respiratory viruses during winter months is similar to that of other countries.7 Etiologically, studies by Muraira et al. and Noyola et al. in patients hospitalized for lower respiratory infections with viral infections (30.7-47.2%) place RSV as the most frequent viral agent with (61.3-85.6%).8,9 The epidemiological burden of RSV is estimated at 64 million cases and 160,000 deaths each year.10 In the U.S., direct medical costs of RSV associated with hos-pitalizations for children between 1997 and 2000 had an average annual cost of $750 million U.S. dollars (USD).11

In Canada, these costs are quantified in the amount of $18 million USD12 where hospitalization (62%) was the most important component of direct medical costs followed by outpatient follow-up (38%).13 At the international level the-re are striking differences in terms of direct medical costs in the care of patients with RSV. Costs of medical care corresponding to hospitalization in patients <36 months of age were reported for Germany as $1,832 USD ($99.20 USD in the case of outpatient care, using an exchange rate of $1.64 euros to $1 USD),14 followed by those reported in Holland and Spain where the same hospital costs were $2,200 USD15 and $2,750 USD, respectively.16 Finally, the


Direct medical costs of treating Mexican children under 2 years of age with respiratory syncytial virus

highest costs were those reported in the U.S. where the costs per hospital admission for RSV ranged from $3,799 USD to $9,000 USD.17,18

In Mexico there is no information regarding the costs involved in the care of patients with RSV; therefore, its impact on health institutions and society is unknown. Even with a high incidence of disease, the majority of RSV infections do not require medical care (ambulatory and/or hospital). However, taking into consideration the high impact of this disease and its impact on high-risk groups (such as patients with heart disease who do require medical attention), carrying out a study that provides information to assist decision-makers in regard to resource allocation and planning within health institutions for management of RSV and its complications in Mexico is warranted.

In this regard, the objective of this study was to identify the management pattern of those patients who receive medical care for suspicion of RSV infection (with hospital and/or ambulatory management) within the public health system and the estimated direct medical costs associated with patient management.


Given that the public health institutions cover more than two-thirds of the Mexican population, the analysis was conducted from the perspective of the public health insti-tutions where information from Hospital General Regional of the Instituto Mexicano del Seguro Social (IMSS) located in Mexico City was used. This hospital is representative of a second-level care facility within the IMSS. To reference the importance of the IMSS, this institution covers 80.8% of the social security services in Mexico.19

A descriptive, cross-sectional, retrospective study was performed and included all patients who were seen from January 2006 to December 2009 in the emergency room and/or were hospitalized with suspicion of bronchiolitis or pneumonia. All patients with gastroesophageal reflux disease, patients with lipoidic pneumonia or with airway malformations were excluded.

A review of medical records was done using a survey that identified the principal demographic and clinical characteristics of the patients (gender, age, weight, height) as well as resources utilized for their management (dose, frequency, duration, quantities, etc.). This review covered information up to 1 year of patient follow-up from the

initial contact in case the patient returned to the hospital due to a complication related to the first encounter. The survey used was previously validated in a pilot study by a group of medical experts within the hospital.

Cost analysis was carried out using a case-mix te-chnique. In the case of services used, unit costs were determined, whereas for estimation of drug costs, the microcosting technique was used (adjusting the calcu-lation according to the presentation and corresponding unit price).

Sources of information used were costs of institutional care (IMSS 2010)20 and unit costs for purchasing drugs by the IMSS during 2010.21 Due to the duration of the study, no discount rate in the costs is used.

Total costs were divided according to the principal cost components and according to whether they corresponded to ambulatory and/or hospital medical care. For each component percentage of utilization, average values of the monetary equivalent expressed in Mexican pesos (year 2010) were presented as well as its standard deviation (SD) and/or resource utilization rates. To generate more robust estimates in the estimation of the SD of the costs, adjustment by means of the bootstrap technique was used.22 For statistical analysis, Excel 2007 and Stata v.10 software were used. Results are reported in USD where an exchange rate of $12 Mexican pesos to $1 USD was used.23

RESuLTS

A total of 74 patients who were treated during the study period were analyzed; 46% (n = 34) were managed as outpatients and 54% (n = 40) required hospitalization. Among the principal characteristics of the patients, fe-males represented 52.7% of the sample. Average age of the patients was 10.78 (±8.2) months. Average weight was 8.23 (±2.5) kg and average height was 68.0 (±10.0) cm (Table 1).

For patients who received outpatient treatment, the average length of stay was 5.89 ± 1.82 h. With regard to the resources used, a consistent pattern was found for these patients. Among these averages were included inter-consultations (inhalation therapy and, to a lesser degree, cardiology) and chest x-ray; 50% had venous infusion as part of their treatment (Table 2). Of the hospitalized pa-tients, 100% were admitted through the emergency room. In order to calculate the total resources utilized for these


Joaquín F. Mould-Quevedo, Iris Contreras-Hernández, Silvia Martínez-Valverde, Miguel A. Villasís-Keever, Víctor M. Granados-García, Guillermo Salinas-Escudero, Onofre Muñoz-Hernández

89.3% and general hospitalization 6.5%), placement of central venous catheter (CVC) 2.0%, interconsultations 0.7%, and ventilatory support and diagnostic/imaging studies 0.5%. The remainder of the resources used repre-sented 0.2%.

DISCuSSION

Emergency services in the IMSS hospitals have a specified length of stay in the emergency room as a maximum of 3 h. One of the important findings in this study was that 20% of the patients exceeded the specified waiting times. Another important finding in the review of the medical records and which was widely discussed with the physicians was the existing problem of lack of rapid diagnostic tests to confirm the etiology of the cases treated in the emergency department, which leads to the following three problems: 1) Without a supportive diagnosis, an increased length

of stay in the emergency department is generated in order to assess patient progress.

2) Lack of accurate diagnosis implies that, in some ca-ses, antibacterial coverage was administered to the patient with this type of infection.

3) Increase in wait time in the emergency room gene-rates a saturation of service and high costs for other patients who arrive for such services.

These three factors increase the actual cost of treatment of patients with RSV within the institution.

When comparing the costs obtained per episode of outpatient management of $230 USD in this study with those costs reported in Germany by Ehlken et al. ($99.20 USD),13 we find that the cost obtained in our study is almost 2.3 times greater. Similarly, we found that our co-

Table 1. General characteristics of patients

Variables

Ambulatory management

In-hospital management

n = 34 n = 40Mean SD Mean SD

Age (months) 13.44 11.64 8.52 5.28

Weight (kg) 8..68 3.04 7.85 2.04

Height (cm) 69.52 11.36 66.90 8.93

Male (%) 52.0 42.5

SD, standard deviation

Table 2. Patient utilization of resources during emergency consult

Variables Ambulatory management n = 34

Mean SD

Shift time in emergency service 1.79 0.20Time of stay (h) 5.89 1.82Emergency consults 1.00 -Interconsults 1.70 0.29Laboratory tests 1.94 0.19Diagnostic studies 1.05 0.05

SD, standard deviation.

patients, it is necessary to add the resources previously reported for outpatient management. The resources de-tailed here correspond to hospital management (Table 3).

Patients managed in the hospital had an average hos-pital stay of 4.35 ± 2.6 days; 98% of patients required ventilatory therapy support, 90% required an additional consultation and a new battery of diagnostic and laboratory studies. Total average cost for patients who received out-patient management was $230.0 ± $10.35 USD, whereas for patients admitted to the hospital the average cost was $8,313.2 ± $595.36 USD (Table 4).

In patients with outpatient management, a percentage of the total costs were for emergency room consultation (41.6%), interconsultation (32.7%), diagnostic/imaging studies (10.7%), costs for venous infusion (7.1%), labo-ratory tests (5.9%) and, finally, medications and solutions, which together represent 1.9%.

In those patients requiring hospital management, the principal component of the total cost was represented by hospitalization (95.7% of the total cost, intensive care

Table 3. Patient utilization of resources during hospitalization

Variables Hospitalization n = 40

Mean SD

Interconsults (inhalotherapy) 0.90 0.13Laboratory tests 2.38 0.30Diagnosis tests 1.40 0.67X-rays 1.20 0.40Days of hospitalization 4.35 0.31Days with ventilatory assistance (oxygen and assisted ventilation)

4.20 0.40

SD, standard deviation.


Direct medical costs of treating Mexican children under 2 years of age with respiratory syncytial virus

rresponding costs for hospital management reported in our study ($8,313 USD) were greater than those reported by Miedema et al.15 ($2,200 USD) and Diez Domingo et al.16 ($2750 USD) for various European countries; however, these were found to be within the range of those reported for the U.S. Health System by Stewart et al.17 and Pelletier, et al.18 of $3,800 USD-$9,000 USD.

Information reported in this study may be valuable in terms of management for decision-makers because it identifies two main aspects: 1) to obtain costs associated with management of patients presenting to medical servi-ces with RSV and 2) to identify a niche of opportunity to improve patient management with the use of rapid diag-nostic tests and to improve utilization of resources within emergency services of the institution. Performance of these tests does not necessarily establish the best alternative; however, it provokes an opportunity for possible further studies including patient characteristics, cost-effectiveness or cost-benefit for the patient and/or institution.

One of the limitations of this study is that the corres-ponding information regarding patient severity was not included, which may provide additional information to explain the somewhat prolonged observation of patients.

Finally, we are aware that the use of medical records as a source of information to determine resource utilization may be a limitation due to underreporting of information normally associated with these types of clinical records.

Estimating the management of patients <2 years of age who seek public health services with suspicion of RSV represented an average direct medical cost of $275 USD in the case of patients managed on an outpatient basis and $7,739 USD in the case of patients requiring hospitalization.

Corresponding author: Mtro. Guillermo Salinas Es-cudero, CEESES, Hospital Infantil de México Federico Gómez, Dr. Márquez 162, segundo piso, Col. Doctores, Delegación Cuauhtémoc, 06720 México, D.F., México.

Tel: 52289917, ext. 3001.E-mail: [email protected]

REFERENCES

1. Levy BT, Graber MA. Respiratory syncytial virus infection in infants and young children. J Fam Pract 1997;45:473-481.

Table 4. Treatment costs in USD

Variables Patient with ambulatory management (emergencies)

Patient with in-hospital management

Mean SD Mean SD

Emergency consults $95.77 — $0.00 —Interconsults $75.33 $7.28 $62.25 $5.00Hospitalization $0.00 — $537.30 $67.47Surgical procedure*,† $16.24 $2.79 $167.91 $13.77Ventilatory support (assisted ventilation) $0.00 — $39.87 $7.85Intensive therapy $0.00 — $7,421.69 $550.97Oxygen $0.00 — $7.22 $5.12Laboratory tests $13.62 $1.34 $16.67 $2.06Diagnosis tests $24.59 $1.38 $43.34 $8.87Antibiotics (emergencies/hospitalization) $0.09 $0.05 $4.49 $0.86Medications (emergencies/hospitalizations) $2.81 $1.37 $9.59 $2.35Solutions emergencies/hospitalizations) $0.27 $0.58 $0.75 $0.13Discharge medications $1.25 $0.48 $1.80 $0.44Discharge antibiotics $0.08 $0.04 $0.29 0.07Total $230.08 $10.35 $8,313.21 $595.36

SD, standard deviation.*Ambulatory venoclysis.†Central venous catheter.


Joaquín F. Mould-Quevedo, Iris Contreras-Hernández, Silvia Martínez-Valverde, Miguel A. Villasís-Keever, Víctor M. Granados-García, Guillermo Salinas-Escudero, Onofre Muñoz-Hernández

2. Meissner HC, Welliver RC, Chartrand SA, Law BJ, Weisman LE, Dorkin HL, et al. Immunoprophylaxis with palivizumab, a humanized respiratory syncytial virus monoclonal antibody, for prevention of respiratory syncytial virus infection in high risk infants: a consensus opinion. Pediatr Infect Dis J 1999;18:223-231.

3. Wright AL, Taussig LM, Ray CG, Harrison HR, Holberg CJ. The Tucson Children’s Respiratory Study. II. Lower respiratory tract illness in the first year of life. Am J Epidemiol 1989;129:1232-1246.

4. Darville T, Yamauchi T. Respiratory syncytial virus. Pediatr Rev 1998;19:55-61. doi: 10.1542/pir.19-2-55.

5. Dubois B, Ray G. Viral infections of the lower respiratory tract. In: Taussig LM, Landau LI, eds. Pediatric Respiratory Medicine: New York: Elsevier; 1999. pp. 573-579.

6. Murtagh P, Cerqueiro C, Halac A, Avila M, Salomón H, Wis-senbacher M. Acute lower respiratory infection in Argentinian children: a 40 month clinical and epidemiological study. Pediatr Pulmonol 1993;16:1-8.

7. Miranda-Novales G, Solórzano-Santos F, Leaños-Miranda B, Vázquez-Rosales G, Palafox-Torres M, Guiscafre-Gallardo H. Blood culture and respiratory syncytial virus identification in acute lower respiratory tract infection. Indian J Pediatr 1999;66:831-836. doi:10.1007/BF02723847.

8. Muraira GA, Villareal CE, Quiroga GA, Ábrego MV, Duran RAG, Cárdenas CBG, et al. Agentes virales en niños hospitalizados por infecciones respiratorias bajas. Rev Mex Pediatr 2002; 69;185-189.

9. Noyola DE, Rodríguez-Moreno G, Sánchez-Alvarado J, Martínez-Wagner R, Ochoa-Zavala JR. Viral etiology of lower respiratory tract infections in hospitalized children in Mexico. Pediatr Infect Dis J 2004;23:118-123.

10. World Health Organization. Acute respiratory infections (update September 2009). Respiratory syncytial virus and parainfluen-za viruses. Available at: http://www.who.int/vaccine_research/diseases/ari/en/index2.html

11. Leader S, Kohlhase K. Recent trends in severe respiratory syncytial virus (RSV) among US infants, 1997 to 2000. J Pediatr 2003;143(suppl 5):S127-S132.

12. Langley JM, Wang EE, Law BJ, Stephens D, Boucher FD, Dobson S, et al. Economic evaluation of respiratory syncytial virus infection in Canadian children: a Pediatric Investigators Collaborative Network on Infections in Canada (PICNIC) study. J Pediatr 1997;131:113-117.

13. Ehlken B, Ihorst G, Lippert B, Rohwedder A, Petersen G, Schumacher M, et al. PRIDE Study Group. Economic impact of community-acquired and nosocomial lower respiratory tract infections in young children in Germany. Eur J Pediatr 2005;164:607-615.

14. Banco Nacional de México. Tipo de cambio EUA. Tipo de cambio promedio Dólar/Euro 2005. Available at: http://www.banamex.com/esp/finanzas/historicos/economia_int/ei_eua_cambio.jsp?init=2005&offset=7

15. Miedema CJ, Kors AW, Tjon A Ten WE, Kimpen JL. Medical consumption and socioeconomic effects of infection with res-piratory syncytial virus in The Netherlands. Pediatr Infect Dis J 2001;20:160-163.

16. Díez Domingo J, Ridao López M, Úbeda Sansano I, Ballester Sanz A. [Incidence and cost of hospitalizations for bronchiolitis and respiratory syncytial virus infections in the Autonomous Community of Valencia in Spain (2001 and 2002)]. An Pediatr (Barc) 2006;65:325-330.

17. Stewart DL, Romero JR, Buysman EK, Fernandes AW, Maha-devia PJ. Total healthcare costs in the US for preterm infants with respiratory syncytial virus lower respiratory infection in the first year of life requiring medical attention. Curr Med Res Opin 2009;25:2795-2804.

18. Pelletier AJ, Mansbach JM, Camargo CA Jr. Direct medical costs of bronchiolitis hospitalizations in the United States. Pediatrics 2006;118:2418-2423.

19. Secretaría de Gobernación. Anexo Estadístico Tercer Informe de Gobierno, Felipe Calderón Hinojosa. Estadísticas Nacio-nales. México; 2009. pp. 251-270.

20. Diario Oficial de la Federación. Instituto Mexicano Seguro Social. Costos Unitarios de Atención Médica. May 18, 2010. Available at: http://dof.gob.mx/nota_detalle.php?codigo=5143097&fecha=18/05/2010

21. Instituto Mexicano del Seguro Social. Portal de Transparencia México. IMSS va a comprar. IMSS compró. January-December 2010. Available at: http://www.imss.gob.mx/transparencia/Pages/index.aspx.

22. Glick HA, Doschi JA, Sonnad SS, Polsky D. Economic Evaluation in Clinical Trials. Handbooks in Health Economic Evaluation. Great Britain: Oxford University Press; 2007. pp. 89-113.

23. Diario Oficial de la Federación. Banco de México. Tipo de cambio para solventar obligaciones denominadas en moneda extrajera pagaderas en la República Mexicana. March 24, 2011. Available at: http://www.notasfiscales.com.mx/indicadores.html


Osteopetrosis — calcification beyond the skeletal system. A case report

clinical case


Patricia Mejía Osuna,1 Jesús Santos-Guzmán,2 Luis Villela,1 Enrique Javier Cedillo-Alemán,1 and Adrián García3

AbSTRACT

background. Osteopetrosis represents a lack of apoptosis in osteoclastic activity, producing a highly calcified but fragile bone due to excess of calcium. Excess calcium deposited in the medullary compartment leads to bone expansion, producing a predominant secondary hematopoiesis accompanied by significant visceromegaly and pancytopenia. Osteopetrosis is a genetic disease with a low prevalence and incidence in Mexico. Case report. We report the case of a 12-year-old female who presented with bone pain in the lower extremities at an early age. A radiological diagnosis of ostepetrosis was made, and the condition was complicated by multiple fractures and infections. The patient was treated with dietary modifications and analgesics and was considered to be a candidate for hematopoietic stem-cell transplant. Conclusions. Osteopetrosis is a rare and complex disease without any current effective medical treatment, necessitating a multidisciplinary approach. Hematopoietic stem-cell transplantation offers a promising alternative treatment for certain cases of severe osteopetrosis.Key words: osteopetrosis, calcium, osteoclast, anemia, hematopoietic stem-cell transplant

1 Cátedra de Hematología y Cáncer, 2Cátedra de Terapia Celular, Escuela de Medicina TEC de Monterrey Instituto Tecnológico de Estudios Superiores de Monterrey (ITESM), Monterrey, Nuevo León, México

3 Traumatología de la Clínica 21, Instituto Mexicano del Seguro Social, Monterrey, Nuevo León, México

Correspondence: Dr. Jesús Santos-GuzmánCátedra de Terapia Celular, Escuela de Medicina TEC de Monterrey Instituto Tecnológico de Estudios Superiores de Monterrey (ITESM) Monterrey, Nuevo León, MéxicoE-mail: [email protected]


INTRODuCTION

Osteopetrosis (OP) or marble bone disease (also known as Albers-Schönberg disease) refers to a group of rare hereditary skeletal disorders characterized by increased bone density demonstrated by x-rays.1 It is a disease caused by poor function or poor development of the osteoclasts, resulting in a dysregulated activity of the bone resorption process, causing a variety of clinical conditions dependent on the primary type of the process. It can be classified according to three types: a) autosomal recessive malignant osteopetrosis OP (also known as classic) characterized by fractures, short stature, compressive neuropathies and

hematologic failure due to altered bone marrow develo-pment, b) intermediate autosomal recessive OP and c) autosomal dominant OP (also called Albers-Schönberg disease), which occurs most frequently in adults and with a very heterogeneous spectrum from asymptomatic to fatal (rare).2

CASE REPORT

We present the case of a 12-year-old female patient without clinically relevant prenatal, perinatal or family history. The patient’s clinical history includes pharyngitis, otitis, lower urinary tract infection, conjunctivitis, and episodes of dental caries and intestinal giardiasis, with an age- and gender-related frequency. At 3 years of age she presented with valgus. The use of orthopedic shoes was recommended by an orthopedic surgeon for lower extremity pain (no alterations reported in the distribution of bone calcium). At 6 years of age, radiological images of the long bones confirmed the diagnosis of osteopetrosis (OP) due to highly calcified bone. Subsequently, we found elevated serum phosphorus values were identified (p = 42.9 mg/dL vs. normal 0.6-12.5 mg/dL). Serum calcium has remained normal. From 7 years of age, the patient reported pain in long bones and, sometimes, in the joints, without evidence of arthritis, inflammation or deformity.


Patricia Mejía Osuna, Jesús Santos-Guzmán, Luis Villela, Enrique Javier Cedillo-Alemán and Adrián García

She did, however, demonstrate left-side rib fractures: 6th, 7th and 8th. The patient was managed with dietary calcium restriction and pain medications. Despite treatment, she presented repeated fractures, especially of the extremities. In addition, she had respiratory infections and occasional gastrointestinal infections. At 9 years of age she presented fracture and deformity of the forearm and right wrist. At 10 years of age she had only uncomplicated respiratory tract infections and at 11 years of age she had cholecystitis requiring cholecystectomy (without complications). Later in that same year, she had a traumatic fracture in the region of the right fibula, as a result of a blow from another child. Early in the next year, while wearing the plaster cast for the previous fracture, she fell and fractured the contralateral fi-bula as well as suffering a fracture of her right wrist, which healed with plaster orthosis. She later suffered from an upper respiratory infection, which resolved after 1 week. During the ages of 11 and 12 years, she had splenomegaly and pancytopenia without transfusion requirement and with only oral replacement of iron and vitamins. She has also presented frequent migraine headaches.

The growth curve is not affected by the disease. At 12 years of age, the patient’s height is 156 cm and her weight is 46.6 kg (within the 50th percentile for age). She presented uncomplicated chickenpox but, due to a severe neutrope-nia and pancytopenia, she required hospital management. The patient reported occasional dizziness and headaches. For this reason, simple skull computed axial tomography (CAT) was carried out to evaluate intracranial structures characteristic of the inner ear to rule out compressive neuropathies. We found only generalized bone sclerosis in the cranial cavity, in the skull base and in the petrous region, with increased density and thickness of the bony structures.

CAT of the inner ear also showed increased density of the staples bone at the oval window, but inner ear structures, tympanic cavity and contents were normal and unchanged compared to previous studies. Twenty-four-hour Holter ECG was performed to rule out a neurocardiogenic origin of the above symptoms. The patient is currently under-going evaluation for bone marrow transplant.

DISCuSSION

Manifestations presented by patients with OP are highly variable and directly proportional to the degree of dys-

function of osteoclasts. The classic form is manifested by bone marrow suppression, which leads to anemia, thrombocytopenia and severe infectious complications, often fatal in childhood. This, unlike the less severe forms, is demonstrated by a highly variable spectrum of clinical presentations among which include malformations and frequent fractures due to abnormal bone fragility. The present case has more consistent characteristics with the type of autosomal dominant OP because there are predo-minantly skeletal manifestations and no severe neonatal manifestations. In turn, the autosomal dominant disease is subdivided into types I and II, based mainly on the radiological pattern of the axial skeleton. Type I shows greater involvement of the cranial vault and less of the spine, unlike type II that is characterized by thickening and sclerosis of the vertebral end plates giving the appearance of “sandwich vertebra” or rugger jersey. Differences were also observed in laboratory studies (e.g., serum phosphate is lower in type I and alkaline phosphatase is higher in type II). This suggests differences in bone metabolism between the two types as well as clinical differences such as increased risk of fractures in type II.3 In this case, we relied primarily on the radiographic patterns to classi-fy as type II within the pattern of autosomal dominant osteopetrosis (Albers-Schönberg disease) (Figure 1). Orthopedic problems that occur with greater incidence in the intermediate and autosomal dominant forms include, in addition to fractures, coxa vara, varus deformation of long bones, degenerative arthritis of the knees and hips and mandibular and long bone osteomyelitis. The common sites of fracture are the long bones of the arms and legs, particularly the neck of the femur, upper third of the dia-physis of the femur and upper third of the tibia, posterior region of the ribs and the acromial process.4 According to growth charts, many children with OP measure <10th per-centile on growth charts, and some have severe dwarfism. This growth retardation may be related to a side effect of steroid therapy, but it is also a consequence of the disease itself because, when resorption is affected, the entire bone remodeling cycle changes with negative consequences on bone formation. Moreover, poor osteoclast function can cause changes in calcium homeostasis. This may manifest as symptomatic, severe hypocalcemia within the first months of life despite the high total body calcium reserves because dysfunctional osteoclasts are resistant to hormonal stimulation. Over time, these serum calcium levels return



that is clinically manifested with hepatosplenomegaly, a prominent feature on physical examination of the patient reported in this study.

All patients are also at risk of dental problems and severe tooth decay.7 Abnormalities have been identified in lymphocytes and in the production of immunoglobulins that predispose to an increased frequency and severity of various infections.8 This series of events results in deterioration in the quality of life (or end thereof) due to possible complications. Because of the complexity and low prevalence of this condition, there is currently no effective medical treatment. For this reason, manage-ment and treatment of patients with this disease should be multidisciplinary.9 This approach can be divided into two groups: symptomatic management of complications and medical management of the disease. Within the spec-trum of symptomatic management, complications such as arthritis and multiple fractures should be treated by an experienced orthopedic surgeon because of the fragility of the bone and frequent secondary complications.10 De-tection and prevention of optic nerve atrophy should be accomplished with periodic ophthalmologic evaluations including assessment with evoked potentials. Dental pro-blems are common alterations; therefore, odontological monitoring and proper dental hygiene are an integral part in patient management.11 Current medical management of the disease can be carried out as follows:

• Drug treatment and dietary restriction• Bone marrow transplantation• Gene therapy

Treatment with corticosteroids, calcium restriction and administration of calcitriol and interferon gamma are the main options for medical treatment of OP. In children with ongoing transfusion requirement, low-dose steroids may be considered to reduce their frequency because they increase the number of circulating erythrocytes and platelets.12 Patients with a calcium-restricted diet and high doses of calcitriol experience a decrease in bone density. Dietary calcium restriction creates a condition that facilita-tes the absorption of calcium and calcitriol stimulates bone resorption by activation or differentiation of osteoclasts.13 Long-term treatment with interferon-γ has been shown to increase bone resorption, hematopoiesis and leukocyte function.14 In our patient, only dietary calcium restriction has been used, which has been the most effective therapy for the above-mentioned requirements. However, based

Figure 1. Thoracoabdominal anteroposterior (AP) x-ray in standing position showing a significant increase in the density of bone structures such as the spine, rib cage and pelvis. The spine shows endplate thickening and sclerosis (classical appearance of “sandwich vertebra”). Also noted are the manifestations of the delineation presenting visceromegaly.

to normal, probably due to the action of other mediator organs for calcium homeostasis (intestine and kidney) in response to elevated levels of 1,25(OH)2-vitamin D.6 In the case reported, there were no documented serum calcium imbalances. The skull base, choanae bones and mandible are commonly affected, causing breathing to be noisy (snuffling) along with upper airway restriction. This places patients at risk for obstructive sleep apnea. In combination with anemia and restriction of movement of the chest wall, this can provide the necessary conditions for development of pulmonary hypertension, in addition to the increase of upper and lower respiratory infections, which may also contribute to respiratory failure. Manifes-tations of greater severity with potential risk to the patient’s life are mainly pancytopenia, sepsis and osteomyelitis. Bone marrow failure is caused by the accumulation of calcium, with subsequent extramedullary compensation


Patricia Mejía Osuna, Jesús Santos-Guzmán, Luis Villela, Enrique Javier Cedillo-Alemán and Adrián García

on hematological manifestations presented by the patient, alternative treatment with bisphosphonates should also be considered. These are currently used in the treatment of various disorders of bone metabolism, particularly osteogenesis imperfecta, Paget’s osteitis, adult OP and other cases of OP.15

Similarly, based on the same condition of bone marrow affection present in this case, consideration of the patient as a bone marrow transplantation candidate is warranted. This procedure has been successful in similar cases.16 The history of bone marrow transplantation as treatment for OP began with investigations by Walker, which demonstrated that murine OP can be reversed with hematopoietic stem cell transplantation (HSCT).17 Currently, HSCT is reserved for severe forms of OP (autosomal recessive OP) due to the high morbidity and mortality. Complications include rejection, delayed hematopoietic reconstruction, venous occlusive disease, pulmonary hypertension and highly calcified bone crises.18 HSCT does not alter the result in subtypes of OP associated with primary neuropathy rather than compression. These are subtypes associated with cer-tain genetic mutations (CLCN7 and OSTM1) and forms that are caused by the absence of osteoclasts rather than their malfunction.19 In cases when bone marrow transplant is warranted, pretransplant evaluation includes a large number of disease-specific studies including complete blood count, immunoglobulins, immunophenotyping of peripheral blood lymphocytes, alkaline phosphatase, lactate dehydrogenase, calcium, phosphorus, urinary and blood pH. In addition, chest, head and limb x-rays should be taken, CAT or MRI scans of the head, and detailed neurological, ophthalmological and otorhinolaryngolo-gical explorations.

Bone marrow transplantation continues to present many serious risks. A large proportion of these procedures pro-duce sequelae; therefore, transplant is reserved for severe forms of the disease, excluding some specific subtypes. The procedure requires an extensive pre-assessment in-cluding determination of genetic subtype and a careful analysis to determine if this option is appropriate and represents the ideal management for this condition.20 In autosomal dominant forms, as the heterogeneity of its manifestations, treatment is highly variable and can range from simple therapies such as dietary calcium restriction to the newer agents that have shown a positive impact on the course of the disease such as interferon-γ and innovative

gene therapy (which is still being tested) as an alternative in cases unresponsive to conventional therapies. A careful balance should always be made between the benefits and potential risks of these treatments as well as caring for and preventing the potentially significant complications of this multifaceted disease.

REFERENCES

1. Tolar J, Teitelbaum SL, Orchard PJ. Osteopetrosis. N Engl J Med 2004;351:2839-2849.

2. Del Fattore A, Cappariello A, Teti A. Genetics, pathogenesis and complications of osteopetrosis. Bone 2008;42:19-29.

3. Stoker DJ. Osteopetrosis. Semin Musculoskelet Radiol 2002;6:299-305.

4. Gupta R, Gupta N. Femoral fractures in osteopetrosis: case reports. J Trauma 2001;51:997-999.

5. Iacobini M, Migliaccio S, Roggini M, Taranta A, Werner B, Panero A, et al. Apparent cure of a newborn with malignant osteopetrosis using prednisone therapy. J Bone Miner Res 2001;16:2356-2360.

6. Hermey DC, Ireland RA, Zerwekh JE, Popoff SN. Regulation of mineral homeostasis in osteopetrotic (op) rats. Am J Physiol 1995;268(2 Pt 1):E312-E317.

7. de Baat P, Heijboer MP, de Baat C. Osteopetrosis. Classifi-cation, etiology, treatment options and implications for oral health. Ned Tijdschr Tandheelkd 2005;112:497-503.

8. Villa A, Vezzoni P, Frattini A. Osteopetroses and immuno-deficiencies in humans. Curr Opin Allergy Clin Immunol 2006;6:421-427.

9. Stark Z, Savarirayan R. Osteopetrosis. Orphanet J Rare Dis 2009;4:5.

10. Landa J, Margolis N, Di Cesare P. Orthopaedic management of the patient with osteopetrosis. J Am Acad Orthop Surg 2007;15:654-662.

11. Lam DK, Sándor GK, Holmes HI, Carmichael RP, Clokie CM. Marble bone disease: a review of osteopetrosis and its oral health implications for dentists. J Can Dent Assoc 2007;73:839-843.

12. Askmyr MK, Fasth A, Richter J. Towards a better understand-ing and new therapeutics of osteopetrosis. Br J Haematol 2008;140:597-609.

13. Key L, Carnes D, Cole S, Holtrop M, Bar-Shavit Z, Shapiro F, et al. Treatment of congenital osteopetrosis with high-dose calcitriol. N Engl J Med 1984;310:409-415.

14. Key LL Jr, Rodriguez RM, Willi SM, Wright NM, Hatcher HC, Eyre DR, et al. Long-term treatment of osteopetrosis with recombinant human interferon gamma. N Engl J Med 1995;332:1594-1599.

15. Allgrove J. Biphosphonates. Arch Dis Child 1997;76:73-75.16. Kaplan FS, August CS, Fallon MD, Dalinka M, Axel L, Haddad

JG. Successful treatment of infantile malignant osteopetro-sis by bone-marrow transplantation. J Bone Joint Surg Am 1988;70:617-623.

17. Walker DG. Control of bone resorption by hematopoietic tis-sue. The induction and reversal of congenital osteopetrosis



in mice through use of bone marrow and splenic transplants. J Exp Med 1975;142:651-663.

18. Driessen GJ, Gerritsen EJ, Fischer A, Fasth A, Hop WC, Veys P, et al. Long-term outcome of haematopoietic stem cell transplantation in autosomal recessive osteopetrosis: an EBMT report. Bone Marrow Transplant 2003;32:657-663.

19. Ballet JJ, Griscelli C, Coutris C, Milhaud G, Maroteaux P. Bone-marrow transplantation in osteopetrosis. Lancet 1977;310:1137.

20. Steward CG. Hematopoietic stem cell transplantation for osteopetrosis. Pediatr Clin North Am 2010;57:171-180.


borreliosis: recurrent fever due to spirochetes. Case report

clinical case


Norberto Sotelo Cruz1 and Pedro Valencia Mayoral2

1 Departamento de Medicina Universidad de Sonora, Hermosillo, Sonora, Mexico

2 Departamento de Patología, Hospital Infantil de México Federico Gómez, México, D.F., México

Correspondence: Dr. Norberto Sotelo CruzDepartamento de Medicina Universidad de SonoraHermosillo, Sonora, MexicoE-mail: [email protected]; [email protected]


AbSTRACT

background. Relapsing fever is a complex group of diseases caused by spirochetes of the genus Borrelia transmitted to humans by lice or ticks. The purpose of this study is to present a case of relapsing fever Case report. A 12-year-old female with no relevant clinical history was admitted with fever, headache, cervical adenitis, and thoracoabdominal exanthema. She had relapsing fever for 3 to 5 days with 15- to 21-day-intervals of apyrexia during the past 3 months. Laboratory exams were normal or negative including antibodies for Borrelia burdorferi. Peripheral blood smear showed spirochetes. She was treated with various antibiotics and finally doxycycline was added with a good response. The patient is asymptomatic and without sequelae 3 months after treatment.Conclusion. In the case we reported, relapsing fever due to spirochetemia was made during the differential diagnosis. Due to the difficulty in identification, it is important to have a clinical suspicion of this type of infection.Key words: borreliosis, spirochetemia, relapsing fever, antibiotics, doxycycline.

INTRODuCTION

Recurrent fever can be caused by various types of spiro-chetes of the genus Borrelia. Borrelia recurrentis is the only species transmitted by body lice (Pediculus humanus) without an animal vector and represents an epidemic si-tuation. There are other vectors such as soft-bodied tick Ornithodoros from rodents and other small mammals, which have an endemic behavior. On the other hand, there are about 15 species of Borrelia worldwide. Among the most common in Africa are Borrelia duttonii, B. recurren-tis, B. corcidurae and in North America, B. hermsii and B. turicatae. Infection is transmitted by the vectors indicated and is common among homeless people and refugees. In these groups epidemic outbreaks may occur. In the U.S.

and Mexico, most cases occur in persons who have been exposed to infected ticks that, after feeding on the blood of rodents, acquire the infection. They come in contact with humans while staying in recreational environments or when visiting caves infested by rodents. Soft-bodied ticks are peculiar in that they produce a painless bite that goes unnoticed. The contact of parasite with human occurs between 10 and 30 min and usually overnight. The tick transmits the infection through the saliva after feeding with blood. In contrast, body lice become infected only after feeding on blood of humans with spirochetemia. In these cases infection is transmitted when the infected lice are crushed and their fluid contaminates the bite or broken skin areas. These vectors are contagious while alive because transmission among humans does not occur.1,2

Recurring fever is characterized by sudden onset of high fever, headache, profuse sweating, severe shaking chills, muscle and joint pain, progressive weakness and deteriora-tion and may be associated with macular rash of the chest of short duration. There may also be petechiae, epistaxis, jaundice and cough. On physical examination there may be hepatosplenomegaly. In either of the two forms of in-fection, through lice or ticks, there may be complications such as hepatitis, thrombocytopenic purpura, pleuritis, pneumonitis, meningitis, myocarditis, and iridocyclitis, to name a few. In addition to the lice and their local effects on skin and scalp, they are disease transmitters. During


Borreliosis: recurrent fever due to spirochetes. Case report

pregnancy, the disease course is usually severe and results in stillbirth or neonatal infection.1-4

The organism can be grown in Barbour-Stoenner half-Kelly (BSK) media in blood or i.p. inoculation of newborn mice. Because serological tests for Borrelia are still vague, a simple and effective method is that during the febrile period a thin smear of blood or a peripheral blood smear colored with Wright, Giemsa or acridine orange stains is performed. By observation under a darkfield microscope, spirochetes can be identified.1-4

During the initial treatment it has been recommended that penicillin be administered i.m. or i.v. for 5 days as well as erythromycin, but the use of doxycycline has been more effective. In circumstances such as involvement of the nervous system, use of ceftriaxone has also been recommended. Mortality in patients who are untreated may range from 10 to 70%. In cases of recurrent fever transmitted by lice, the percentage is 4 to 40%, whereas that transmitted by the tick is between 2 and 5%.1,2

CLINICAL CASE

We present the case of a 12-year-old female from a me-dium/high socioeconomic status. The patient was a native and resident of Hermosillo, Sonora. She had no relevant perinatal hereditary familial history for the current con-dition. She had a complete immunization schedule. The clinical picture manifested beginning April 5, 2011. It was initially characterized by the appearance of sudden fever from 38.5 to 39.0°C of 5 days duration accompanied by headache, rash predominantly on the trunk and cervical adenopathy. For 3 months the patient developed recurrent fever for 3 to 5 days at intervals of 15─21 days, severe headache, photophobia, shaking chills, rash on the trunk extending to the upper abdomen, diaphoresis, weakness, and epistaxis on two separate occasions. During this period the patient had a weight loss of 3.5 kg.

On June 27 of the same year, the patient reported a new episode of fever that was accompanied by the pre-viously mentioned symptoms. Upon further questioning, the patient revealed that she participated in a camping experience during a field trip from March 28 to April 3, 2011 and stayed in a cabin during that time. Although she did not report having sustained any injury or abra-sion on the skin, 2 days later she presented with the first febrile episode.

Physical examination revealed a weight of 49.5 kg, height 1.58 m, HR 100/min, RR 18/min, temperature 38.7°C. Head was normocephalic without exostosis or cavitations. Eyes showed normal pupillary reflexes without photophobia at that time, oropharynx was normal, neck was without lymphadenopathy, normal thyroid, thorax with normal mobility, normal heart sounds and breathing, abdomen without organomegaly, examination of genitals deferred, and macular skin rash of the anterior chest and upper abdomen, which disappeared within 24 h. Extremities were within normal range of motion and sensory and neurological examination remained without change.

Blood count showed hemoglobin 12.7 g/l, leukocytes 9,600/mm3, segments 66%, lymphocytes 23%, platelets 257,000/mm3, erythrocyte sedimentation rate (ESR) of 36 mm/h, C-reactive protein (CRP) 10.6 mg/l. Urinaly-sis, glucose, urea, creatinine and serum electrolytes were normal. Antinuclear antibodies, serum immunoglobu-lin to febrile reactions, alanine aminotransferase and aspartate aminotransferase and antinuclear antibodies were negative, anti-B. burgdorferii antibodies by ELI-SA were normal or negative. Intradermal reactions to PPD (purified protein derivative) and coccidioidin were negative. Chest x-ray showed only hilar enhancement. Blood smears taken during febrile episode revealed, in addition to the normal blood elements, elongated and irregular bacteria 6 to 10 µm in length with Wright’s stain (Figure 1). One of the slides was stained with silver stain (Warthin-Starry) and also revealed organisms consistent with spirochetes (Figure 2).

During the disease period, the patient was assessed by the medical practitioner who considered the episodes as a result of viral disease. She was treated with general measures and antipyretics. Upon reevaluation, clinical his-tory was reassessed and a blood smear was taken. Results were positive for spirochetemia. On June 30, 2011 it was decided to initiate treatment with erythromycin at doses of 40 mg/kg/day, which was suspended on July 12, 2011. Treatment was initiated with procaine penicillin i.m. for 5 days followed by 5 days of oral potassium penicillin, with the patient showing improvement. However, on July 30 the previous symptoms recurred with headache and fever of 39–40°C, profuse sweating, myalgia, arthralgia and weakness. The patient also complained of nasal obstruction and was admitted for treatment.


Norberto Sotelo Cruz and Pedro Valencia Mayoral

ped a fever that spiked to 39.5°C, headache, and diffuse chest rash that disappeared 30 min later. This episode was also accompanied by tachycardia, diffuse sweating, and hypotension (65/40 mm/Hg). The patient was treated with acetaminophen (500 mg IV) and a physiological glucose solution at 1:1 dilution. Temperature decreased to 34.5°C; however, the following 3 h of evolution showed improvement. This event was considered compatible with a Jarisch-Herxheimer reaction.

On the same day the patient was admitted to the hospital and received a dose of oral doxycycline (100 mg) calcu-lated at 200 mg/day in a split dose of 100 mg/12 h. It was decided to continue with this drug. On the fourth day of evolution, the fever subsided, and penicillin and ceftriaxone were suspended after completing 5 days of treatment. The patient continued with doxycycline only, showing a marked improvement and she remained hospitalized for 8 days. Laboratory studies were done including blood count, pla-telet count, urinalysis, liver function tests, urea, creatinine, serum electrolytes and procalcitonin, and all were within the normal range. Changes were found only in the ESR with reports of 22 mm/h corrected and with elevation of CRP to 10.46 mg/l. These parameters were normalized at the end of hospitalization. She was discharged on the eighth day, and on the tenth day all medications were discontinued. A new peripheral blood smear taken 8 days after the discontinua-tion of doxycycline was negative for spirochetemia. At 45 days of discharge from the hospital, the patient remained asymptomatic and had regained 2.5 kg of body weight.

DISCuSSION

The genus Borrelia consists of two main groups: the first is Lyme disease. Lyme disease is known as relapsing fever, which corresponds to the second group and is a disease that is diagnosed infrequently in our environment.1 The main characteristic of this condition is the presence of re-current fever of 39.5 to 40°C of sudden onset, accompanied by headache, profuse sweating, severe chills, epistaxis, muscle and joint pain, progressive weakness and malaise. Macular rash may also occur in the chest of short duration. These signs and symptoms that characterize the clinical picture are consistent with those exhibited by the patient described in this report.

Relapsing fever caused by spirochetes of the genus Borrelia may be caused by different types of Borrelia and

Figure 2. Silver stain showing bacteria in the blood smear (arrow).

Figure 1. Wright stain showing bacteria in the blood smear (arrow).

At the time of admission a sinus x-ray was ordered and revealed moderate opacity of both maxillary antrum. Treatment was started with i.v. crystalline penicillin G (5,000,000 U) every 6 h and ceftriaxone 1 g/24 h. Two hours after application of penicillin, the patient develo-


Borreliosis: recurrent fever due to spirochetes. Case report

may vary by geographic regions. B. recurrentis has been identified in the Congo, Tanzania and Ethiopia, B. duttoni in Mauritania and West Africa, B. crocidurae, in the U.S. B. hermsii, B. turicatae and B. parkeri, and in Spain, B. hispanica. Other types of Borrelia are B. gallinarum, B. lonestari, B. johnsonii, B. texasensis, B. caucasica, B. persica and B. latyschewii.2,3,5,6

Currently, diagnosis using serological methods is difficult, even in specialized laboratories. Nevertheless, new options have been proposed to conserve and identify antigens for early serological diagnosis.6 Laboratories, in general, can process samples and detect antibodies by enzyme immunoassay or immunoblotting (Western blot). The problem arises because these tests are not standar-dized and can be altered by variations among species and give positive reactions in cases of syphilis infections and leptospirosis. Cultures can be done in blood cultures in Barbour-Stoenner-Kelly media or i.p. inoculation in newborn mice.1 There are other diagnostic methods such as real-time PCR reaction (polymerase chain reaction), phylogenetic classification through multilocus sequential analysis for species identification, and DNA hybridiza-tion analysis, which is only available to communities with groups of investigators interested in studying these agentes.3,5-7 In Mexico most clinical laboratories and their reference links perform tests for B. burgdorferii for Lyme disease.8 This test may also provide cross-reactivity and positivity for other varieties. To date, it is not possible in our region to have blood screening for those species of Borrelia related with relapsing fever and its correct identification. One can send blood samples for analysis to national reference centers in other countries and to the Centers for Disease Control and Prevention in the U.S.1

The results of staining of the smears showed the pre-sence of spirochetes in the present case. Silver staining also allows histological confirmation in various tissues of patients who died, especially those receiving no treatment. Myocarditis, liver damage and bleeding in various organs are usually the causes of death. The spleen is the organ where the microorganisms are more numerous and form true abscesses.1-3

Currently, there are several groups that develop classi-fication studies of Borrelia and the relative implications for the control in endemic areas and those with greater possibilities of endemic outbreaks, as well as of diagnostic serological procedures that are more accessible and offer

greater certainty.2,3,5-7 In this case, diagnosis of spirochete-mia was done because of the suspicion due to the history of an excursion by the patient to a rural cabin, which they occupied for certain months of the year and where control of vermin is ignored, as well as the coincidence of the start of the symptomatic recurrent fever immediately after the stay in that cabin.9 There was no confirmed history of a bite because usually the event of contact is almost always overlooked when it comes to soft tick bites by rodents. On the other hand, we know that there was no other case recor-ded in the group of hikers, making it difficult to consider that this patient was a case representative of belonging to an endemic outbreak.

The negativity of the test for Lyme disease and the inability of reference laboratories to process serologic tests for other species of Borrelia left only the possibility of a skin biopsy for culture and histopathology, but the rash was short lived, and it was not possible to perform the skin biopsy. Therefore, we performed the peripheral smear for detecting spirochetes microscopically. This allowed their identification and the subsequent provision of targeted therapy.

Other arguments to be taken into consideration in that it was recurrent fever caused by spirochetes possibly transmitted by rat ticks is the fact that in neighboring U.S. regions to our Mexican state (Arizona and Texas) identified cases of Lyme disease have been identified, transmitted by such arthropods.3,4,10 On the other hand, it is known that the louse-borne relapsing fever sometimes disappears with single doses of antibiotics such as tetracycline and penicillin,1 but the tick-borne variety requires a minimum 5-day cycle and it is not uncommon as in the adolescent and that there may be recurrences despite the use of peni-cillin and erythromycin, especially in adult patients. It has been reported that the response to penicillins tends to be higher in preschool and school-age children. Antibiotics initially chosen for this teenager, erythromycin and peni-cillin, did not control the disease process. This confirms that adequate treatment of choice should be doxycycline.1,2

In complicated cases with meningeal forms, use of i.v. ceftriaxone or penicillin for at least 14 days is recom-mended. Mortality due to relapsing fever ranges from 4 to 40%, which is produced by lice and 2-5% in the tick-produced, but generally, in the condition treated it is <5%.2 The literature has described reactions induced by proin-flammatory cytokines, tumor necrosis factor alpha


Norberto Sotelo Cruz and Pedro Valencia Mayoral

(TNF-α), interleukins (IL-6 and IL-8) with the use of intramuscular and intravenous antibiotics. In this case there was a Jarisch-Herxheimer reaction that did not cause a more serious manifestation and was controlled without complications, although this reaction tends to be less ag-gressive in children and adolescents than in adults.1,2,11 The treatment of choice currently recommended is doxycycline (100–200 mg/day depending on age) for a period of 10 days. The fever usually disappears around the fifth day of administration of this drug as with the patient presented her who, 2 1/2 months later was still asymptomatic.2

REFERENCES

1. Pickering LK, Baker CJ, Kimberlin DW, Long SS. Borrelia, infecciones (fiebre recurrente). In: Pickering LK, Baker CJ, Kimberlin DW, Long SS, eds. Red Book: Enfermedades Infec-ciosas en Pediatría. Argentina: Editorial Médica Panamericana; 2011. pp. 233−235.

2. Escudero-Nieto R, Guerrero-Espejo D. Enfermedades produci-das por Borrelia. Enferm Infecc Microbiol Clin 2005;23:232−240.

3. Cutler SJ. Relapsing fever—a forgotten disease revealed. J Appl Microbiol 2010;108:1115–1122.

4. Brouqui P, Raoult D. Arthropod-borne diseases in homeless. Ann NY Acad Sci 2006;1078:223–235.

5. Cutler SJ, Bonilla M, Singh R. Population structure of East African relapsing fever Borrelia spp. Emerg Infect Dis 2010;16:1076–1080.

6. López JB, Porcella SF, Schrumpf ME, Raffel SJ, Hammer CH, Zhao M, et al. Identification of conserved antigens for early serodiagnosis of relapsing fever Borrelia. Microbiology 2009;155:2641–2651.

7. Toledo A, Anda P, Escudero R, Larsson C, Bergstrom S, Be-nach JL. Phylogenetic analysis of a virulent Borrelia species isolated from patients from with relapsing fever. J Clin Micorbiol 2010;48:2484–2489.

8. Gordillo-Pérez MG, Solórzano-Santos F. Enfermedad de Lyme. Experiencia en niños mexicanos. Bol Med Hosp Infant Mex 2010;67:164–176.

9. Boyer KM, Munford RS, Maupin GO, Pattison CP, Fox MD, Barnes AM, et al. Tick-borne relapsing fever: an interstate outbreak originating at Grand Canyon National Park. Am J Epidemiol 1977;105:469–479.

10. Whitney MS, Schwan TG, Sultemeier KB, McDonald PS, Bill-hart MN. Spirochetemia caused by Borrelia turicatae infection in 3 dogs in Texas. Vet Clin Pathol 2007;36:212–216.

11. Cooper PJ, Fekade D, Remick DG, Grint P, Wherry J, Grif-fin GE. Recombinant human interleukin-10 fails to alter proinflammatory cytokine production or physiologic changes associated with the Jarisch-Herxheimer reaction. J Infect Dis 2000;181:203–209.


Systemic lupus erythematosus and antiphospholipid antibody syndrome in an adolescent patient

clinicopathological case


María del Rocío Maldonado Velázquez,1 Sandra Enciso Peláez,1 María Argelia Escobar,2 Rosa Delia Delgado Hernández,3 and Gisela Abigail Monroy Prado4

1 Servicio de Reumatología,2 Departamento de Patología,3 Departamento de Radiología,4 Departamento de Dermatología, Hospital Infantil de México Federico Gómez, México, D.F.,

México

Correspondence: Dra. María Argelia EscobarDepartamento de PatologíaHospital Infantil de México Federico Gómez

México, D.F., MéxicoE-mail: [email protected]

Received for publication 2-2-12Accepted for publication: 3-29-12

CLINICOPATHOLOGICAL SESSION A-10-52

SummaryWe present the case of a 14-year-old female who arrived at the Outpatient Service with headache and vomiting.

Family History The patient’s mother is a healthy, 42-year-old, uneducated female who l ives wi th a par tner employed as an independent laborer. No addictions are admitted. The patient’s biological father is dead due to an unknown cause. There were seven siblings: five are alive and healthy and two died due to unknown causes.

Nonpathological HistoryThe patient and her family are natives of the state of Oaxa-ca, Mexico and currently reside in the State of Mexico. Their home has electricity and water, and no animals live in the home. The patient adhered to the family diet, which may have been deficient in quality and quantity due to economic considerations. The patient’s psychomotor development was appropriate for her age, and she was without education. Immunization schedule is unknown.

Perinatal and Pathological HistoryThe mother was unable to recall perinatal details. There was no patient history of transfusion surgery or trauma. The patient was seen by her physician for 2 months due to her condition with arthralgias, myalgias, fatigue, weakness and decreased appetite. Treatment was not specified. The patient arrived at a second-level hospital due to chest pain, fever and productive cough of 2 weeks duration. Chest x-ray demonstrated basal radiopacity and slight effacement of the left costophrenic angle. Pleural fluid and scarce pericardial fluid were demonstrated on chest computed tomography (CT). Drainage was performed and yielded 740 mL of serous fluid. Normocytic-normochromic anemia was found along with impaired renal function.

Current Condition There was a 12-h history of sudden onset with progressive, sharp, holocraneal headache with 6/10 intensity progres-sing to 9/10 and vomiting five times. Gastric contents were abundant and preceeded by nausea and dry retching.

Previous treatment included prednisone (60 mg/m2 SC/day), captopril (1 mg/kg/dose), furosemide (2 mg/kg/day), hydroxychloroquine (4.5 mg/kg/day), omeprazole (1 mg/kg/day), azathioprine (2.3 mg/kg/day). During physical examination the following were found: 42.5 kg weight, 145 cm height, heart rate (HR) 167/min, respiratory rate (RR) 28/min, blood pressure (BP) 130/85 mmHg, temperature 39°C, 3-sec capillary refill, and Glasgow score 14/15. The patient was a female adolescent who was appeared to be chronologically age appropriate. She was pale, hypoac-tive, uncooperative, well-hydrated and with Cushing’s facies. Head was normocephalic without cavitations or exostosis. Fundus was not classified due to lack of coope-ration. Ears showed an abundance of waxy substance and pharynx was hyperemic. Chest demonstrated appropriate


María del Rocío Maldonado Velázquez, Sandra Enciso Peláez, María Argelia Escobar, Rosa Delia Delgado Hernández and Gisela Abigail Monroy Prado

respiratory movements and decreased vocal fremitus in the basal region of the right hemithorax. There was dull-ness to percussion with right basal hypoventilation. Left hemithorax was unchanged. Rhythmic heart sounds were appropriate in intensity and frequency without aggrega-tion. Abdomen was without alterations. Genitalia were Tanner stage III. Limbs showed strength and sensitivity. There was hyperreflexia, bilateral Babinski, voluntary neck stiffness and Kernig and Brudzinski signs were negative.

Laboratory and Imaging studiesLaboratory and imaging studies were conducted during admission (Table 1).

Chest X-ray Chest x-ray demonstrated radiopacity with effacement of the right basal costophrenic and cardiophrenic angles.

management The patient was managed according to the following: fasting, 1200 mL/m2 SC/day base solutions, glucose/sodium and po-tassium (2:1), 30 mEq/m2 SC/day, furosemide 2 mg/kg/dose every 12 h, paracetamol 15 mg/kg/dose PRN, omeprazole 0.5 mg/kg/dose/24 h, captopril 1.1 mg/kg/dose/24 h, losartan 1.1 mg/kg/dose/24 h, ceftriaxone 75 mg/kg/day/8 h, amikacin 15 mg/kg/day/24 h, hydrocortisone 180 mg/m2 SC/day/8 h.

The patient presented a generalized one-time tonic-clonic seizure. CT of the skull revealed corticosubcortical atrophy, adequate differentiation of gray and white matter, general reduction of the caliber of the vasculature, and discrete bea-ding of the left middle cerebral artery. Due to neurological impairment, we performed endotracheal intubation and lumbar puncture with 30 mmHg opening pressure (Table 2).

August 14, 2010Rheumatology Intravenous gammaglobulin (IVIG) was initiated (2 g/kg/dose infusion treatment) with trimethoprim-sulfamethoxa-zole (TSX) (150 mg/m2 SC/day).

Infectious Disease DepartmentCoverage was expanded with ceftriaxone (100 mg/kg/day/12 h), vancomycin (60 mg/kg/day), and ampicillin (300 mg/kg/day). Blood pressure was 76/40 mmHg. Norepinephrine was started (0.1 mg/kg/min). The patient was admitted to the pediatric intensive care unit (PICU).

August 20, 2010 magnetic Resonance Angiography (mRA) MRA showed probable hemorrhagic cerebral infarct in the territory of the posterior cerebral artery (PCA), bila-teral occipital cerebral ischemia with enhancement due

Table 1. Laboratory and clinical studies upon admission

Hb Hct Leuc Ban Seg Lymphocytes Platelets MCV HCM MCHC ESR Gluc BUN

9.6 g/dayL 28.3% 16,000/mm3 1% 80% 13% 296,000 94.2 fL 32 pg 34 g/dL 24 mm/h 101 mg/dayL 34 mg/day/L

Hb, hemoglobin; Hct, hematocrit; Leuc, leucocytes; Ban, bands; MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration; ESR, erythrocyte sedimentation rate; Glu, glucose; BUN, blood urea nitrogen.

Creat Uric acid Na K Cl Ca P DB TB GTO

1.5 mg/dL 10.6 mg/dL 139 mEq/L 4.7 mEq/L 101 mEq/L 8.4 mg/dL 1.7 mg/dL 0.06 mg/dL 0.32 mg/dL 18 U

Creat: creatinine; DB, direct bilirubin; TB, total bilirubin; GTO, glutamate transaminase oxalate.

TGP AP LDH GGT Alb Procalcitonin Urinary prot (12 h) Schwartz creatine clearance

34 U 120 U 328 U 30 U 3.4 g/dL 98.36 ng/mL 101.7 mg/m2 SC/h 49.8 mL/m2 SC/min

TGP, glutamic-pyruvic transaminase; AP, alkaline phosphatase; LDH, lactate dehydrogenase; GGT, gamma glutamyl transpeptidase; Alb, albumin.

C3 C4 EGO pH DU Alb Hb Erythrocytes Leukocytes Cylinders

39 mg/dL 10.4 mg/dL 5 1,022 + +++ 3,200/mm3 600/mm3 Granulated and hematic

UA, urinalysis; UD, urinary density.



to probable hypoperfusion, and bilateral middle cerebral artery vasculitis.

Rheumatology Initiation of low molecular weight heparin (LMWH) was suggested (1 mg/kg/day/12 h).

August 26, 2010Thoracic Surgery and Endoscopy Gastrostomy and tracheostomy performed due to neurologi-cal damage and prolonged intubation without complications.

EEGSevere generalized dysfunction was demonstrated.

NeurologyPatient demonstrated respiratory automatism, spontaneous eye opening, 3-mm reactive pupils, indifference to the envi-ronment, low spontaneous mobility of upper extremities, and loss of flexor and extensor tone of lower extremities. Time required for determining vegetative state was not determined.

August 31, 2010Laboratory results showed hemoglobin 6.6 g/dL and he-matocrit 18.4%. Erythrocyte concentrate was transfused. The patient presented ventilator impairment due to decan-nulation. T-tube had to be changed to phase III ventilation with placement of cannula tracheostomy.

Rheumatology Lupus activity was determined as a likely diagnosis. Pulsed doses (3) of methylprednisolone (30 mg/kg/bolus) and later hydrocortisone (40 mg/m2 SC/day) were indicated.

Infectious Diseases Invasive forms were demonstrated in urine with yeast and pseudomycelia. Treatment was initiated with caspofungin (70 mg/kg/day) and 50 mg/kg/day for maintenance.

Urine culture: Candida albicans. Galactomannans: negative.Immunofluorescence of bronchial secretion: Pneumo-cystis jirovecci.

September 8, 2010Ventilatory impairment increased ventilator settings (Table 3). Chest x-ray showed bilateral infiltration with efface-ment of the basal right costophrenic angle. Thoracentesis was performed and yielded 15 mL of serosanguineous fluid; 50% leakage was demonstrated by tracheostomy tube. Endotracheal intubation was performed.

September 9, 2010Ethics CommitteeNeurological state was reported with no improvement, no eye opening, and no interaction with the environment.

EEG Severe generalized dysfunction was demonstrated for 5 days to meet criteria for vegetative state. The patient was transferred from the PICU to the medical floor where it was agreed to provide palliative care and counseling and thanatology and to avoid aggressive treatment.

September 10, 2010 The patient was sent to the Department of Internal Medicine.

Table 3. Gasometry (August 9, 2010)

pH pO2 pCO2 CO2T HCO3 SaO2 FiO2 Anion GAP

7.36 39.0 mmHg 30.5 mmHg 16.6 mEq/L 16.9 mmol/L 77.3% 21% 19.6 mEq/L

Table 2. Results of lumbar puncture

CSF Color Prot Gluc Leuc PMN MN Gram Tincture

Turbid Xanthochromia 350 mg/dL 9 mg/dL 248/mm3 81% 19% Neg Neg

CSF, cerebrospinal fluid; PMN, polymorphonuclear leukocytes; MN, mononuclear leukocytes.



Pain medicine Buprenorphine (3 mg/kg/dose) and midazolam (4 mg/kg/min) infusion were administered. The patient presented hypotension even without antihypertensive treatment, and bleeding from puncture sites, microscopic hematu-ria, bleeding as a result of cannula and melena stools. Enoxaparin was discontinued. HR was 77/min, RR was 24/min, BP 52/20 mmHg, temperature 35.5°C, and 3-sec capillary refill.

September 13, 2010 (18:50 h)The patient was unresponsive to stimuli. There was absen-ce of respiratory effort, heart rate and pulse, and tracings of isoelectric cardiac activity.

CASE REPORT

Case Presentation (Dr. Rocio maldonado)The case presented today is of a 14-year-old female from a very low socioeconomic and cultural environment. Becau-se these factors played an important role in the evolution of the patient’s disease, it is important to discuss these. We requested comments from the Department of Social Work.

Social Work Review (ms. Nelly moreno) This is a female who is 14 years, 3 months of age born in Oaxaca, Mexico and residing in the State of Mexico in a reorganized home. The biological father is deceased and the mother lives with a partner and admits to physical abuse and is responsible for family support along with two additional children. The partner is an assistant bricklayer with a minimum wage. The family has no support network and lives in a crowded environment. There is a sister in detention for manslaughter. The mother has a passive atti-tude regarding her daughter’s treatment. The couple does not contribute financially to cover medical care. Support was provided to accompany the family and support for medications and food was provided and carried out through coordinated efforts.

Radiology (Dr. Rosa Delia Delgado Hernandez)The patient had a simple phase contrast scan during the first admission of June 29, 2010, showing accentuation of the frontal-parietal subarachnoid spaces and bleeding data. In contrast phase there is rectification of the middle cerebral vessel, which could correspond to the inflam-

matory process. On chest x-ray there is costophrenic angle effacement in relation to the presence of pleural fluid, cardiac silhouette enlargement, increased pulmonary vascular resistance, cephalization of flow, and diffuse interstitial pattern in relation to lung disease of multiple etiologies. There is elevation of diaphragm associated with hepatomegaly. Kidney size was normal on renal ultrasound. There was loss of corticomedullary ratio with inflammatory changes related to immune pathology. Regarding the patient’s second follow-up on August 14, 2010, chest x-ray was done and showed elevated hemi-diaphragm with effacement and loss of corticomedullary ratio. At low liquid interface, there was hepatomegaly and thickening of the interstitium.

Chest x-ray done on August 20 shows continuation of interstitial increase and there is a cannula, a catheter and breast shadows. Simple x-ray of the skull demonstrates no bleeding or bruising. The presence of an area of parietal ischemia is demonstrated, probably cortical necrosis, loss of interface, thinning of the vessels, and profound inflammation due to probable vasculitis in large and medium vessels. Chest x-ray shows interstitial infiltrate of multiple etiologies due to distress. From the center to the periphery, there is a radiopaque area in the right lower lobe of multiple etiologies, hyperperfused areas, generalized radiopacity of the left side and cardiomegaly.

Rheumatology Review (Dr. Sandra Enciso Pelaez, Re-sident Physician) The patient is an adolescent female with low height for her age although the average family height is unknown so this is not considered pathological. The patient had a BMI of 17.8, (between the 10th and 25th percentiles), indicating a normal weight for height. She was from a low socioeco-nomic and cultural status and without education in a dysfunctional family. Her immunization status is unknown. The patient was first seen in the outpatient rheumatology clinic during March 2010. Systemic lupus erythematosus (SLE) was suspected. Additional studies were requested and she was to return after 3 days for reassessment but did not attend the appointment. There was a history of previous hospitalization in a second-level hospital 5 weeks afterward for hypertension and probable seizures. She was referred to this institution to meet the criteria for classification according to the American College of Rheu-matology for SLE as follows: 1) renal—nephrotic range



• Nephrotic syndrome—characterized by hyperten-sion (95th percentile for age) and urinalysis with hematuria and microhematuria and nephrotic range proteinuria

• Renal failure syndrome—according to glomerular filtration rate of 49.8 mL/m2 SCD, increased crea-tinine and hyperuricemia without nitrogenous reten-tion

• Social deprivation syndrome—living in an environ-ment of severe and chronic poverty, familiar illite-racy, lack of commitment and responsibility of the adult responsible for the patient reflected by the poor adherence to drug treatment and lack of follow-up (defined by the Academy American Academy of Pe-diatrics, April 2010)

By integrating syndromatic diagnoses, the following no-sological diagnoses were made:

• Infectious encephalitis—based on an acute fever, headache, nausea and vomiting, brain syndrome, cranial hypertension syndrome rapidly progressing to seizures and impairment of consciousness requi-ring airway protection with endotracheal intubation

According to laboratory examinations, evidence of leukocytosis was found due to targeted, high ESR and high PCT levels. Lumbar puncture showed an opening pressure of 30 mmHg. Cytochemical analysis showed elevated protein levels, hypoglycorrhachia, and leukocytosis due to polymorphonuclear cells. There was unstained gram, India ink was negative, and cultures were negative for tuberculosis. No isolation was found in CSF. Angiotomo-graphy of the skull showed a generalized decrease of the blood vessel caliber and beading of the middle cerebral artery. It is well documented that in patients with immu-nocompromised status and altered state of consciousness, neuroimaging should be performed prior to CSF sample collection.2 This was appropriately done with our patient. Moreover, based on an infectious syndrome and systemic inflammatory response data, we performed the sepsis diagnosis, focusing on the CNS level. It is striking that isolation did not appear in the CSF culture, but rather only in the blood culture isolating Listeria monocytogenes. It is important to remember that, when a patient demonstra-tes sepsis and neuroinfection, antibiotic treatment should be initiated. In the case presented, treatment was escalated after obtaining cytochemical stains and meningeal dose of ampicillin was retained to cover L. monocytogenes.

proteinuria, 2) serositis—history of pleural effusion and pleural effusion requiring drainage, 3) arthritis—knees, ankles, 4) immune—anti-DNA positive at very high titers, 5) positive antinuclear antibodies—homogeneous pattern by indirect immunofluorescence to higher titers.1 The patient also presented hypergammaglobulinemia owing to IgG and hypocomplementemia. She also had disease activity characterized by pleural effusion and lupus ne-phritis. Staging was achieved by means of renal biopsy as glomerulonephritis (GMN) class IV according to the WHO. She was treated with gamma globulin, boluses of methylprednisolone (MPN) and the first bolus of cyclo-phosphamide but then did not attend follow-up. On August 13, 2010 she was to receive the second bolus, which was deferred. The patient was admitted 24 h later. Based on the findings reported in the clinical file, the following syndromes were identified:• Emetic syndrome—12 h duration accompanied by

nausea and dry retching• Infectious syndrome—fever documented upon arri-

val to the emergency room that may be secondary to an infectious process or activity due to the un-derlying disease; laboratory results showed leuko-cytosis, elevated ESR and procalcitonin (PCT)

• Brain syndrome—due to alteration of consciousness, headache, and seizure activity

• Upper motor neuron syndrome (UMNS)—based on hyperreflexia, Babinski and, although not documen-ted on physical examination, hypertonia as expected

• Seizure syndrome—due to the presence of tonic–clo-nic seizures

• Intracranial hypertension syndrome—patient with headache, vomiting, and deterioration of neurological status and, although fundus examination was not des-cribed in the clinical file, papilledema as expected

• Systemic inflammatory response—based on fever, leu-kocytosis, tachycardia, and respiratory rate (the last two >2 standard deviations from that expected for age)

• Incomplete pleural effusion syndrome—documen-ted by reduced vocal vibrations and dullness to percussion; chest x-ray showing effacement of the costophrenic and right costodiaphragmatic angles; syndrome strictly characterized by dullness to per-cussion and decreased respiratory movements

• Anemic syndrome—documented by pallor and nor-mocytic normochromic tachycardia



SLE Activity1. Serositis—characterized by pleural effusion. This is

the most common pulmonary manifestation in pa-tients with SLE. Within the range of activity of SLE, patient was given a score of 2.

2. Anemic syndrome—although not having a prior determination of hemoglobin for comparison and showing decreases in hematocrit, hemolysis is sus-pected according to the disease. Coombs test and reticulocytes were not corrected. This possibility is very low because the bilirubin and lactate dehydro-genase are within normal ranges. Anemia, which is frequently associated with SLE in as many as 50% of patients, is normochromic normocytic type and is associated with chronic inflammation. It is no-teworthy that, in the context of our patient with renal insufficiency, the half-life of erythrocytes is lower, and there may be deficiencies in the production and inhibition of peripheral activity of erythropoietin.

3. Class IV lupus nephritis—characterized by a diffu-se endo-extracapillary proliferative glomerulone-phritis, global sclerosis, and cellular crescents with IA 12/24 IC 6/12. Renal ultrasound was normal, which prompts us to assume that the evolution of renal involvement is relatively recent, accompanied by glomerular filtration rate of 49.8 mL/m2 SCD. Progression of proteinuria was present with active urinary sediment despite having received prior ma-nagement with MPN and cyclophosphamide. The patient also presented hypertension despite being administered a triple antihypertensive scheme. The patient also had poor prognostic factors for ne-phritis with high titers of anti-DNA and IC >3 on biopsy. There was a delay and neglect in treatment and creatinine was elevated.

4. Likely neurolupus—due to cognitive deficits, the pre-sence of antinuclear antibodies with homogeneous cytoplasmic staining according to immunofluores-cence suggests the presence of ribosomal P antibody neurolupus. Angiography showed narrowing of the vasculature and beading of the left middle cerebral artery, which according to the MRA evolved to vas-culitis of bilateral middle cerebral artery with evi-dence of ischemic infarction with hemorrhagic trans-formation at the level of the posterior circulation. The European League of Rheumatological Diseases

(EULAR) published recommendations for the mana-gement of neuropsychiatric lupus in August 2010,3 establishing that nervous system involvement occurs in 50–60% of patients during the first year of SLE diagnosis where risk factors are present for the deve-lopment of disease activity at any level as well as the presence of antiphospholipid antibodies to medium-high titers. Upon introducing an ischemic event as a manifestation of neurolupus, the recommendation is to administer boluses of cyclophosphamide and high doses of glucocorticoids with a 3D level of eviden-ce. Within the neurolupus pathophysiology, vascular abnormalities are included because small vessels are affected more often and endothelial cells are activa-ted by autoantibodies. This causes disruption of the integrity of the blood brain barrier and intrathecal production of inflammatory mediators such as IL-6, interferon-α and TNF.

5. It is reported that the likelihood triples of developing a secondary antiphospholipid syndrome in a patient with active lupus in the presence of antiβ2GP1, an-ticardiolipin and lupus anticoagulant. This happe-ned with our patient according to the Sapporo cri-teria of 1996:4 presence of high titers of IgM β2GPI and positive lupus anticoagulant and evidence of myocardial ischemia in the course of the posterior cerebral artery accompanied by thrombocytopenia and abrupt decline in hematocrit and in the arterial vascular nervous system. As suggested, enoxaparin should be initiated at therapeutic doses. The patient had a diagnosis of SLE from the time of her first admission to the second-level hospital. With lupus activity data, she received glucocorticoid mana-gement, but monitoring was not continued. After 5 weeks the patient was readmitted with Cushing facies, reflecting that this manifestation took about 4 weeks with high-dose prednisone. However, she already had deterioration of filtration rate and lupus activity characterized by serositis. She presented a foci of infection in the lungs. She was classified as a hypertensive emergency, but the management re-ceived was unknown. It must be kept in mind that if a patient has hypertension according to the Task Force with systolic and/or diastolic pressure >95th percentile along with further evidence of target or-gan damage, a hypertensive emergency should be



suspected. The therapeutic goal is to prevent dama-ge to target organs. BP should be reduced by 20-25% in periods of 15 min to 3 h. A rapid reduction should not be accomplished due to further damage to target organs. Management should include main-tenance and antihypertensive loop diuretics. It was decided to start pulses of methylprednisolone (30 mg/kg/day), which are indicated in cases of severe compromise. The aim is to achieve an immediate anti-inflammatory effect, minimizing the toxicity related to prolonged use of steroids and achieving clinical improvement in a short time. An azathio-prine-based immunosuppressant was also used, a purine analog, with the aim of suppressing cellular immunity and inhibition of monocyte function. Im-munosuppressive effects are achieved by inhibiting the growth of T cells in the S phase of the cell cycle. Hydroxychloroquine, an antimalarial that inhibits the synthesis of DNA and RNA, also interferes with antigen processing and modulates the response cau-sed by the antigen-antibody complex, acting as an antioxidant, inhibiting phospholipase activity and chemotaxis. The first i.v. bolus of cyclophosphami-de was administered due to nephritis. The patient was discharged. The patient was admitted 5 weeks later in poor general health with fever, inflammatory response and neurological impairment, with pro-longed capillary refilling, and slightly hypertensi-ve, complicating goal-guided resuscitation therapy guided because there was no baseline number for hypertension in the context of what was known: hypertension and antihypertensive triple scheme. The characteristics of the pulses are not described and we do not have the results of gasometry that may indicate if there is any metabolic impact. Base solutions remain below the calculated requirements for metabolized calories with electrolyte supply as a requirement. The patient may have been a candi-date for initiating high hypertonic solutions due to the possibility of cerebral edema and head position at 45 degrees, euthermia and euvolemia to ensure cerebral perfusion pressure. Hydrocortisone was allowed at the equivalence of glucocorticoid mana-gement in order to avoid adrenal suppression. Gam-ma globulin was administered in light of a patient with lupus activity accompanied by neuroinfection.

IVIG was again administered (2 g/kg/day). Use of gamma globulin is well documented in patients with autoim-munity in the presence of disease and disease activity. It is useful to treat both conditions due to the following features:1. IgG infused molecules bind to the FC receptor of the

target cells, blocking their access and preventing au-toantibodies from binding to these cells.

2. IgG acts as an immunomodulator by binding to the Fc receptor of B and T lymphocytes, inhibiting the synthesis of B cells, regulating T-helper cells and co-stimulating phagocytosis.

3. IgG can function as an anti-idiotype antibody, sup-pressing B lymphocytes and inhibiting production of pathogenic autoantibodies.

4. IgG also acts as an anti-inflammatory by regulating the low production of cytokines and proinflammatory mediators in monocytes and macrophages and IL-1 antagonists, altering the solubility of immune com-plexes in autoimmune diseases and covalently bin-ding of complement by its activation. On the other hand, it prevents binding to endothelial cells.

The patient later evolved to septic shock, requiring vasopressor support. She was admitted to the PICU with torpid evolution plus antiphospholipid antibody syndrome (APAS). In the registry of pediatric patients with pediatric antiphospholipid syndrome, it has been estimated that 50% of patients present with another autoimmune-based disease. Of this group of patients, the underlying disease is lupus in 85% of cases. In patients with SLE and clinical manifestations such as seizures, transient ischemic events, stroke, chorea, proteinuria, skin necrotizing lesions, livedo reticularis, Raynaud syndrome, hemolytic anemia, throm-bocytopenia, and difficult to control hypertension, the presence of a secondary APAS must be excluded. A meta-analysis of pediatric patients with SLE that investigated the prevalence of antiphospholipid antibodies described a prevalence of 44% for anticardiolipin antibody (aCL), 40% for β2GPI and 22% for lupus anticoagulant (LA).5

Certain factors are considered in patients with SLE that act as a trigger in the presence of antiphospholipid antibo-dies to develop the disease. This is because this behavior does not occur in other autoimmune diseases with high titers of antiphospholipid antibodies. The specificity is higher for IgG aCL at high titers, but the association of the presence of β2GPI IgG or IgM to high titers and thrombotic events in lupus patients has been documented. Positive



lupus anticoagulant is seen as the major acquired risk factor for development of thrombosis. The most common sites of venous thrombosis are the lower limbs and arterial thrombosis (CNS). The patient had a torpid neurological level with vegetative state defined by the alternation of waking and sleep periods, spontaneous maintenance of circulatory and respiratory functions, absence of precise motor responses, absence of verbal vocalization, respon-se to verbal commands, propositional eye movements, incontinence of both sphincters and EEG showing severe dysfunction. Gastrostomy and tracheostomy were perfor-med and parenteral nutrition was initiated.

There was no improvement of neurological status and lupus activity continued, characterized by hematocrit decrease. Therefore, MPN was indicated. Lupus activity was probably triggered by an infectious focus due to Candida albicans at the urinary level. The patient was treated also with caspofungin. She presented lung dama-ge caused by Pneumocystis jirovecci that was managed with trimethoprim-sulfamethoxazole. Cuchacovich and Gedalia conducted a review of the pathophysiology and clinical spectrum of infections in patients with SLE.6 These authors found that the main factors associated with severe infections were time of lupus evolution, persistence of the activity that does not respond to immunomodulatory management, neurolupus, presence of nephritis, acute thrombocytopenia, neutropenia, high titers of anti-DNA, low CH50 (hypocomplementemia), chronic use of glu-cocorticoids and cyclophosphamide. It is important to remember that we must rule out an immunodeficiency associated with SLE. To complicate the picture, there is no study that clearly shows the immunization status of these patients because disease exacerbation has been documented after application of pneumococcal vaccine, tetanus toxoid, influenza B, and hepatitis B, among others.

Our patient presented with several of these risk factors, which explains the outcome of the case.

The patient continued with a poor evolution. Due to gastrointestinal bleeding, anticoagulation was tempo-rarily suspended. Pulmonary deterioration progressed and chest x-ray was compatible with lupus pneumonitis even with previous therapeutic gamma globulin and pulsed methylprednisolone administration. The patient was given a second pulse of cyclophosphamide despite being a questionable option because the patient may have benefited more with plasma exchange, which is

the preferred treatment for lung involvement. Increased immunosuppression would also have been avoided. Finally, Klebsiella pneumoniae was isolated and resistance to cefepime was demonstrated in catheter cultures. The antibiotic scheme progressed to pipera-clina tazobactam.

A meeting was held with the Ethics Committee and it was agreed to provide palliative care to avoid therapeutic continuation. The patient was transferred to the medical floor with orders for sedation and pain management. The patient presented hypotension and disseminated intravascular coagulation and died 1 month after admission.

Final Diagnoses- Adolescent female with short stature for age- Systemic lupus erythematosus- Class IV lupus nephritis- Secondary antiphospholipid syndrome- Infectious encephalitis probably secondary to Liste-

ria monocytogenes- Sepsis with central nervous system focus- Right occipital infarction- Significant vasospasm involving the posterior circu-

lation- Occipital cortical infarction- Pneumocystis pneumonia due to Pneumocystis jiro-

vecci- Urinary tract infection due to Candida albicans- Catheter-related infection due to cefepime-resistant

Klebsiella pneumoniae- Gastrostomy and tracheostomy- Vegetative state- Upper gastrointestinal bleeding- Disseminated intravascular coagulation- Cardiopulmonary arrestCause of Death Sepsis with a catheter-related pulmonary focus due to Klebsiella pneumonia.

Review of Pathology (Dr. maria Sanchez Escobar Al-geria)Renal BiopsyA renal biopsy of the patient showed up to 11 glomeruli: five totally sclerosed and six with endo-extracapillary proliferation with formation of cellular crescents. At higher



magnification, endo-extracapillary proliferation is best observed with cellular crescent formations and hyaline thrombi in the lumen of the glomerular capillaries. With PAS staining, hyaline material is evident in the capillaries, and in the interstitium there are clusters of lymphocytic inflammatory infiltrate. In the tubules there is isometric vacuolation and tubular atrophy in 10% of all cores. In Masson staining there is evident full sclerosis of some glomeruli and crescent formation. Silver stain shows the double contour of the lumen of the glomerular capillaries. Immunofluorescence was performed and granular deposits were found in the mesangium and peripheral glomerular capillaries. Immunoreactants were all positive. Based on this, diagnosis of glomerulopathy was made, rather than lupus nephritis. Diffuse proliferative glomerulonephritis was diagnosed, endo-extracapillary global sclerosis and crescent cellular formation. The disease was classified as class IV lupus glomerulonephritis with 12/24 activity and chronicity of 6/12 (Figure 1).

Necropsy Findings No photograph of the autopsy was available. The patient had Cushing’s facies, hirsutism and petechiae and was being treated with steroids. Findings are related to SLE and APAS

Kidneys. The kidneys were within the expected weight. There is loss of the corticomedullary ratio with intense failure. In this section we can also see the lining of the bladder, which only demonstrated bleeding in one layer. Kidney damage is more extensive than revealed in the biopsy. Most of the glomeruli present total sclerosis. There is also an increased number of atrophic tubules in most of the cuts that were included in both kidneys. The presence of thrombus and sclerosis is also observed. Silver staining evidences these changes in the glomeruli, tubules

Figure 1. (A) Renal biopsy (40x, H/E). (B) IgG immunofluorescence (100x). Figure 2. IgM skin immunofluorescence (100x).

and interstitium. In the Masson stain there is interstitial fibrosis plus tubular atrophy. At the time of autopsy, cuts were only included for immunofluorescence in which im-munoglobulin deposits were again observed in a granular form, both in the mesangium and in the peripheral loop of the glomerular capillaries.

Skin. Skin sections were included where there are very subtle histological data and no significant changes consistent with SLE. However, according to immunofluo-rescence there is a very clear lupus band positive for all immunoreactants, IgG, IgA, IgM and fibrinogen (Figure 2). There is also serositis, another finding that supports lupus activity.

Pericardium. Pericardium showed extensive hemor-rhage, granulated tissue and edema, which may be related to lupus activity or as the final event of shock data.

Lymph nodes. Lymph nodes are observed in the mes-enteric lymph node with subcapsular hemorrhage. In the subcapsular sinus there are extensive areas of necrosis. There is total loss of architecture. There is no differentia-tion of the cortex of the paracortex. At higher magnification there is necrosis, karyorrhexis, which is known as acute necrotizing lymphadenitis or Kikuchi syndrome associated with lupus. In addition to the above, there is presence of erythrocytes within macrophages, i.e., there is a secondary macrophage activation syndrome described in SLE. There are fibrin thrombi and increased numbers of plasma cells, a reactive plasmacytosis accompanying SLE.

Bone marrow. Bone marrow reveals part of the tra-beculae and intertrabecular spaces with cellularity ~80 to 90%. There is presence of megakaryocytes, myeloid and erythrocyte series, without alterations for proper matura-tion. Additionally, the presence of numerous plasma cells



is seen. There is reactive plasmacytosis in bone marrow and lymph nodes. At higher magnification we can see the presence of bleeding and hemosiderin deposition, probably secondary to transfusions. There were no microorgan-isms, no increase in myeloid series and no evidence of bone marrow reactive to a systemic infection process. Based on these findings, the main disease is SLE and APAS.

Concomitant Alterations- Diffuse proliferative glomerulonephritis or endo-and

extracapillary, global sclerosis and cell crescents - Lupus nephritis class IV or with 12/24 activity and

8/12 chronicity- Skin with lupus band- Acute pericarditis- Acute necrotizing lymphadenitis- Lymphoid depletion- Reactive plasmacytosis- Secondary macrophage activation syndrome Other FindingsLungs. Lungs are at the level of the thoracic cavity. As we can see, this was the cause of death. There is a hemorrha-gic infarction occupying the entire right lower lung lobe (Figure 3). In serial sections we can see the magnitude of the hemorrhagic infarction secondary to APAS coagulo-pathy, not to pulmonary embolism. There is a cavitation filled with hemorrhagic material with a diameter >4.5 cm. In the histological section, part of the lung parenchyma is preserved and the cavity contains erythrocytes and recent hemorrhage. An interface is seen between the best preserved areas of the lung and bleeding. Elsewhere there are intra-alveolar hemorrhages. Both lungs were fully affected. In the best preserved areas there is hyperplasia of the alveolar septa and scarce lymphoplasmic inflam-matory infiltrate, which represents probable interstitial pneumonia resolution. There is no evidence in any of the cuts of P. jirovecci infection or of Klebsiella or other microorganisms. There is no evidence of inflammation or systemic response to an infectious process. There are also hyaline membrane formations indicating acute alveolar damage and fibrin thrombi in the microvasculature of the lungs (Figure 4).

Figure 3. Macroscopic view of both lungs with cavitary lesion in the right lower lung lobe.

Figure 4. Fibrin clots in both lungs (20x).

Concomitant Alterations- Hemorrhagic infarction (4.5 cm diameter) in the

right lower lobe- Bilateral diffuse intraalveolar hemorrhage- Diffuse alveolar damage- Chronic fibroadhesive pleuritis



Figure 5. Macroscopic view of the dura mater with subdural hemorrhage.

and reactive gliosis can be observed throughout the bra-in. Congestion of subarachnoid vessels, vacuolation and degeneration of white matter is also noted. In other areas there is proliferation of astrocytes, some hypoxic neurons and presence of macrophages. There is perivascular cuffing of lymphocytes, but this cannot be determined to be an infectious process. In addition to the previously mentioned data, fibrin thrombi are observed throughout the central nervous system microvessels and hypoxic neurons. All cuts shown above correspond to the anterior, middle and posterior cerebral arteries, with all its branches. There were no details of vasculitis or thrombosis, but congestion and microthrombi were observed in the choroid plexus.

Concomitant Alterations- Cerebral atrophy- Encephalitis- Multiple old supratentorial cerebal microinfarcts- Subdural hemorrhage- Fibrin thrombi in the microvasculature of the brain

Liver. The liver weighed 50 g more than expected. We found only some pale areas and other areas with conges-tion. Histologically, the architecture is preserved. There is only some dilatation of the sinusoids.

Pancreas. There are areas of steatonecrosis of me-senteric adipose tissue and the pancreas. We also found the presence of fatty infiltration in pancreas and heart. Gastrointestina tract. In the gastrointestinal tract there was congestion and areas of bleeding in the stomach in both the antrum and body. Histologically, there were no abnormalities in the esophagus, stomach or intestines, only contraction bands in smooth muscle throughout the gastrointestinal tract as a final event of the shock. Bladder. In the bladder, mucosal congestion was ob-served as a final event of shock and visceral myopathy (Figure 6), in addition to the presence of secretion in the lumen of the pancreatic ducts, secondary to dehydration. Gonads showed congestion.

The following diagnoses were integrated: fatty necrosis, multiorgan fatty infiltration, anatomic data of shock and coagulopathy, retention of secretions, visceral myopathy, multivisceral congestion, fibrin thrombi and hemorrha-ge. Postmortem cultures of liver, spleen, colon, small intestine, lungs, blood culture and CSF were negative. It appears that the cause of death is lupus activity

- Bilateral hemothorax [180 mL (right), 265 mL (left)]- Post-thoracentesis status- Acute or ulcerated tracheitis- Fibrin thrombi

Central nervous system. Numerous meninges and dura mater adherent clots were found (Figure 5). Different cuts were made to the venous sinus and there was no thrombus. Thrombi were in the microvasculature. Autopsies should be performed with all autoimmune diseases, particularly SLE, where the circle of Willis was dissected and inclu-ded all branches of the middle cerebral artery, anterior and posterior. No thrombi were found at this level. The brain had a weight of 1.050 g vs. an expected weight of 1400 g, i.e., a decreased brain weight for age. There are broadening of the convolutions and loss of the relationship between the cortex and white matter, i.e., there is extensive cortical atrophy. In the territory of the middle cerebral artery at the level of the frontoparietal lobes, hemorrhage and congestion data are observed as well as microinfarcts elsewhere in the brain. Infratentorial portion (ITP) showed no microscopic abnormalities and the different cuts show significant congestion in the subarachnoid space. It is wor-th mentioning that there is no mild inflammatory infiltrate in the meninges or microorganisms, but significant cortical atrophy and multiple microinfarcts, neuropil vacuolation



Figure 6. Macroscopic view of the bladder mucosa showing hemorrhage and congestion.

plus coagulopathy associated with APAS, which cau-sed hemorrhagic infarction. The immediate cause of death was lung damage, not the source of infection.

Review of Rheumatology (Dr. Rocio maldonado) There are many questions regarding the frequency of Lis-teria infection in our environment. Therefore, we asked the Infectious Diseases Department what triggered this infection in our patient.

Review of Infectious Diseases Department (Dr. Sarbelio moreno) The literature describes this as a major pathogen of immunocompromised patients because their defense mechanism is type T lymphocyte dependent. Therefore, any pathogen that engages this system can trigger this infection. There are several series of patients, mainly adults with SLE in which Listeria can be divided into two forms: acquired orally by inadequate refrigeration or pasteurization, although we have a highly effective system of mucous membranes to contain it. This is not often observed in the intestine. Also, unique invasive mechanisms exploit elements of the intestinal mucosa resulting in endocytosis, crossing the barrier and entering the bloodstream. There are two disposal sites, placenta and brain. Its frequency in blood and not in the CSF is determined by the manner in which it is spread through

macrophages. Once phagocytized, vacuoles are formed and these elements are used to form pseudoflagellae, thus diffusing other macrophages. Therefore, it is easier to re-cover from blood cultures than from cultures in the CNS, with <30% recovery. CSF is characteristic of bacterial meningitis with high amounts of protein, high cellularity (predominantly polymorphonuclear) and, although not as often as that which causes hypoglycorrhachia such as in our patient, it is sometimes very difficult to identify. This is because prophylaxis against Pneumocystis covers Listeria, and this is attributed to the fact that it is not frequently found. What is important is the treatment of choice, which was ampicillin that was frequently used. Because the intracellular form of spread is through ma-crophages, which is outside the scope of beta-lactams, it is recommended to add an aminoglycoside.

Review of Rheumatology (Dr. Rocio maldonado) The patient presented with a very torpid evolution. CNS disease was the trigger for the poor outcome. Additionally, there was always controversy as to whether the patient was in a vegetative state as a trigger for all events. This was most likely influenced by the presence of APAS, which later developed to catastrophic shock. The question is: What was the mechanism for this development?

Review of Rheumatology (Dr. Enrique Faugier) The process may be triggered initially by a secondary sep-tic event to a procoagulant state of the patient. The criteria are well defined but, to date, pediatric patient morbidity is very controversial compared with adults in whom there are risk factors such as smoking, obesity, and hypertriglyceri-demia. Beginning from a catastrophic syndrome, autopsy showed the presence of thrombosis in at least three organs during a 1-week period. The patient was well managed and it is known that mortality is 50–90% as in this case.

Review of Rheumatology (Dr. Rocio maldonado) Obviously there were several factors that led to the death of the patient. However, a vegetative state was previously triggered, making difficult to determine the time needed for confirmation. Therefore, it is important to determine how to reach this diagnosis.

Review of Neurology (Dr. Juan Hernandez Aguilar)This patient clearly had a generalized disturbance with a



significant neurological compromise, mainly at the cortical level. For diagnosis of vegetative state, criteria are consi-dered ranging from a minimum state of consciousness to brain death. Persistent vegetative state is characterized by lack of awareness without any experience, no sleep-wake cycle, opening and closing of the eyes, normal breathing pattern, and significant EEG changes. Outcome depends on the pathology that conditions it; 63% of patients in vegetative states survive up to 8 years, progressing to brain death or improvement. The patient presented data to suspect vegetative state, but we would have to wait 3–6 months to discuss a definitive prognosis and to determine whether she would recover.

Review of Rheumatology (Dr. Rocio maldonado) According to what has been discussed above, aggressive treatment for this patient would have been necessary in order to know how to proceed in these cases.

Review of medical Ethics (Dr. Jose Gamboa marrufo) According to what has been described, the patient had significant neurological impairment. She was a candidate for palliative care. She had no pain until her death. Pa-lliative care ends with a period of mourning 4–6 months after death.

REFERENCES

1. American College of Rheumatology. 1997 update of the 1982 American College of Rheumatology revised criteria for classification of systemic lupus erythematosus. Available at: http://www.rheumatology.org/practice/clinical/classification/SLE/1997_update_of_the_1982_acr_revised_criteria_for_classification_of_sle.pdf#search="1997 revised criteria for classification of systemic lupus erythematosus"

2. Infectious Diseases Society of America. IDSA Practice Guidelines. Available at: http://www.idsociety.org/Guidelines_Patient_Care/

3. Bertsias GK, Ioannidis JPA, Aringer M, Bollen E, Bombardieri S, Bruce IN, et al. EULAR recommendations for the manage-ment of systemic lupus erythomatosus with neuropsychiatric manifestations: report of a task force of the EULAR standing committee for clinical affairs. Ann Rheum Dis 2010;69:2074-2082. doi:10.1136/ard.2010.130476

4. Wilson WA, Gharavi AE, Koike T, Lockshin MD, Branch DW, Piette JC, et al. International consensus statement on preliminary classification criteria for definite antiphosholipid syndrome: report of an international workshop. Arthritis Rheum 1999;42:1309-1311.

5. Avcin T, Cimaz R, Silverman ED, Cervera R, Gattorno M, Garay S, et al. Pediatric antiphospholipid syndrome: clinical and immunological features of 121 patients in an international registry. Pediatrics 2008;122:e1100-e1107.

6. Cuchacovich R, Gedalia A. Pathophysiology and clinical spec-trum of infections in systemic lupus erythematosus. Rheum Dis Clin North Am 2009;35:75-93.

7. Jennette HC, Olson JL, Schwartz MM, Silva FG. Heptinstall’s Pathology of the Kidney. Philadelphia: Lippicott Williams and Wilkins; 2007.


Dermatologic manifestations of Alagille syndrome

pediatric theMe


André Morales Martínez,1 Carlos Alfredo Mena Cedillos,1 Jaime Nieto Zermeño,2 Verónica Morán Barroso,3 Salvador Villalpando Carrión2 and Silvia Ramírez Dovala4

1 Servicio de Dermatología Pediátrica, 2Dirección de Enseñanza y Asistencia Médica, 3Departamento de Genética, Hospital Infantil de México Federico Gómez, Mexico, D.F., Mexico

4 Departamento de Dermatología, Hospital General de México, México, D.F., México

Correspondence: Dr. André Morales MartínezServicio de Dermatología PediátricaHospital Infantil de México Federico Gómez Mexico, D.F., MexicoE-mail: [email protected]


AbSTRACT

Alagille syndrome (MIM #118450) causes the majority of cases of congenital cholestasis. The disease is inherited in an autosomal dominant pattern and is a multisystem disorder associated with several clinical manifestations including the core criteria of cholestasis, cardiac defects, skeletal abnormalities, and eye and facial features. This condition is caused by microdeletions of the 20p12 gene corresponding to JAG1. It is known that a second form of Alagille syndrome is caused by mutations in the NOTCH gene on 1p13-p11. Diagnosis is often delayed because only few patients show a classic picture in the early stages of the disease, causing an increase in morbidity. This review suggests clinical tools for early suspicion and disease management.Key words: Alagille syndrome, cholestasis, cutaneous manifestations.

INTRODuCTION

Alagille syndrome (AS) is an inherited syndromatic form of chronic cholestasis due to intrahepatic bile duct hypo-plasia, which is associated with extrahepatic congenital malformations in children with a peculiar phenotype. It presents an autosomal dominant inheritance pattern of variable expression by microdeletion in the JAG1 gene locus 20p12.2.1-4 Since its description in 1969 by Alagille et al., it has been reported as the most common cause of chronic cholestasis in the western world.5 Classically, diagnosis is based on histopathological findings, which are interlobular bile duct paucity and three to five major criteria: chronic cholestasis, heart disease, skeletal and

ocular abnormalities and characteristic phenotype.3 AS is a rare condition that occurs in 1/70,000 to 100,000 new-borns without gender preference. Some cases have been associated with chromosome 20p deletion and others due to de novo mutations.6,7

Clinical Features of Alagille Syndrome Liver, skeletal, renal, eye and facial abnormalities are expressed in AS. Major and minor criteria for diagnosis are outlined below.

Major criteria • Chronic cholestasis—associated with paucity of in-

trahepatic bile ducts (more than half of portal tracts without bile ducts) or absence of intrahepatic bile ducts reported on liver biopsy, accompanied by pru-ritus and hypercholesterolemia.

• Facial features—hypertelorism, broadened fore-head, pointed chin, sunken eyes and elongated nose with bulbous tip

• Vertebral anomalies—butterfly hemivertebrae (mainly in the thoracic spine)

• Posterior ocular embryotoxon—prominence of Schwalbe’s line that represents the termination of the peripheral Descemet’s membrane; present in up to 90% of cases (exotropia is found less often). Diag-nostic criteria also include ectopic pupil, keratotic



band and lens changes. It is known that posterior embryotoxon may present as an isolated autosomal dominant feature associated with cholestatic syndro-me, setting the tone for suspicion of AS.

• Congenital heart disease—the most common abnor-mality is peripheral pulmonary artery stenosis and, less commonly, tetralogy of Fallot (7–9%) (TOF), patent ductus arteriosus (PDA), ventricular septal defect, atrial septal defect, pulmonary atresia and aortic coarctation. In addition, we included some systemic vascular abnormalities such as renal or ca-rotid artery stenosis.

Minor criteria • Xanthomas secondary to cholestasis (cholesterol

>500 mg/dl) located primarily in areas of extension: fingers, palms, neck, groin and popliteal fossa

• Low weight and height for age, recurrent lung infec-tions, pancreatic insufficiency (which should be sus-pected with acute diarrheal episodes), hypothyroi-dism, hypogonadism, delayed puberty, retarded growth and high-pitched and hoarse voice

• Vascular abnormalities such as Moyamoya disease, abnormal intrahepatic portal venous radicals and cerebral vascular anomalies with risk of intracranial hemorrhage

• Neurological disorders such as peripheral neuro-pathy secondary to vitamin E deficiency2-3

• Renal alterations such as nephrolithiasis, defects in urine concentration, hypoplasia, duplicity, cysts, solitary kidney, bifida pelvis, ectopic kidney, renal failure and interstitial nephropathy1-7

• It was previously considered that these patients de-monstrated mental retardation; however, it is currently suspected that vitamin deficiencies, particularly vita-min E, are the cause of this clinical situation because most of these patients retain normal intelligence.3

• Definitive diagnosis is established based on liver biopsy when it is at least 20 portal tracts and a rela-tionship between the number of bile ducts and portal tracts of <0.4 (normal range: 0.9–1.8). Fibrosis can also be detected to varying degrees.3,5,8

• Molecular analyses to detect mutations in the JAG1 gene sequence.

Not all patients with AS show all the previously men-tioned features, even those features considered the most

classic. Some patients did not initially demonstrate jaun-dice, ascites or xanthomas. This complicates and delays diagnostic suspicion for years, thereby increasing disease morbidity.3,5,8

Clinical Manifestations of AS The aim of this review was to evaluate the clinical mani-festations of AS, which are almost specific for this disease and, in general, not often considered in the diagnostic approach. Although importance is reduced for the wide range of clinical forms of the disease, total consideration of these elements is key for clinical diagnostic suspicion and thereby early initiation of the evaluation and management of this entity in order to improve prognosis and patients’ quality of life. Cutaneous manifestations can be considered as the expression of different internal manifestations of AS present at birth such as supernumerary interdigital creases and characteristic facies. Other manifestations such as jaundice, pruritus, lichenification and xanthomas usually follow. After changes secondary to vascular disease and malnutrition appear, there is often concern on the part of the family to seek medical attention. Due to the rarity of this disease, symptoms may be mistaken for other different or transient conditions (Table 1).7,9,10

All clinical manifestations of liver disease are mainly cutaneous.9-11 Obstruction or prolonged pseudo-obstruction of the bile pathway determines the accumulation of serum cholesterol. Unesterified cholesterol, for the most part,

Table 1. Principal clinical manifestations of Alagille syndrome

Alterations Clinical manifestations

Hyperbilirubinemia IcterusPruritus (skin excoriations)XerosisLichenification

Hyperlipoproteinemia Xanthomas (planum, tuberous, eruptive)

Hepatopathy Telangiectasias and collateral venous network

Vitamin deficit Zinc: enteropathic acrodermatitisVitamin A: follicular hyperkeratosis

Cardiopathy Hippocratic or “watch glass” nails

Mutation of JAG1 gene Supranumerary interdigital creasesCharacteristic faciesPosterior embryotoxin


André Morales Martínez, Carlos Alfredo Mena Cedillos, Jaime Nieto Zermeño, Verónica Morán Barroso, Salvador Villalpando Carrión, and Silvia Ramírez Dovala

stimulates the formation of an abnormal lipoprotein or lipoprotein X. Prolonged hypercholesterolemia leads to the formation of flat xanthomas, xanthelasma and tuberous xanthomas, which may mimic other dermatological condi-tions.12 In addition to jaundice outside of the physiological range (Figure 1), accumulation of bile increases plasma pruritogens. These are produced in the liver and excreted under physiological conditions, leading to an increase in endogenous opioid levels that ultimately induce pruritus. This has been mentioned as the most severe symptoms in AS. Even because of the discomfort and inconvenience it creates for the patient, it becomes a criterion for liver transplantation in specific situations.13

Other mentioned manifestations of AS are xerosis, excoriations, telangiectasias, collateral venous network (Figure 2), palmar erythema, alopecia, lymphedema and keratoderma. With respect to the most representative dermatosis of this entity, Garcia et al. conducted a stu-dy reporting that 7/38 patients (29%) had disseminated xanthomas.10 This is similar to what has been reported in

Figure 1. The jaundiced “tint” outside physiological ranges for suspecting the presence of liver affectation.

Figure 2. Collateral venous network and hematic crusts.

the literature (28–45%). Xanthomas originate from chronic cholestasis and hypercholesterolemia, although appearan-ce of those lesions is not always linked to high cholesterol levels.8,13 Xanthomas are also found in the ears, neck, extensor surfaces of the fingers, palms, soles, popliteal fossa, groin areas, buttocks, elbows and knees (Figure 3). The youngest age of presentation of AS was at 10 months, increasing in severity according to the degree and duration of cholestasis.3,4,8,11,12,14 Some peculiarities of xanthomas are confluent on elbows and knees and due to the intense itching, there is lichenification, excoriation and eczema. Its appearance perceived the need for liver transplantation in >90% of patients who present this because of the pro-gression to liver failure dysfunction.4,8,14 Xanthomas tend to disappear in accordance with the decrease in serum cho-lesterol levels and more rapidly after liver transplantation, after which there is a dramatic improvement in pruritus and skin lesions.3,10,14 The study conducted by Kamath et al. reported the presence of interdigital accessory folds in 35% of patients with AS. This presence was associated with a JAG1 mutation, although its role is unclear in the normal development of this region (Figure 4).15 Identification of dermatoses presented in an isolated manner is important both for the suspected diagnosis of AS as for other causes of cholestasis, according to age and the remaining clinical



setting in which they present. However, associations with other clinical data reported were strongly oriented toward the diagnosis of this syndrome. Early identification of AS will help to prevent adverse life-threatening situations, avoiding morbidity and use of treatments that do not resolve or improve specific pathogenesis.

Disease prognosis is determined by the associated vascular changes (Figure 5) and the degeneration caused by cholestasis, as well as high levels of cholesterol and risk of liver and kidney failure, which set the tone for es-tablishing the severity the problem. In some patients, the disease degenerates into terminal liver disease, therefore requiring urgent liver transplantation. Other patients die early during the course of the disease due to infections or heart conditions.10-16

Patient management for AS should focus on correcting complications of the affected systems. A variety of diag-

Figure 5. Clubbing in a patient with Alagille syndrome and tetralogy of Fallot.

Figure 3. Disseminated xanthomas.

Figure 4. Interdigital accessory folds.

nostic tools are useful to support the treating physician according to the various complications associated with the syndrome to provide early identification. In this way, you can delay and even prevent the presentation of many of these complications, offering a better quality of life for the patient. Parents should also receive adequate and appropriate genetic counseling.2,8,15,16

REFERENCES

1. Online Mendelian Inheritance in Man. Alagille syndrome. Available at: http://www.omim.org/entry/118450.

2. Chen H. Alagille syndrome. In: Atlas of Genetic Diagnosis and Counseling. Totowa, NJ: Humana Press; 2006. pp. 32-35.

3. Rosenthal P. Atresia biliar y trastornos neonatales de las vías biliares. In: Wyllie R, Hyams J, eds. Gastroenterología Pediátrica. Philadelphia: McGraw-Hill Interamericana; 2001. pp. 640-641.

4. Ruiz-Castillo M, Michel-Penichet F, Cervantes-Bustamante R, Zarate-Mondragón F, Mata-Rivera N, Montijo-Barrios E, et al. Síndrome de Alagille: informe de 12 casos en el Instituto Nacional de Pediatría. Rev Enfer Infecc Pediatr 2007;81:13-17.

5. Wang JS, Wang XH, Zhu QR, Wang ZL, Hu XQ, Zheng S. Clinical and pathological characteristics of Alagille syndrome in Chinese children. World J Pediatr 2008;4:283-288.

6. Jiménez-Jiménez JR, Castellanos-Reyes K, Huerta-Albarrán R, Justiniani-Cedeño NE, Yáñez-López MP, Sierra-Torto-lero A. Un caso del síndrome de Alagille. Rev Mex Pediatr 2007;74:152-157.

7. Krantz ID, Piccoli DA, Spinner NB. Alagille syndrome. J Med Genet 1997;34:152-157.

8. Emerick KM, Rand EB, Goldmuntz E, Krantz ID, Spinner NB, Piccoli DA. Features of Alagille syndrome in 92 patients:


André Morales Martínez, Carlos Alfredo Mena Cedillos, Jaime Nieto Zermeño, Verónica Morán Barroso, Salvador Villalpando Carrión, and Silvia Ramírez Dovala

frequency and relation to prognosis. Hepatology 1999;29:822-829.

9. Segupta S, Das JK, Gangopadhyay A. Alagille syndrome with prominent skin manifestations. Indian J Dermatol Venereol Leprol 2005;71:119-121.

10. García M, Ramonet M, Ciocca M, Cabrera H, Lapunzina P, Álvarez E, et al. Alagille syndrome: cutaneous manifestations in 38 children. Pediatr Dermatol 2005;22:11-14.

11. Ghosn SH, Kibbi AG. Cutaneous manifestations of liver disea-ses. Clin Dermatol 2008;26:274-282.

12. White LE. Xantomatosis y otras enfermedades de las li-poproteínas. In: Wolff K, Goldsmith LA, Katz SI, Gilchrest BA, Paller AS, Lefell DJ, eds. Fitzpatrick Dermatología en

Medicina General. Argentina: Médica Panamericana; 2009. pp 1272-1281.

13. Schwartz R, Rehder K, Parsons DJ, Morrell DS. Intense pruritus and failure to thrive in Alagille syndrome. J Am Acad Dermatol 2008;58(suppl 2):S9-S11.

14. Buckely DA, Higgins EM, du Vivier AW. Resolution of xantho-mas in Alagille syndrome after liver transplantation. Pediatr Dermatol 1998;15:199-202.

15. Kamath BM, Loomes KM, Oakey RJ, Krantz ID. Supernume-rary digital flexion creases: an additional clinical manifestation of Alagille syndrome. Am J Med Genet 2002;112:171-175.

16. Ling SC. Congenital cholestatic syndromes: what happens when children grow up? Can J Gastroenterol 2007;21:743-751.


Principal causes of childhood mortality in mexico: recent trends

vital statistics


Sonia B. Fernández Cantón,1 Gonzalo Gutiérrez Trujillo,2 and Ricardo Viguri Uribe2

1 Dirección de Información Epidemiológica, Secretaría de Salud, Mexico, D.F., Mexico

2 Departamento de Ediciones Médicas, Hospital Infantil de México Federico Gómez, México, D.F., México

Correspondence: Dra. Sonia B. Fernández CantónDirección de Información Epidemiológica Secretaría de Salud Mexico, D.F., MexicoE-mail: [email protected]; [email protected]


In this report we will discuss the latest figures obtained by INEGI in regard to mortality for 2010. In particular, we review the trend in the population of children <1

year of age, both according to overall performance as well as the main causes of death.

According to information from the previous decade, it is noted that the number of deaths of children <1 year of age recorded in 2010 amounts to 10,000 deaths less than 10 years ago: 38,000 vs. 28,000 between 2000 and 2010, respectively. It is noteworthy that, during the previous year, there was an apparent stagnation with only 123 fewer deaths reported. This impacts the infant mortality rate and remains virtually unchanged (Figure 1). The explanation for this fact has a positive background because there is evidence of a notable improvement in the completeness of the clinical record by reducing the number of deaths on a regular basis, which are not reported to the civil registry on a regular basis. As of 2010, the Department of Health includes the third copy of the death certificate, which remains in the medical unit that treated the decea-sed person. The new procedure establishes that the data should be captured in the information system from this

point, whether or not the original certificate has arrived at the office of civil registry.

Distribution of childhood deaths according to gender has remained stable. There is a noticeable predominance of males, which is universal: 56% of deaths in males vs. 44% in females. In terms of distribution according to the age of the child at the time of death (neonatal and postneo-natal mortality), the gap clearly continues to widen such as neonatal mortality (<28 days) where 18.151 deaths are observed, representing 63% of the total, whereas 37% of deaths are attributed to postneonatal mortality (between 29 days and 1 year of age) with 10,696 deaths. This shows that the endogenous causes are those that explain the majority of childhood deaths, whereas external causes linked to the environment and living conditions continue to decline. This is clearly documented by analyzing the 20 leading causes of death in children <1 year of age (Table 1). Indeed, it appropriately characterizes the epidemiological situation observed in the national context for 2010. The first aspect that stands out from the above list is that only the leading cause of death explains half of all childhood deaths, and the top three causes account for 75% of these deaths.

In view of mortality of essentially endogenous causes such as those in the previous table, some authors mention direct bias. Among the most relevant are premature birth, genetic diseases, various insults to the maternal organism during pregnancy, certain developmental defects in the infant and hypermaturity, among others. The causes that have had the highest impact with regard to relative weight are shown in greater detail below.

Conditions Originating During the Perinatal PeriodConditions originating during the perinatal period are the leading cause of death and account for half of all childhood deaths. However, the trend has declined


Sonia B. Fernández Cantón, Gonzalo Gutiérrez Trujillo and Ricardo Viguri Uribe

over the last 10 years. Between the years 2000 and 2010 there have been 26% fewer deaths (from 19.394 to 14.337), although the relative weight has not chan-ged compared to the total. Among the direct causes in this group are, in order of importance, respiratory distress of the newborn (4011 deaths), bacterial sepsis (2663), disorders related to prematurity and low birth weight (1268), birth asphyxia (1123) and congenital pneumonia (892). The infant mortality rate from this cause in 2010 is reported at 746 deaths/100,000 births (Figure 2).

Congenital malformations, Deformities and Chromoso-mal Abnormalities Congenital malformations, deformities and chromosomal abnormalities are the second leading cause of death, responsible for the occurrence of 6477 deaths in the year 2010, representing 22% of childhood deaths. Its tendency, with regard to the number, is relatively stable with a figure between 6,500 and 7,000 deaths/year du-

ring the decade ending. However, due to the downward trend in births, the rate increases to between 299 and 336 deaths/100,000 births during the last 10 years (Figure 3). In a more detailed analysis, is noted that congenital cardiac malformations stand out with 2287 deaths fo-llowed by those of the musculoskeletal system (366), the great arteries (350) and anencephaly and similar malformations (274).

Pneumonia and Influenza Respiratory problems have caused most deaths in children, particularly in the most vulnerable sectors. At present they are the conditions that have a significant downward trend for the number of deaths even though they are the first cause of consultation in health services. Deaths due to respiratory causes has been reduced practically in half during the last 10 years, going from 3530 deaths in the year 2000 to 1820 deaths in the year 2010. During this same period the rate has been reduced from 146 deaths to 94 deaths/100,000 births. Similarly, the percentage of deaths

1400.00

1450.00

1500.00

1550.00

1600.00

1650.00

1700.00

2000 2001 2002 2003 2004 2005

Year

2006 2007 2008 2009 2010*

Rat

e pe

r 10

0,00

0

5 000

10 000

15 000

20 000

25 000

30 000

35 000

40 000

45 000

Deaths

Deaths

Rate

Figure 1. Deaths and mortality in the population of children <1 year of age, Mexico, 2000-2010.


Principal causes of childhood mortality in Mexico: recent trends

due to respiratory causes has decreased with respect to the relative weight to total infant mortality (from 9% to 6%). Within this group of causes, pneumonias of unspecified origin (1183 deaths) and acute bronchitis (254) are noted (Figure 4).

Certainly, one aspect that must be addressed in a complementary manner is the differential behavior of these causes of death in rural and urban areas and the impact of the size of the town of residence. Such issues will be reviewed in a forthcoming contribution.

Table 1. Principal causes of infant mortality México, 2010

Number Cause ICD code Deaths Rate * %

1 Various conditons originating during the perinatal period A33, P00-P96 14377 746.41 49.812 Congenitlal malformations, deformities and chromosomal anomalies Q00-Q99 6477 336.27 22.443 Pneumonia and influenza J09-J18 1256 65.21 4.354 Accidents V01-X59, Y40-Y86 768 39.87 2.665 Infectious intestinal diseases A00-A09 586 30.42 2.036 Acute respiratory Infections except pneumonia and influenza J00-J06, J20-J22 572 29.70 1.987 Septicemia A40-A41 557 28.92 1.938 Malnutrition and other nutritional deficiencies E40-E64 424 22.01 1.479 Heart diseases I00-I51 (except I46

cardiac arrest only for death)

409 21.23 1.42

10 Esophageal diseases K20-K22 146 7.58 0.5111 Cerebrovascular diseases I60-I69 120 6.23 0.4212 Renal insufficiency N17-N19 119 6.18 0.4113 Malignant tumors C00-C97 76 3.95 0.2614 Liver diseases K70-K76 74 3.84 0.2615 Chronic bronchitis, emphysema and asthma J40-J43, J45-J46 69 3.58 0.2416 Epilepsy G40-G41 68 3.53 0.2417 Anemias D50-D64 65 3.37 0.2318 Aggressions (homicides) X85-Y09 60 3.12 0.2119 Paralytic ileus and intestinal obstruction without hernia K56 51 2.65 0.1820 Meningitis G00, G03 47 2.44 0.16

Causes poorly defined 618 32.08 2.14

Remaining causes 1926 99.99 6.67Total 28865 1498.59 100.00

Source: DGIS. Principal causes from the Mexican registry 1998-2010/CONAPO. Birth projection estimates, México Census 2005 (1990 - 2012).*Calculated rate 1/100, 000 births


Sonia B. Fernández Cantón, Gonzalo Gutiérrez Trujillo and Ricardo Viguri Uribe

2 000

4 000

6 000

8 000

10 000

12 000

14 000

16 000

18 000

20 000

2000 2001 2002 2003 2004 2005

Year

2006 2007 2008 2009 2010

Dea

ths

680

700

720

740

760

780

800

820

840

860

Rate/100,000

Deaths

Rate

Figure 2. Deaths and mortality from certain diseases during the perinatal period, Mexico, 2000-2010.

Figure 3. Deaths and mortality from congenital malformations in the population of children <1 year, Mexico, 2000-2010.

Rate/100,000

5 700

5 900

6 100

6 300

6 500

6 700

6 900

7 100

7 300

2000 2001 2002 2003 2004 2005

Year

2006 2007 2008 2009 2010

Defunciones

270

280

290

300

310

320

330

340

350

Tasa por 100 000

Deaths

Rate

Dea

ths


Principal causes of childhood mortality in Mexico: recent trends

Figure 4. Deaths and mortality from pneumonia and influenza in the population of children <1 year, Mexico, 2000-2010.

Dea

ths

500

1 000

1 500

2 000

2 500

3 000

3 500

4 000

2000 2001 2002 2003 2004 2005

Year

2006 2007 2008 2009 2010

20

40

60

80

100

120

140

160

180R

ate

/100,000

Deaths

Rate


Early diagnosis and adequate treatment of patients with primary immunodeficiency

letter to the editor


Amos Etzioni,1 Ricardo Sorensen,2 Executive Committee, World Primary Immunodeficiency Week (2012)3

1 Meyer Children's Hospital, 31096 Haifa, Israel2 Department of Pediatrics, Children's Hospital, 200 Henry Clay

Ave., New Orleans, Louisiana 701183 Members of the Committee: A. Bousfiha, J. Drabwell, F.

Espinosa, A. Etzioni, A. Farrugia, S. Holland, F. Modell, V. Modell, J. Prevot, R.E. Schmidt, R. Sorensen, and G. Vaughn

Correspondence: Joelle KhraicheE-mail: [email protected]


In previous years, primary immunodeficiencies were considered as a group of rare disorders affecting ~1/10,000 persons; however, currently this is not the

case. It is known that primary immunodeficiencies (PID) are much more common and may occur at any age inclu-ding adulthood. Basically, almost all patients admitted to hospital with severe and life-threatening infections and patients with less severe but recurrent infections have an abnormal immune response. In many cases, with cu-rrent knowledge it is possible to detect the exact cause. In other cases, the primary immune defect is unknown. Periodically, new genetic disorders are discovered that generate some immune deficiency. But understanding the interplay between the different "actors" of the immune system remains a goal to be achieved. All our efforts are aimed at resolving the role of cells, molecules and the different organs of the normal functioning of the immune response in order to improve the condition of patients with immunodeficiency disorders. However, most important is the early detection of different clinical presentations of

primary immunodeficiencies. This course will improve survival and morbidity. For example, performing stem cell transplantation for severe combined immunodeficiencies in the first 3 months of life increases the survival rate >95% (which formerly had been a fatal condition). In addition, early transplantation has a major impact over saving treatment costs.1 Hypogammaglobulinemia and antibody deficiency are the most common defects of the immune system for generating serious infections, mainly in the lungs. Some type of antibody abnormality plays a role in most of the various immunodeficiencies. Diagnostic delay in antibody deficiency and recurrent pneumonias generate bronchiectasis that may involve pulmonary de-ficiencies with additional risk of mortality and morbidity.2 Antibody deficiencies may also lead to recurrent sinusitis, otitis and other infections. Therefore, immunoglobulin replacement should begin as early as possible. During the past 30 years, use of intravenous immunoglobulin became the recognized standard of medical care. The dose should be individualized to achieve the minimum concentration of 600 mg/dl or a sufficient dose to maintain the patient free of severe infections. Recently, the use of subcutaneous immunoglobulin (s.c.) has become popular. In some countries, up to 90% of patients are treated with this type of immunoglobulin. Thus, replacement of i.v. and the possibility of home treatment have increased patients’ comfort.3 In some parts of the world, however, supplying immunoglobulin (i.v. or s.c.) is limited, and patients do not receive appropriate therapy. Efforts to improve the knowledge of physicians worldwide and awareness of the general population is a constant and continuous work. This effort is carried out together by patient organiza-


Early diagnosis and adequate treatment of patients with primary immunodeficiency

tions, mainly the Jeffrey Modell Foundation (JMF) and the International Organization of Patients for Primary Immunodeficiencies (IPOPI), various medical organiza-tions—European Society for Primary Immunodeficiencies (ESID), European Federation of Immunological Societies (EFIS), Latin American Society for Immunodeficiencies (LASID), African Society for Immunodeficiencies (ASID) and the Clinical Immunology Society (CIS)—, nursing groups such as International Group of Nurses for Immuno-deficiencies (INGID), and industry—Therapeutic Plasma Proteins Therapeutic Assocation (PPTA).

World PI Week (WPIW) is a global awareness initiative aimed at improving the detection and diagnosis of primary immunodeficiencies (PI) as an important and growing group of diseases. It is held from April 22–29, ending on the International Day of Immunology on April 29. This initiative is an excellent opportunity to achieve our goal:

to educate the medical and general community about PI. This awareness will increase early diagnosis and achieve better access to appropriate treatment of children and adults whose prognosis was previously very poor.

REFERENCES

1. Buckley RH. Transplantation of hematopoietic stem cells in human severe combined immunodeficiency: longtem outco-mes. Immunol Res 2011;49:25–43.

2. Resnick ES, Moshier EL, Godbold JH, Cunningham-Rundles C. Morbidity and mortality in common variable immune deficiency over 4 decades. Blood 2012;119:1650–1657. doi:10.1182/blood-2011-09-377945.

3. Berger M. Choices of IgG replacement therapy for primary im-mune deficiency diseases: subcutaneous IgG vs. intravenous IgG and selecting an optimal dose. Curr Opin Allergy Clin Immunol 2011;11:532–538.

Boletín Médico del Hospital Infantil de México is the official publication of the Hospital Infantil de México “Federico Gómez.” The journal has been continuously published on a bi-monthly basis since 1944 and publishes studies relating to pediatrics ac-cording to the following areas: biomedical, clinical, public health, clinical epidemiology, health education and clinical ethics. The following guidelines are in accordance with the “Uniform Re-quirements for Manuscripts Submitted to Biomedical Journals,” published by the International Committee of Medical Journal Editors (http://www.icmje.org).

Types of articlesTypes of articles published are as follows: Review Articles, Cli-nical Case Reports, Clinicopathological Cases, Pediatric Themes and Letters to the Editor. Published articles appear both in print and on-line in Spanish and on-line in English.

Submissions should be sent via electronic mail to: [email protected] with the following requirements:1. Letter addressed to Dr. Gonzalo Gutiérrez Trujillo, Editor,

Boletín Médico del Hospital Infantil de México, Departamen-to de Ediciones Médicas. The letter, signed by the correspon-ding author, should include the following information:a) The enclosed article is being submitted for evaluation

for eventual publication in Boletín Médico del Hospital Infantil de México.

b) The authors declare that the work has not been pre-viously published, has not been previously accepted for publication and has not been submitted simultaneously to another publication.

c) Type of study should be indicated along with the corres-ponding pertinent area of pediatrics.

d) Confirm that the Guidelines to Authors have been re-viewed and adhered to prior to submission.

e) If applicable, the authors should declare any conflict of interest or submit a statement that no conflict of interest exists. In the event of a conflict of interest, the authors must disclose any external financial or economic inter-est.

f) All external funding sources should be clearly indicated.g) All authors must affirm that they are in agreement with

the submission of the manuscript and that they have reviewed and approved the work.

Please be reminded that without the appropriately signed author letter, the initial editorial process will be delayed.

manuscript preparationAll manuscripts should be prepared with standard programs (preferably Word) using the word processor function of your computer. Double space all sections of the manuscript including References, Tables and Figure Legends. Do not justify right mar-gins and use one-inch margins all around. Keep formatting to a minimum. Pages should be numbered consecutively beginning with the first page and numbers should appear in the lower right corner of the page.

AbbreviationsComplex terms used frequently in the manuscript may be ab-breviated. Abbreviations are placed in parentheses at first use in the abstract and again at first use in the text. Confirm that any

Guidelines to authors

abbreviations used in Tables are appropriately spelled-out in the Table legend underneath.

Organization of the manuscriptThe first page should include the following:

a) Title of the manuscript (Spanish and English) b) Type of manuscript: Original Article, Review Article,

Clinical Case Report, etc.c) Name(s) of all authors in their order of appearance in

relation to the publication d) Affiliation of each author (degrees and honors should

be omitted)e) Name, E-mail address, postal address and telephone

number of the corresponding author to whom any co-rrespondence can be directed during the review process of the manuscript.

The second page should contain the Abstract. Note that the Abstract is the most-often read part of the manuscript. For this reason, it must be clear, concise and contain information relevant to the article. Do not use references in the Abstract. In the case of Original Articles and Clinical Case Reports, the Abstract should be structured according to the following sections: Background, Methods, Results, Conclusions, or Background, Clinical Case and Conclusions. Abstracts for Review Articles and Pediatric Themes should be unstructured and include only one paragraph. The Abstract should be limited to 200 words and include only relevant aspects of each of the principal sections of the body of the manuscript. Authors should provide 3–6 keywords following the Abstract and use Medical Subject Headings (MeSH) terms as a guide. Visit: http://www.nlm.nih.gov/mesh/meshhome.html. The manuscript should include the following sections: 1) Original articles: Introduction, Methods, Results, Discus-

sion and References.2) Clinical case reports: Introduction, Clinical case, Discus-

sion and References.3) Clinicopathological cases: Clinical case, Discussion and

References.

An Acknowledgment section may be included directly following the Reference section. Granting institutions or other financial aid may be listed under Acknowledgments. If there are persons, other than the authors, who assisted with the study or preparation of the manuscript (i.e., technicians, nurses, ancillary health personnel, editorial assistance), they may be listed here.

ReferencesReferences should be numbered consecutively, double spaced, and listed in the order in which they appear in the text using ara-bic numbers (in the text, references are indicated by superscript arabic numbers after any punctuation). The Reference section should follow the last section of the manuscript. It is not neces-sary to begin the References on a separate page. The references should be formatted according to the instructions from the U.S. National Library of Medicine. Abbreviated journal names should reflect the style of Index Medicus (visit http://www.nlm.nih.gov/tsd/serials/lji.html) When a reference cites six or fewer authors, names should be included for all authors. When there are seven or more authors, use the first six names followed by et al. Authors are responsible for the accuracy of references. Please use the following examples for presentation of references:

Journals:• Klimo P, Rao G, Brockmeyer D. Congenital anomalies of

the cervical spine. Neurosurg Clin North Am 2007;18:463-478.

• Published book:• Bell RM. Holy Anorexia. Chicago: University of Chicago

Press; 1985.• Book chapter:• Hudson JI, Hudson RA, Pope HG. Psychiatric comorbidi-

ty and eating disorders. In: Wonderlich S, Mitchell J, eds. Eating Disorders Review. Part 1. Oxford: Radcliffe Publis-hing; 2005. pp. 43-58.

• Internet consult: • McKusick VA. Klippel Feil syndrome. Online. Mendelian

inheritance in man (accessed: March 26, 2008). Availa-ble at: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=148900.

Tables and Figures All tables and figures including schemes, diagrams and table legends must be presented in an editable form. Do not “copy and paste” material from external sources.

TablesTables should be numbered using arabic numbers in the order in which they are cited in the text and include a short descriptive title. Tables should not reiterate information presented in the Results section. For preparation of Tables containing only data, use the “Table Editor” function of your word processing program. Do not insert any vertical lines. Use horizontal lines only for clarity of information under table headings. Confirm that infor-mation provided below each table heading is properly aligned and clearly identifiable. Tables containing schemes or diagrams should be prepared in PowerPoint; graphics with shading, bars, dispersions, etc. should be prepared using Excel. Each Table should be prepared on a separate page, following the Reference section. Table footnotes should include any abbreviations that need to be explained and notes relating to the Table should be presented alphabetically using superscript letters.

FiguresAuthors should number figures in the order in which they ap-pear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a self-explanatory legend. Digital images should be legible and printed with a resolution of not less than 300 dpi, using .jpg (jpeg) or .bmp extension. If photographs submitted correspond to actual patients, the anonymity of the patients should be protected or written per-mission from the patient and/or family/legal guardian to publish the photograph(s) should be submitted. Figure legends with corresponding figure numbers should be typed consecutively on a separate page following the last Table (or following the Acknowledgments if there are no Tables).

Permission to use previously published Tables or FiguresIf the manuscript contains Tables or Figures that have been pre-viously published, permission must be obtained from the original Publisher in order to reproduce the material. This applies to Ta-bles or Figures that have been modified, adapted or translated. A sample “permission” letter is available from the Editorial Office of Boletín Médico del Hospital Infantil de México. Appropriate credit must be written per the following example:

Reprinted (or Adapted, Modified, Translated) from Castilloux J, Noble AJ, Faure C. Risk factors for short- and long-term morbidity in children with esophageal atresia. J Pediatr 2010;156:755-760. With permission.

Ethical approval of studies and informed consentIn regard to possible ethical conflicts, the rights of patients of privacy and confidentiality shall be maintained. For studies involving human subjects, state the manner in which informed consent was obtained from the study participants (i.e., oral or written). All manuscripts reporting data from studies involving humans or animals are subject to formal review and approval by an appropriate institutional review board or ethics committee and should be described at the end of the Methods section. For investigators who do not have formal ethics review committees, the principles outlined in the Declaration of Helsinki as well as in the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources, Commission on Life Sciences, National Research Council) should be followed. Review process The first review of the manuscript is performed by the Editor to assure that the manuscript corresponds to the theme of the journal and that all required information has been properly submitted in accordance with the Guidelines to Authors. The second review is carried out by two independent reviewers who have been assigned to the manuscript on the basis of their field of expertise. The identities of authors’ and reviewers’ are kept confidential.

CopyrightAll accepted manuscripts become the permanent property of the Boletín Médico del Hospital Infantil de México and may not be published elsewhere, in whole or in part, without prior written permission from the Editor and appropriate credit to the authors and to Boletín Médico del Hospital Infantil de México. Upon acceptance of an article for publication in Boletín Médico del Hospital Infantil de México, a letter signed by all authors shall be submitted transferring copyright of the published article to Boletín Médico del Hospital Infantil de México. If the author(s) wishes to reprint any of the material already published in Boletín Médico del Hospital Infantil de México, prior authorization is required from the Editor.

Note: For periodic up-to-dates of "Guidelines to Authors", please consult our internet page: www.himfg.edu.mx

Boletín Médico ISSN-1665-1146himfg.com.mx/descargas/documentos/BMHIM_2012/BMHIM... · Boletín...

Documents

Transcript of Boletín Médico ISSN-1665-1146himfg.com.mx/descargas/documentos/BMHIM_2012/BMHIM... · Boletín...