Blood study guide due next class!!!!!!!!!
-
Upload
debra-joseph -
Category
Documents
-
view
23 -
download
1
description
Transcript of Blood study guide due next class!!!!!!!!!
![Page 1: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/1.jpg)
Blood study guide due next class!!!!!!!!!
![Page 2: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/2.jpg)
Do Now!• Write 1 thing you know about DNA on the
board !
![Page 3: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/3.jpg)
DNA Profiling
![Page 4: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/4.jpg)
![Page 5: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/5.jpg)
![Page 6: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/6.jpg)
![Page 7: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/7.jpg)
![Page 8: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/8.jpg)
![Page 9: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/9.jpg)
•Identify or eliminate suspects
•Exonerate wrongly accused
•Identify victims of crimes or catastrophes
•Establish paternity
•Link crime scenes together
![Page 10: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/10.jpg)
Paternity Cases• Who’s your daddy?1.
2.
1. 2.
![Page 11: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/11.jpg)
Exoneration• Kirk Bloodsworth
– Convicted in 1985 for the rape and strangulation of a 9-year old girl and sent to death row
– In 1992, defense attorneys were successful in having a dime-sized semen stain on the girl’s underpants tested against Bloodsworth’s DNA
– He was exonerated
![Page 12: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/12.jpg)
DNA Profiling• “I didn’t understand the DNA stuff at all. To
me, it was just a waste of time. It was way out there and carried absolutely no weight with me at all.”
• Post-trial commentary from a juror in the O.J. Simpson trial: V. Bugliosi, Outrage (New York: Dell Publishing, 1996).
• “In a forensic setting, ... an innocent suspect has little to fear from DNA evidence, unless he or she has an evil twin.”
• N. Risch & B. Devlin, “On the Probability of Matching DNA Fingerprints” (1992) 255 Science.
![Page 13: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/13.jpg)
![Page 14: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/14.jpg)
RFLPs• DNA is cut by molecular “scissors” – enzymes
which recognize particular sequences of nucleotides
• These enzymes identify short sequences of DNA, then snip it
• Because everyone’s DNA is different, enzymes cut in different places
• The resulting samples contain DNA fragments of different size (Restriction Fragment Length Polymorphisms)
![Page 15: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/15.jpg)
RFLP: Gel Electrophoresis
• DNA is visualized using electrophoresis• Negatively charged DNA moves through a gel with a
current• Smaller DNA moves faster than larger DNA fragments
![Page 16: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/16.jpg)
![Page 17: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/17.jpg)
Results?
![Page 18: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/18.jpg)
![Page 19: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/19.jpg)
![Page 20: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/20.jpg)
![Page 21: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/21.jpg)
How unique are these profiles?
• The probability of 2 people having exactly the same DNA profile is between
1 in 5 million to1 in 100 billion
(greater than the population of humans on earth)• This number becomes even larger if you
consider more regions of DNA
• Thus, the odds that the DNA evidence from a crime scene will match your DNA profile is astronomically small (unless you have an evil identical twin)
![Page 22: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/22.jpg)
![Page 23: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/23.jpg)
![Page 24: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/24.jpg)
![Page 25: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/25.jpg)
PCR allows us to use STRs
• Short Tandem Repeats– Newer method than RFLPs– Faster– Uses 13 different primers to isolate the 13
different loci as identified by the FBI
![Page 26: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/26.jpg)
![Page 27: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/27.jpg)
![Page 28: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/28.jpg)
For example, D7S280 is STR that repeats ‘GATA’
• CTAACGATAG ATAGATAGAT AGATAGATAGATAGATAGAT AGATAGATAG ATA
• How many GATA’s? • So at this loci (location) the person’s # is
_______
![Page 29: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/29.jpg)
Narrowing it down
• You can calculate the probability that two people would have same # of STR’s for EACH of the 13 loci…..it’s nearly impossible!
![Page 30: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/30.jpg)
![Page 31: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/31.jpg)
![Page 32: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/32.jpg)
![Page 33: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/33.jpg)
![Page 34: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/34.jpg)
![Page 35: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/35.jpg)
![Page 36: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/36.jpg)
Case Study: The First Use of DNA Evidence
• Two teenage girls raped and murdered in Leicestershire, England
• Semen from the victims indicated a male with Type A blood and a rare enzyme = 10% of the local male population
• A local boy, Richard Buckland, confesses upon interrogation
• Police use DNA fingerprinting to confirm, but DNA profiles of Buckland and crime scene DNA do not match
• Ironically, Buckland becomes the first person exonerated by DNA evidence
![Page 37: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/37.jpg)
Case Study: The First Use of DNA Evidence
• Police request DNA samples from all adult males in 3 nearby villages (5000 men)
• 6 months later – no results!• A year later, police are informed by a
bakery worker that they overheard a co-worker bragging they had given a DNA sample for another man
• Police obtain DNA from Colin Pitchfork and obtain a perfect match
![Page 38: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/38.jpg)
The Result?• In 1988, Colin Pitchfork was tried and
convicted and sentenced to life in prison for the double rape and homicide based in large part to the DNA evidence
![Page 39: Blood study guide due next class!!!!!!!!!](https://reader036.fdocuments.in/reader036/viewer/2022062521/5681307e550346895d965932/html5/thumbnails/39.jpg)
O.J. Simpson Trial-Discussion Q’s
• What was the crime?• What was the evidence?• What was the defense
team’s strategy?• What can future
prosecution teams learn from this trial?