Biotransformation of citrinin to decarboxycitrinin using an organic solvent-tolerant marine bacterium, Moraxella sp. (MB1).

Prabha Devi*, Chandrakant Govind Naik and Celina Rodrigues

Chemical Oceanography Division, National Institute of Oceanography, Dona Paula, Goa 403 004 INDIA.

Abstract: Organic solvent tolerant microorganisms (OSTM) are novel group of

extremophilic microorganisms that have developed resistance to withstand

solvent toxicity. These organisms play an important role in biotransformation of

organic compounds. In the present study, we used an organic solvent-tolerant

marine bacterium, Moraxella sp. MB1. 16S rRNA sequencing revealed that the

bacterium shows 98% similarity with an uncultured marine bacterium with gene

bank accession number AY936933. This bacterium was used for the

transformation of a toxin, citrinin, into decarboxycitrinin in a biphasic system. This

transformation was affected by decarboxylase enzyme produced by MB1.

Transformation of citrinin to decarboxycitrinin was monitored by thin layer

chromatography (TLC) and spectrophotometrically. Citrinin decarboxylase

activity responsible for transformation was studied in cell-free growth medium

and cell lysate of Moraxella sp. MB1. Citrinin decarboxylase was found to be

intracellular in nature. The biotransformed product was purified and identified as

decarboxycitrinin using Electrospray Ionization Mass Spectrometer (ESI-MS/MS)

and Nuclear Magnetic Resonance (NMR) spectrometer. The antibiotic activity of

both citrinin and decarboxycitrinin is also reported.

Key words: Biotransformation; citrinin; decarboxycitrinin; Moraxella sp.; decarboxylase; nephrotoxin.

* Corresponding author. Email: dprabha@nio.org

1. INTRODUCTION

Biotransformation reactions are the subject of increasing interest in the

pharmaceutical industry because of the demand for enantiomerically pure

compounds (Schulze and Wubbolts, 1999). Biotransformation processes that

involve enzymatic or microbial biocatalysts, when compared to their chemical

counterparts, offer the advantages of high selectivity and mild operating

conditions. For example esterases are being increasingly recognized as useful

for stereospecific manipulation of esters (Cornec et al., 1998). Similarly,

decarboxylation reaction using microorganisms (biocatalysts) is increasingly

used for regio- and stereo-specificity of the end product (Ward and Singh, 2000).

Use of biocatalyst also minimizes the problems of isomerization, racemization,

epimerization, and rearrangement that are common in chemical processes

(Patel, 2000). However, biotransformation of water insoluble compounds is

hindered mainly because of their low solubility in aqueous medium. In such

instances, two-phase systems (aqueous medium-organic solvent) are likely to be

advantageous for biotransformation.

Organic solvents are generally toxic to microorganisms. However, organic

solvent-tolerant bacteria (OSTB) are group of microorganisms with novel

tolerance mechanisms to organic solvents. A number of microorganisms i.e.

Pseudomonas putida IH-2000 (Inoue and Horikoshi, 1989), Pseudomonas

aeruginosa ST-001 (Aono et al., 1992), Pseudomonas putida Idaho (Cruden et

al., 1992), Pseudomonas sp. strain TOR (Nakajima et al., 1992), P. aeruginosa

LST-03 (Ogino et al., 1994), Bacillus pumilus (In-Young Lec, 1998), Pseudomona

sp. strain ST-200 (Doukyu and Aono, 1998), P. putida S12 (Isken et al., 1999), P.

aeruginosa PST-01 (Ogino et al., 2001), Bacillus sp. BC1 (Sardessai and Bhosle,

2003), are reported to grow in media containing various amounts of organic

solvents (cyclohexane, p-xylene, 1-octanol, toluene, 1-heptanol, benzene etc.).

These bacteria have mechanisms available to cope with the deleterious effects of

organic solvents. Hence they may be successfully employed as biocatalysts in

non-aqueous conditions (Bont, 1998).

In the present study, we use Moraxella sp. MB1 from a marine source as

an organic solvent tolerant bacterium. This culture was used in the

transformation of citrinin. Citrinin is a mycotoxin reported to be initially isolated

from Penicillium citrinum from where it derived its name (Hetherington and

Raistrick, 1931). In the present study, citrinin was isolated as a secondary

metabolite from Penicillium chrysogenum, isolated from marine environment

(Prabha Devi et al., communicated.). Citrinin is a lemon yellow colored solid,

which appears as a fluorescent spot at 366 nm on TLC plate. It is poorly soluble

in water but readily soluble in organic solvents. This compound is a broad-

spectrum antibiotic, however, due to its nephrotoxic effects on experimental

animals it has limited pharmaceuticals applications (Sankawa et al., 1983;

Bilgrami et al., 1998). We have attempted to transform this compound

selectively into a product (decarboxycitrinin), which retained its antibiotic activity

and at the same time is not toxic to test animals (Jackson and Ciegler, 1978).

We use microbial enzymes for the transformation. According to Chandrasekaran

(1997), microbial enzymes are relatively more stable than corresponding

enzymes derived from plants or animals.

Thus, this paper reports on the transformation of a toxin, citrinin into a non

toxic compound decarboxycitrinin aided by the marine bacterium, Moraxella sp.

The enzyme decarboxylase produced by Moraxella sp. is also stable in the

presence of the organic solvent, and an attempt is made to understand the

nature of its origin. Furthermore, the biotransformed product from the

fermentation medium is isolated, purified and identified using Electrospray

Ionization Mass Spectrometer (ESI-MS/MS), Nuclear Magnetic Resonance

(NMR) spectrometer and tested for antibiotic activity.

2. MATERIALS AND METHODS

2.1. Isolation of citrinin

Citrinin was isolated from the fermentation broth of Penicillium chrysogenum

(MTCC 5108). Details of the isolation, purification and identification of citrinin is

described in Devi et al., (personal communication). Pure crystalline citrinin is

lemon yellow in color, poorly soluble in water but soluble in organic solvents.

2.2. Culture medium

During this study two different media namely nutrient agar and nutrient broth

medium was used (HiMedia). The nutrient agar medium comprised of 5 g of

peptic digest of animal tissue, 5 g of NaCl, 1.5 g of Beef extract 1.5 g of Yeast

extract and 20 g of Agar dissolved in one liter of seawater:distilled water (1:1,

V/V). This nutrient agar will henceforth be referred to as NA. The second

medium, the nutrient broth medium, comprised of 5 g of peptic digest of animal

tissue, 5 g of NaCl, 1.5 g of Beef extract and 1.5 g of Yeast extract prepared in

seawater:distilled water (1:1, V/V). This medium had a salinity of 16 ppt and its

pH was adjusted to 7.5. This nutrient broth medium will henceforth be referred to

as NB medium.

2.3. Sample collection and isolation of associated bacteria

The seaweed sample Elysia sp. was collected from Malvan (16˚ 50’ N; 17˚ 35’

E), Goa coast, India. A small portion of the seaweed was rinsed using sterile

seawater and then placed on nutrient agar plate and incubated at room

temperature (27 + 2oC) for 24 hrs. The colonies grown on the plates were

isolated, streaked and repeatedly sub cultured on the basis of colony

characteristics till pure cultures were obtained.

2.4. Test for solvent tolerance

The pure cultures obtained were tested for their potential to grow in the presence

of organic solvent as described earlier (Ogino et al., 1995). The pure cultures

were spread plated on nutrient agar plates and were overlaid with 5-6 ml of

organic solvent (hexane, ethyl acetate and methanol) and incubated at 27oC for

24 h. After 24 h incubation, only those cultures, which showed mat-type growth,

were considered (Table 1).

2.5. Sensitivity of culture to citrinin

Briefly, nutrient agar plates were inoculated and spread with each culture

consisting of approximately 1.2 x 108 CFU/ml separately and discs loaded with

citrinin (50 µg disc-1), were placed on the surface of the medium. Following an

incubation period of 24 h at 27oC, microbial growth inhibition was visualized and

quantified by measuring the clear zone around the disc (Table 1).

2.6. Bacterial strain

The culture MB1 which was Gram-negative, non-motile, coccobacillus was

identified as Moraxella sp. and has been deposited at the Bio-organic section of

the National Institute of Oceanography (accession no. NIOCC/OSTB-MB1). Its

morphological and biochemical characteristics are given in Table 2.

2.7. 16S rRNA Sequence analysis

The PCR amplification, sequencing and phylogenetic analysis of the microbial

culture was carried out as described by Hentschel et al (2001) and Thakur et al.

(2004).

DNA was extracted from the stationary phase culture using Bioron DNA

isolation kit (Kit no. 501001). PCR amplification was performed in a total volume

of 50µl containing the appropriate reaction buffer and reagents and the universal

primer 27f (5’-GAGTTTGATCCTGGCTCA-3’) corresponding to Escherichia coli

16S rDNA numbering. The PCR conditions were as follows: initial denaturation

(2 min at 95oC), followed by 30 cycles of denaturation (1 min at 95oC), primer

annealing (1 min at 52oC) and primer extension (1.5 min at 72oC).

The PCR amplification product was purified using a Qiagen kit (Kit no.

28104). The recovered fragment was sequenced using ABI 3700 Sequencer.

The obtained sequence was subjected to BLAST search for closest match in the

database.

2.8. Culture inoculum

The culture Moraxella sp. MB1 from NA slants was grown in 25 ml NB medium.

Cultures were incubated with shaking at 200 rpm at 27oC for 24h. This was used

as inoculum for further studies described below.

2.9. Tolerance of Moraxella sp. MB1 in liquid medium

Culture MB1 was tolerant to hexane, ethyl acetate and methanol. Hexane did

not dissolve citrinin and methanol did not form a biphasic medium essential for

the experiment. Hence, ethyl acetate was the preferred solvent. The culture was

tolerant to ethyl acetate evidenced by mat type growth on NA plates overlaid with

solvent. Its tolerance to ethyl acetate was also studied in liquid NB medium.

This experiment was repeated thrice. Two sets of 500 ml Erlenmeyer flasks were

taken. To one set of flasks containing 200 ml of NB medium, 2 ml of inoculum

(grown as above) was added which served as control. To the second set of

flasks containing 100 ml of NB medium supplemented with 100 ml of ethyl

acetate, 2 ml of inoculum was added (experimental flasks). Both the sets of

flasks were incubated at room temperature (27+1oC) on a shaker (200 rpm) for

24 h. Growth of the culture (cell density) in both the flasks (control and

experimental) was monitored separately by measuring OD at 540 nm on a UV-

VIS Spectrophotometer (Shimadzu, UV 2401 PC) at intervals of 30 min. (Fig. 1).

2.10. Biotransformation of citrinin

After confirming Moraxella sp. MB1 to be ethyl acetate tolerant as well as citrinin

insensitive, the biotransformation experiment was conducted twice with two

replicates per experiment. Two ml of MB1 (from the original inoculum) was

added to a 500 ml Erlenmeyer flask containing 100 ml NB medium supplemented

with 100 ml of ethyl acetate. To another flask containing 100 ml NB

supplemented with 100 ml ethyl acetate, no culture was added (control). To

both the flasks (with and without the culture, MB1), 4 mg citrinin was added to the

ethyl acetate (100 ml) layer. The flasks were incubated on a shaker (200 rpm) at

room temperature (27+ 1oC) and the fermentation was allowed to proceed for 30

h. At every 30 min intervals, 1 ml from the organic phase was removed under

sterile conditions from both the experimental and the control flasks.

Transformation of citrinin using this 1 ml of organic solvent was assessed by

spotting 2 µl of extract on silica gel thin layer chromatography (TLC) sheets. The

remaining extract was concentrated to dryness in vacuo. To this dry product, 5

ml of methanol was added and absorbance was measured

spectrophotometrically. This process was continued till the completion of

biotransformation indicated by the disappearance of citrinin from the organic

medium (monitored by TLC and OD measurements).

Thin layer chromatography (TLC) was performed on aluminium sheets

pre-coated with 200 mm layer of Silica gel 60 F254 (Merk KgaA, Damstadt,

Germany, Cat No. 1.05554). The plates were developed using chloroform:

acetic acid (99:1%) and visualized after keeping the plates in iodine chamber for

2 minutes.

Another set of flask, each flask containing 50 ml NB, 50 ml ethyl acetate

(containing 2 mg of citrinin) inoculated with culture Moraxella sp. MB1 and

another flask without the culture were incubated undisturbed from the start till the

end of the experiment (30 h). At the end of the incubation period, both the flasks

were extracted separately with ethyl acetate (3 x 10ml) and dried in vacuo. The

weight of citrinin and decarboxycitrinin recovered from the medium was

estimated by weighing the compounds using a microbalance (Sartorius, BL

210S).

2.11. Enzymatic activity

The culture Moraxella sp. MB1 was grown in NB medium and incubated for 24 h.

At the end of the incubation period the culture cells were recovered from the

medium by centrifugation at 10,000 x g at 20oC for 20 minutes. To 5 ml of cell-

free supernatant was added 5 ml of ethyl acetate containing 2 mg of citrinin and

incubated for 30 h at 27oC with shaking at 200 rpm. At the end of incubation

period, the end product formed was extracted using ethyl acetate (3 x 10 ml).

The combined ethyl acetate fraction was evaporated to yield crude extract.

The cell suspension (0.5 ml) was repeatedly washed (twice) in phosphate

buffer (0.2 M, pH 7.5) and centrifuged at 10,000 x g for 20 min at 20oC. The

resulting pellet was resuspended in the same buffer (5 ml) and lysed by

sonication using Ultrasonics (Transsonic 460/H, Elma, UK). The lysate was

centrifuged at 10,000 x g at 20oC for 20 min and the supernatant was carefully

separated from the cell debris. To 5 ml of supernatant, 2 mg of citrinin was

added dissolved in 5 ml of ethyl acetate solvent and incubated at room

temperature. At the end of incubation period (4 h), the end product formed was

extracted with ethyl acetate as above to yield crude extract.

2.12. Purification of biotransformed product

The crude biotransformed product was separated from the experimental flasks,

and from the supernatant of cell lysate using ethyl acetate. The crude extract

was subjected to column chromatography on silica gel (60-120 mesh size) with

petroleum ether:ethyl acetate gradient to give pure decarboxycitrinin. Pure

decarboxycitrinin was used for spectrophotometric analysis (Fig. 2) and for

obtaining mass spectral data (Fig. 3) using an ESI-MS/MS (QSTAR XL System)

and 1HNMR data using a Bruker Avance AC 300 Spectrometer.

For obtaining MS data, the ion spray voltage used was 5.5 kv and the

collision cell voltage was variable for different set of experiments. About 1 m

mol of sample was dissolved in methanol containing 0.1% formic acid in water.

Sample was introduced using a syringe infusion pump and the scan rate was

1sec/cycle. About 10 scans were averaged to get a spectrum.

For obtaining 1H NMR data, the chemical shifts were measured in parts

per million (ppm) with tetramethylsilane (TMS) as reference. CDCl3 (99.96%D)

was used as a solvent.

2.13. Screening activity

The antibiotic activity of decarboxycitrinin was assessed using disc diffusion

assay against 7 clinical pathogens. A comparison between the activity of citrinin

and decarboxycitrinin is shown in Table 4. The procedure used for the screening

was identical to that used for testing sensitivity of Moraxella sp. MB1 to citrinin.

3. RESULTS

3.1. Isolation of MB1

A number of marine bacteria were screened to assess their potential to tolerate

organic solvents (Table 1). From 6 strains of marine bacteria, MB1 (Gram-

negative, non-motile, coccobacillus), identified as Moraxella sp. was selected for

the study. The morphological and biochemical characteristics of Moraxella sp.

MB1 are shown in Table 2. Partial 16S rRNA sequence obtained from the

culture is GGATGTTAGCGGCGGACGGGTGAGTACACGTGGGTAACCTGCC

TGTAAGACTGGGATAACTCCG. This bacterium shows 98% homology with the

deposited sequences of uncultured marine bacterium clone ISA-3133 16S rRNA

gene, partial sequence (535bp), with Gene bank accession number AY936933.

Sequence alignment of the amplified 16S rRNA fragment of MB1 (Query) with

Uncultured marine bacterium clone ISA-3133 (Sbjct) is shown below:

Query: 3 atgttagcggcggacgggtgagtacacgtgggtaacctgcctgtaagactgggataactc 62

|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||

Sbjct: 86 atgttagcggcggacgggtgagaacacgtgggtaacctgcctgtaagactgggataactc 145

Query: 63 cg 64

||

Sbjct: 146 cg 147

Pure culture MB1 showed mat-type growth when grown on NA plates overlaid

with organic solvent (hexane, ethyl acetate and methanol). However, ethyl

acetate was the most preferred solvent for the study considering the solubility of

citrinin and the need for obtaining a biphasic medium. In addition to solvent

tolerance, Moraxella sp. MB1 was most resistant to citrinin as compared to the

other cultures used for screening (Table 1).

Results of the experiment wherein, the pure culture MB1 was grown in NB

medium supplemented with 50% of ethyl acetate and without ethyl acetate is

shown in Fig. 1. There was no marked difference in the growth pattern of MB1

when grown in the presence and absence of ethyl acetate.

3.2. Biotransformation

Results of biotransformation at the end of 30 h in the control flasks (containing

citrinin without the culture MB1 in the growth medium) showed no change in

citrinin while the experimental flask containing citrinin with culture MB1 in growth

medium showed the transformed product. This experiment proved that

transformation of citrinin has occurred due to enzymatic activity. The recovery of

citrinin in the control flasks when extracted with ethyl acetate was 95% (1.9 mg).

The recovery of decarboxycitrinin from the experimental flask (containing culture)

was quantified and found to be 85% (1.7 mg). Visual examination showed

citrinin to be fluorescent yellow in color, having Rf value of 0.6 (when developed

on TLC) and it showed absorption at λmax 213, 253 and 321 nm respectively.

Decarboxycitrinin on the other hand, was reddish-brown in color, had Rf value of

0.2 and showed absorption at λmax 212, 265 and 409 nm respectively. A

comparison of the UV absorption maxima for both citrinin and decarboxycitrinin is

shown in Fig. 2.

3.3. Enzyme activity

Experimental flasks containing culture of Moraxella sp. MB1 grown in NB

medium supplemented with 50% ethyl acetate showed conversion of citrinin into

decarboxycitrinin, which was not the case with control flasks without the culture.

This clearly indicates that enzymatic activity has aided in the biotransformation of

citrinin to decarboxycitrinin. In order to confirm whether the enzyme responsible

for the transformation was extracellular or intracellular in nature, cell free culture

medium and cell lysates were further studied. Citrinin when added to cell-free

culture medium did not show the presence of decarboxycitrinin. However,

supernatant collected from cell lysate transformed citrinin to decarboxycitrinin.

From these results it was evident that citrinin was transformed into

decarboxycitrinin by the citrinin decarboxylase, which was clearly intracellular in

nature.

3.4. Structural information

In addition to routinely used TLC techniques and spectrophotometric assay,

confirmation of the structure was done based on Mass spectral data using ESI-

MS/MS (Fig. 3) and 1H NMR spectral data. Mass spectrum in the positive ion

mode revealed a molecular ion (M+H)+ at m/z 251.0387 for citrinin and hence a

molecular formula of C13H14O5 while decarboxycitrinin showed a molecular ion

(M+H)+ at m/z 207.1765 and a molecular formula of C12H14O3. A loss of 44 amu

is evident in the mass data of decarboxycitrinin when compared with citrinin.

Further fragmentation pattern (Table 2) of product ions induced by high-energy

collision with nitrogen proved the structure of citrinin and decarboxycitrinin.

1H NMR spectral data of citrinin showed two doublets at δ1.291 (J=7.2

MHz) and δ1.173 (J=6.7 MHz), which is attributed to two methyl protons. The

four uncoupled resonance at δ1.964, δ8.181, δ15.00 and δ15.86 corresponds to

CH3, CH, COOH, and OH protons respectively. Two quartets at δ4.73 and

δ2.94 are due to CH linked to methyl protons. On the other hand, 1H NMR

spectral data of the biotransformed product showed absence of signals due to

chelated hydroxyl (δ15.86) and carboxyl (δ15.00) groups. Due to

decarboxylation, an additional signal at δ6.31 was observed confirming the

product to be decarboxycitrinin.

Comparison of the antibiotic activities of citrinin and decarboxycitrinin

using disc diffusion assay is shown in Table 4. There was no marked difference

in their activities when tested against clinical bacteria viz. Salmonella typhi,

Escherichia coli, Klebsiella sp., Vibrio cholerae and against drug resistant strains

of Staphylococcus pyogenes, Salmonella typhi, and Acinetobacter sp.

4. DISCUSSION

Biotransformation using whole cells or enzymes is an area of immense

importance. Advantages of enzyme-catalyzed reactions over chemical synthesis

are numerous. Hence, production of chemicals and bioactive compounds using

biological agents such as microorganisms, cells or enzymes is being considered

as a superior alternate to the traditional chemical methods

However, insolubility of the starting material in an aqueous medium many-

a-time hampers biotransformation. Even this condition is now overcome by using

microorganisms that are solvent tolerant called organic solvent-tolerant bacteria

(OSTB). OSTB can, not only, tolerate the presence of organic solvent but can

also grow in organic solvent medium (Inoue and Horikoshi, 1989). Such groups

of microorganisms are significant due to their use in non-aqueous transformation

of industrially important products. This group of OSTB may also be successfully

employed in environmental biotechnology when dealing with problems related to

detoxifying organic solvents from industries, effluent treatment and

bioremediation in hydrocarbon saturated environments (Aono et al., 1994; Abe et

al.,1995; Moriya et al., 1995).

Solvent tolerant bacteria have several mechanisms available to cope with

the deleterious effects of organic solvent (Bont, 1998). Jan de Bont and his

group have studied several aspects in solvent-tolerant Pseudomonas putida

strain, including composition of phospholipids, outer membrane protein,

modification of lipopolysaccharides, cell hydrophobicity , rates of turnover of

membrane components and the composition of the fatty acids of the

phospholipids (Weber et al., 1993; Weber et al., 1994). Solvent toxicity is stated

to be based on their log P values, wherein P is the partition coefficient of the

given solvent in equimolar mixture of octanol and water. Solvents with log P

values below 4 are considered extremely toxic because of partitioning into the

aqueous phase and from there into the bacterial membranes is very high,

causing cell death in most of the ordinary bacteria (Bont 1998).

In this study, MB1 was isolated from a marine source and identified as

Moraxella sp. This bacterium shows 98% homology with 16S rRNA gene (partial

sequence) of uncultured marine bacterium clone ISA-3133. The culture exhibited

excellent tolerance to a wide range of organic solvents viz. hexane, ethyl acetate

and methanol in the plate assay. The growth pattern of the culture did not show

any significant changes when grown in nutrient medium supplemented with 50%

ethyl acetate and without ethyl acetate (Fig. 1).

The culture Moraxella sp. MB1, in addition to being an OSTB was also not

sensitive to citrinin, which is a strong antibiotic. This was indicated by a very

small (1mm) zone of inhibition around the disc loaded with 50 µg.disc-1 of citrinin.

Citrinin, a quinone methine, is poorly water soluble but highly soluble in organic

solvents. It has very powerful antibacterial effects. It is known to show antibiotic

activity but its nephrotoxic properties prevent its use as a therapeutic drug

(Sankawa et al., 1983; Bilgrami et al., 1998). It is reported to have an LD50 of 67

mg kg-1 body weight when given subcutaneously or interperitoneally in rats and

19 mg kg-1 body weight when given intravenously to rabbits. The main aim of

this paper was to biotransform citrinin to a product, which retained its antibiotic

characteristics but at the same time showed minimum toxicity to experimental

animals. Curtis et al. (1968), reported decarboxycitrinin to be a natural

metabolite of P. citrinum. Further, Jackson and Ciegler (1978) observed that

decarboxycitrinin showed antibiotic properties and was not toxic to mice. With

this prior information in hand, we tried successfully to transform citrinin to

decarboxycitrinin using Moraxella sp. MB1, at room temperature in a biphasic

system.

Biotransformation of citrinin in experimental flasks (containing culture

MB1) and no transformation in control flasks (without culture) was direct

evidence to show that the culture cells aided in the transformation of citrinin. A

time dependent decrease in citrinin from the organic phase of the biphasic

system was monitored every 30 min spectrophotometrically and by TLC. The

absorption maxima for citrinin at λ max 253 and 321 nm decreased with time and

finally at the end of 30 h, there was no absorption at the above-mentioned

wavelengths. This marked the completion of transformation. The yield of the

transformed product was around 85% and the comparison of the absorption

spectrum for both citrinin and decarboxycitrinin is shown in Fig 2. The darker

color in decarboxycitrinin is due to the absorption at higher wavelength (408 nm).

Since, the enzyme citrinin decarboxylase was stable at room temperature

(27oC) and in the presence of ethyl acetate, further studies on citrinin

decarboxylase activity responsible for transformation was undertaken in cell-free

growth medium and cell lysate of Moraxella sp. MB1. Citrinin decarboxylase was

present in the supernatant filtrate of lysed cells. However, transformation was

not evident in the cell free culture medium, confirming the enzyme to be present

within the cells (intracellular).

Several other decarboxylases from microbial sources like pyruvate

decarboxylase (Saccharomyces cerevisiae, Kluyveromyces marxianus,

Neurospora crassa, Zymomonas mobilis), benzoylformate decarboxylase

(Pseudomonas putida, Pseudomonas aeruginosa, Acinetobacter calcoaceticus),

phenylpyruvate decarboxylase (Achromobacter eurydice, Acinetobacter

calcoaceticus, Thauera aromatica), alpha acetolacetate decarboxylase

(Klebsiella aerogenes, Lactococcus lactis, Bacillus subtilis) and arylmalonate

decarboxylase (Alcaligenes bronchisepticus) used in chemoenzymatic synthesis

have been compiled by Ward and Singh (2000).

The structure of citrinin and decarboxycitrinin was obtained from

Electrospray ionization mass spectrometry (ESI-ESI/MS) and 1H NMR

spectrometry. A comparison of the 1H NMR spectral data for both citrinin and

decarboxycitrinin showed absence of signal at δ15.00 and δ15.86 indicating

absence of chelated hydroxy and carboxy groups in decarboxycitrinin. It also

shows the appearance of a signal at δ6.31. This is in full agreement with the

structure for decarboxycitrinin. The mass spectrum of citrinin showed a molecular

ion (M+H)+ at m/z 251.0387 indicating its molecular formula to be C13H14O5 (Fig.

3). Similarly, mass spectrum of decarboxycitrinin showed a molecular ion

(M+H)+ at m/z 207.1765 indicative of a molecular formula of C12H14O3 (Fig. 4). A

loss of 44 amu is a very clear indication of a loss of carboxyl group

(decarboxylation). The decomposition of the ions at m/z 251 for citrinin and m/z

207 for the product decarboxycitrinin induced by high-energy collision with

nitrogen gave further fragment ions (Table 2), which confirmed the structure of

citrinin and decarboxycitrinin.

Thus, in conclusion we report citrinin decarboxylase from Moraxella sp.

MB1 transformed citrinin to decarboxycitrinin in a biphasic (aqueous-organic)

system. The biotransformation of the water-insoluble citrinin was complete by

the end of 30 h exposure of the compound to whole MB1 cells in the culture

medium. However, supernatant of cell lysate transformed citrinin into

decarboxycitrinin in 4 hours. No transformation was evident in cell free culture

medium clearly indicating citrinin decarboxylase to be of intracellular nature. This

enzyme was stable in ethyl acetate and at room temperature of 27oC. Citrinin is

a β-keto acid and it may be argued that decarboxylation of a β-keto acid occur

naturally. However, we did not observe such a decarboxylated product of citrinin

in control flasks without MB1 culture, thereby suggesting enzymatic conversion of

citrinin to decarboxycitrinin. Similar observations of this nature using different

strains of OSTB in various organic solvents were made by Ogina et al. (1994;

1995).

Furthermore, citrinin was earlier reported to be a broad spectrum

antibiotic, however, this property could not be utilized in pharmaceutical

applications due to the nephrotoxic effects on various experimental animals. We

attempted a screening for antibiotic activity using citrinin and decarboxycitrinin

against clinical bacterial pathogens as well as some multi-drug resistant bacteria.

There was no significant difference observed in their activities. Further study is

on to isolate, purify and characterize the enzyme responsible for decarboxylation

for industrial application.

Acknowledgements. The authors are grateful to Dr. S. R. Shetye, Director, NIO

for constant encouragement. The authors also wish to thank Dr. N.B. Bhosle

(Scientist, NIO), Dr. C. Raghukumar (Scientist, NIO) and Irene Furtado (Reader,

Goa University) for their valuable suggestion and guidance. Thanks are also

extended to Dr. Loka Bharathi (Scientist NIO) for identifying the bacterial culture

and Dr. N. Thakur (Scientist, NPRC, Mumbai) for providing the 16s RNA data.

One of the authors (CR) is grateful to DOD for award of fellowship and another

author (PD) is particularly indebted to Council of Scientific and Industrial

Research (CSIR), New Delhi, for the award of Research Associateship. Sincere

thanks to The Dean, Goa Medical College, for providing the clinical pathogens.

REFERENCES

Abe, A., Inove, I., Usami, R., Moriya, K., and Horikoshi, K. (1995). Properties of newly isolated polyaromatic hydrocarbons marine bacterium that can degrade in the presence of organic solvents. J Mar Biotechnol 2: 182-186.

Aono, R., Ito, M., Inoue, A., and Horkoshi. K. (1992). Isolation of novel toluene tolerant strain of Pseudomonas aeruginosa. Biosci Biotechnol Biochem 56: 145-146.

Aono, R., Doukyu, N., Kobayashi, H., Nakajima, H., and Horikoshi, K. (1994). Oxidative bioconversion of cholesterol by Pseudomonas sp. Strain ST-200 in a water-organic solvent two-phase system. Appl Environ Microbiol 60, 2518-2523.

Bilgrami, K.S., Sinha, S.P., and Jewal P. (1998). Nephrotoxic and hepatoxic effects of citrinin in mice (Mus musculus). Proc Ind Nat Sci Acad B 54: 35-37.

Bont, J.A.M. (1998). Solvent tolerant bacteria in Biocatalysis. Trends in Biotechnol 16: 493-499.

Chandrasekaran, M. (1997). Industrial enzymes from marine microorganisms: The Indian scenario. J Mar Biotechnol 5: 86-89.

Cornec, L., Robineau, J., Rolland, J.L., Dietrich, J., and Barier, G. (1998). Thermostable esterases screened on hyperthermophilic archaeal and bacterial strains isolated from deep-sea hydrothermal vents: Characterization of esterase activity of a hydrothermophilic archaeum, Pyrococcus abyssi. J Mar Biotechnol 6: 104-110.

Cruden, D.L, Wolfram, J.H. Rogers, R.D., and Gibson, D.T. (1992). Physiological properties of a Pseudomonas strain which grows with p-xylene in a two-phase (organic-aqueous) medium. Appl Environ Microbial 58: 2723-2729.

Curtis, R.F., Hassall, C.H., and Nazar, M. (1968). The biosynthesis of phenols. XV. Some metabolites of Penicillium citrinum related to citrinin. J Chem Soc C., 85-93.

Doukyu, N., and Aono, R. (1998). Purification of extracellular cholesterol oxidase with high activity in the presence of organic solvents from Pseudomonas sp. strain ST-200. Appl Environ Microbiol 64 (5): 1929-1932.

Hentschel, U., Schmid, M., Wagner, M., Fieseler, L., Gernert, C., and Hacker, J. (2001). Isolation and phylogenetic analysis of bacteria with antibacterial activities from the Mediterranean sponges Aplysina aerophoba and Aplysina cavernicola. FEMS Microb Ecol 35: 305-312.

Hetherington, A.C., and Raistrick, H. (1931). Studies in the biochemistry of micro-organisms. XI. On the production and chemical constitution of a new yellow coloring matter, citrinin, produced from glucose by Penicillium citrinum, Thom. Philos. Trans. R. Soc. London Ser. B. 220: 267-297.

Inoue, A., and Horikoshi, K. (1989). Pseudomonas thrives in high concentrations of toluene. Nature (London) 338: 264-266.

Isken, S., Derks, A., Wolffs, P.F.G., and de Bont, J.A.M. (1999). Effects of organic solvents on the yield of solvent-tolerant Pseudomonas putida S12. Appl Environ Microbiol 65 (6): 2631-2635.

Jackson, L.K., and Ciegler, A. (1978). Production and analysis of citrinin in corn. Appl Environ Microbiol 408-411.

Lee IY, Volm, T.G., and Rosazza, J.P.N. (1998). Decarboxylation of ferulic acid to 4- vinylguaiacol by Bacillus pumilus in aqueous-organic solvent two-phase systems. Enzyme and Microbiol. Technol 23: 261-266.

Moriya, K., Yanigitani, S., Usami, R., and Horikoshi, K. (1995). Isolation and some properties of an organic-solvent-tolerant marine bacterium degrading cholesterol. J. Mar Biotechnol 2: 131-133.

Nakajima, H., Kobayashi, H., Aono, R., and Horikoshi, K. (1992). Effective isolation and identification of toluene-tolerant Pseudomonas strains. Biosci Biotechnol Biochem 56: 1872-1873.

Ogino, H., Miyamoto, K., and Ishikawa, H. (1994). Organic solvent-tolerant bacterium which secretes organic solvent-stable lipolytic enzymes. Appl Environ Microbial 60: 3884-3886.

Ogino, H., Yasui, K., Shiotani, T., Ishiwara, T., and Ishikawa, H. (1995). Organic solvent tolerant bacteria which secretes an organic solvent stable proteolytic enzyme. Appl. Envrion Microbiol 61: 4258-4262.

Ogino, H., Uchiho, T., Yokoo, J., Kobayashi, R., Ichise, R., and Ishikawa, H. (2001). Role of intermolecular disulfide bonds of the organic solvent-stable PST-01 Protease in its organic solvent stability. Appl Environ Microbiol 67: 942-947.

Patel, R.N. (2000). Stereoselective biocatalysis for synthesis of some chiral pharmaceutical intermediates. In Stereoselective Biocatalysis. Ed by Patel R.N. New York: Marcel Dekker Inc; 87-130.

Prabha Devi, Celina, R., and Naik, C.G. A process for the production, isolation and identification of citrinin from Penicillium chrysogenum and a report on its antibiotic activity. (Communicated).

Sankawa, U., Ebizuka, Y., Noguchi, H., Isikawa, Y., Kitaghawa, S., Yamamoto, Y., Kobayashi, T., and Iitak, Y. (1983). Biosynthesis of citrinin in Aspergillus terreus. Tetrahedron 39: 3583-3591.

Sardessai, Y., and Bhosle, S. (2003). Isolation of an organic-solvent-tolerant cholesterol-transforming Bacillus species, BC1, form coastal sediment. Mar Biotech 5: 116-118.

Schulze, B., and Wubbolts, M.G. (1999). Biocatalysis for industrial production of fine chemicals. Curr Opin Biotechnol 10: 609-615.

Thakur, N.L., Anil, A.C., and Muller, W.E.G. (2004). Culturable epibacteria of the marine sponge Ircinia fusca: temporal variations and their possible role in the epibacterial defense of the host. Aquat Microb Ecol 37:295-304.

Ward, O.P., and Singh, A. (2000). Enzymatic asymmetric synthesis by decarboxylases. Current Opinion Biotechnology. 11: 520-526.

Weber, F.J., Ooijkaas, L.P., Schemen, R.M.W., Hartmans, S., and Bont, J.A.M. (1993). Adaptations of Pseudomonas putida S12 to high concentrations of styrene and other organic solvents. Appl Environ Microbiol 59: 3502-3504.

Weber, F.J., Isken, S., and Bont, J.A.M. (1994). Cis/trans isomerization of fatty acids as a defence mechanism of Pseudomonas putida strains to toxic concentrations of toluene. Microbiol. 140: 2013-2017.

CAPTION TO FIGURES

Fig. 1- Growth of MB1 in the presence and absence of organic solvent.

Fig. 2 - Absorption spectrum of citrinin and decarboxycitrinin measured spectrophotometrically in methanol.

Fig. 3 - Mass spectrum of citrinin and decarboxycitrinin

Table 1. Tolerance of bacteria to organic solvents indicated by mat growth and disc diffusion assay for testing the sensitivity of cultures to citrinin.

Solvent tolerance (Mat growth) Bacteria Culture No. Hexane Ethyl acetate Methanol

Citrinin tolerance (50 µg.disc-1 ) Inhibition zone measured in mm

MB1 X X X 1 + 0.4

MB2 - - - 8 + 0.5

MB3 X - - 5 + 0.4

MB4 X - - 7 + 0.4

MB5 - - - 3 + 0.4

MB6 X X X 6 + 0.6

- Scanty growth

X- mat growth

Table 2. Microbiological characteristics of Moraxella sp. MB1.

Culture characteristics

Cell shape Short rods

Gram character Gram negative

Aerobiosis +

Motility -

Production of pigment -

Oxidase activity +

Catalase activity +

Carbonic anhydrase -

Acid production from D-Glucose -

Sensitivity to Penicillin Very sensitive

- Negative;

+ Positive

Table 3. ESI fragmentation of citrinin and decarboxycitrinin.

Major Fragment ions of citrinin Major Fragment ions of decarboxycitrinin

251 M+ 207 M+

233 (M+-18) M+ -H2O 189 (M+-18) M+ -H2O

205 (M+-46) M+ -H2O-CO 174 (M+-33) M+ -H2O-CH3

191 (M+-60) M+ -H2O-CO- CH3 161 (M+-46) M+ -3CH3

151 (M+-56) M+ -C4H8

150 (M+-57) M+ -C3H5O

119 (M+-88) M+ -H-C4H8O-CH3

101 (M+-106) M+ -H-C4H8O-CH3-H20

99 (M+-108) M+ -H-C7H9O

Table 4. Screening for antibacterial activity of citrinin and decarboxycitrinin against clinical pathogens

Bacterial pathogens Citrinin (150 µg.disc-1) Decarboxycitrinin (150 µg.disc-1)

Salmonella typhi 2 mm + 0.4 mm 2 mm + 0.6 mm

E. coli - -

Klebsiella sp. - -

Vibrio cholerae 6 mm + 0.5 mm 3 mm + 0.4 mm

Multiple drug resistant strains

Staphylococcus pyogenes 1 mm + 0. mm 2 mm + 0.4 mm

Salmonella typhi 2 mm + 0 mm 1 mm + 0.4 mm

Acinetobacter sp. 1 mm + 0 mm 1 mm + 0 mm

- No inhibition zone.

Fig. 3 - Mass spectrum of citrinin and decarboxycitrinin