Slide 1

BiotechnologyDNA Technology

What is BiotechBiobyte what is biotech

Restriction enzymesBacteria fight invading viruses with Restriction Enzymes.

Degrade phage DNA by cleaving (cutting) it into fragments. Steps 1 and 2

Why doesnt a restriction enzyme cut the DNA of the bacterial cell that makes it?

Methylation protects the bacterias own DNA from being cleaved.

ExampleFor example, the enzyme EcoRI cuts DNA only where it encounters the following paired sequence in the DNA double helix:

You try it!TCGAATTCTAGGCTAACCGGAGASTTCACCGTACGAATTCCTTCAGCAATTCAGACGTA

(video clip human physiology restriction enzymes)Restriction enzyme flash

Gel Electrophoresis When DNA is treated with restriction enzymes, the DNA is cut into fragments of various sizes.

These fragments can be separated in a gel on the bases on their electric charge and size.

Gel ElectrophoresisFlash video

DNA fingerprinting DNA-based technique for identifying individuals.

Uses restriction analysis and electrophoresis.Crime Scene and DNA fingerprinting

DNA FingerprintingDNA fingerprinting methods require at least 1 g of DNA, or the DNA content of about 100,000 human cells.polymerase chain reaction (PCR)Can multiply (amplify) the DNA of interest from even a single cell, producing in a few hours the necessary 1 g for restriction digestion and electrophoresis.PCR1) Double-stranded fragments of DNA are separated into single strands by heating (denatured).

PCR2) ADD:a) A short primer b) along with the Bases (A,C,T,G)c) DNA polymerase to catalyze the production of complementary new strands. (video polymerase chain reaction animated)

DNA Barcode

Paul Hebert at the University of Guelph in Ontario, Canada, has proposed to identify each species with a DNA barcode using a short sequence from a single gene. DNA BARCODE Identify each species with a DNA barcode

He chose is the cytochrome oxidase gene.

Mutates readily, there should be many differences between species.

Present in most cells

Reasonable in size (650-750 base pairs)Why DNA barcode?advance biological research on evolution

to track species diversity

help identify new species

detect undesirable microbes or bioterrorism agents

Make your own transgenic plant