Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  ·...

23
Biotechnology DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used in Biotechnology CRISPR

Transcript of Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  ·...

Page 1: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Biotechnology

DNA Cloning

Genetic Engineering

Gene Therapy

Common Techniques Used in Biotechnology

CRISPR

Page 2: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

What is DNA Cloning? Set of methods that uses live cells to make many identical copies of a DNA fragment

Restriction enzymes Cut DNA at specific nucleotide sequences Leave single-stranded tails/ “sticky ends”

Page 3: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Recombinant DNA A DNA molecule that contains genetic material from more than one organism

Page 4: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Cloning vector A DNA molecule that accepts foreign DNA and carries it into a host cell/ bacterial plasmids

Page 5: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Stone washed jeans

Protein to dissolve blood clots

Inserting gene for pest resistance

Altering bacteria for cleaning up toxic waste

DNA cloning mass produces specific DNA fragments

Page 6: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Technique used to mass-produce (amplify) copies of sections of DNA without having to clone in living cell

Polymerase chain reaction (PCR)

DNA Nucleotides Taq Polymerase Primers Buffers

Thermocycler

Steps Denaturation Annealing Elongation

Page 7: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...
Page 8: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

DNA Sequencing

Page 9: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Electrophoresis

Page 10: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Genomics: Study of whole-genome structure and function

Proteomics: Study of the comprehensive set of proteins produced by an organism or a cellular system

Bioinformatics: Developing computational tools to analyze and interpret biological data

758  GATAATCCTGTTTTGAACAAAAGGTCAAATTGCTGAATAGAAA–GTCTTGATTAACTAAAAGATGTACAAAGTGGAATTA  836  Human  752  GATAATCCTGTTTTGAACAAAAGGTCAAATTGCTGAATAGAAA–GTCTTGATTAACTAAAAGATGTACAAAGTGGAATTA  830  Mouse  751  GATAATCCTGTTTTGAACAAAAGGTCAAATTGCTGAATAGAAA–GTCTTGATTAACTAAAAGATGTACAAAGTGGAATTA  829  Rat  754  GATAATCCTGTTTTGAACAAAAGGTCAAATTGCTGAATAGAAA–GTCTTGATTAACTAAAAGATGTACAAAGTGGAATTA  832  Dog  782  GATAATCCTGTTTTGAACAAAAGGTCAAATTGCTGAATAGAAA–GTCTTGATTAACTAAAAGATGTACAAAGTGGAATTA  860  Chicken  758  GATAATCCTGTTTTGAACAAAAGGTCAAATTGCTGAATAGAAA–GTCTTGATTAAGTAAAAGATGTACAAAGTGGAATTA  836  Frog  823  GATAATCCTGTTTTGAACAAAAGGTCAGATTGCTGAATAGAAAAGGCTTGATTAAAGCAGAGATGTACAAAGTGGACGCA  902  Zebrafish  763  GATAATCCTGTTTTGAACAAAAGGTCAAATTGTTGAATAGAGACGCTTTGATAAAGCGGAGGAGGTACAAAGTGGGACC–  841  Pufferfish  

A gene for DNA Polymerase

Page 11: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

DNA Profiling Identifying an individual by analyzing the unique parts of his or her DNA

Page 12: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Human Genome Project/ completed 2003

Human genome consists of about three billion nucleotides Only about 21,000 genes Only about 1.5% of DNA contains genes that code for proteins

Page 13: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Costs are Decreasing Dramatically

Arabidopsis

Genome

3 Gb

0.125 Gb

Human ~$1 billion

$70 mil

Time to complete Length

5+ years

Cost by Sanger

4 years

Yeast 0.012 Gb 3 years $10 mil

Cost by Illumina

< $20

< $200

~$4000

Time to complete

< 2 week

< 2 week

< 2 week

Present time: few hours and $1000 to sequence the human genome

Page 14: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Ø Process by which an individual’s genome is deliberately modified

Ø Produces a genetically modified organism (GMO) Ø A gene may be altered and reinserted into an

individual of the same species Ø A gene from one species may be transferred to

another to produce an organism that is transgenic Ø Most common GMOs are bacteria and yeast

Genetic Engineering

Page 15: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

GM E. coli

GM Zebra fish

GM Goat

Page 16: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

GM bacteria Ø Produce medically important proteins such as

insulin

Ø Produce enzymes used in food manufacturing

Ø Produce enzymes used to improve taste of beer and fruit juice and slow bread from staling

Engineered Microorganisms

Page 17: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

GM Plants Disease resistance Improved yield Improved salt, frost, …. tolerance Improved nutritional value Resistance to pesticides

Page 18: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

The case of BT corn Enhanced through biotechnology to enable it to protect itself against the corn borer, which is one of the most destructive insects to damage or reduce corn production and one of the most economically significant crop pests in the world

Monarch butterflies

Page 19: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Ø Mice: used for medical research

Ø Goats: genetically engineered to have proteins that treat cystic fibrosis, heart attacks, etc.

Ø Rabbits: genetically engineered to make interleukin-2

Ø Pigs: modified for heart-healthy fat

Ø Trout and salmon: bigger versions

Ø Farm animals: produce more meat or milk

GM Animals

Page 20: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

www.GMOANSWERS.com

Page 21: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

Ø Tested to treat AIDS, Alzheimer, Cystic fibrosis, muscular dystrophy and others

Ø A genetically modified virus is used

Ø Risks

Experimental technique that is used to transfer a normal or modified gene into a person with a genetic disorder

Gene Therapy

Page 22: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

CRISPR Clustered Regularly Interspersed Short

Palindromic Repeats

Ø  Allows for genome editing

Ø  Removing mutated gene and replacing them by normal genes

Ø  Based on restriction enzymes that are guided to specific locations in the genome by specifically designed RNA molecules

Page 23: Biotechnology - websites.rcc.eduwebsites.rcc.edu/tayyar/files/2013/08/Chapter-15-Biote… ·  · 2017-10-27DNA Cloning Genetic Engineering Gene Therapy Common Techniques Used ...

https://www.bing.com/videos/search?q=crspr+videos&view=detail&mid=0533F06520B1126615B50533F06520B1126615B5&FORM=VIRE