Alyssa Stowe BIOL 1103 AT

It is most beneficial to you to write this mock midterm UNDER EXAM CONDITIONS.

This means:

• Complete the midterm in 3 hour(s). • Work on your own. • Keep your notes and textbook closed. • Attempt every question.

After the time limit, go back over your work with a different colour or on a separate piece

of paper and try to do the questions you are unsure of. Record your ideas in the

margins to remind yourself of what you were thinking when you take it up at PASS.

The purpose of this mock exam is to give you practice answering questions in a timed

setting and to help you to gauge which aspects of the course content you know well and

which are in need of further development and review. Use this mock exam as a

learning tool in preparing for the actual exam.

Please note:

• Come to the PASS workshop with your mock exam complete. During the

workshop you can work with other students to review your work.

• Often, there is not enough time to review the entire exam in the PASS workshop.

Decide which questions you most want to review – the Facilitator may ask

students to vote on which questions they want to discuss in detail.

• Facilitators do not bring copies of the mock exam to the session. Please print out

and complete the exam before you attend.

• Facilitators do not produce or distribute an answer key for mock exams.

Facilitators help students to work together to compare and assess the answers

they have. If you are not able to attend the PASS workshop, you can work alone

or with others in the class.

Good Luck writing the Mock Exam!!

Mock exam take-up: Friday, December 8th 6:00 – 9:00 PM (MC 2000)

Extra Office Hours: Wednesday, December 6th 2:00-4:00 PM (402 ML)

Alyssa Stowe BIOL 1103 AT

**Unless otherwise specified, assume independent assortment**

1. What is one way that cells are able to decrease their membrane fluidity? a. By increasing the level of cholesterol in the membrane b. By increasing the number of unsaturated fats in the membrane c. By increasing the number of phospholipids in the membranes d. By increasing the number of saturated fats in the membrane e. By increasing the number of proteins in the membrane

2. In the following reaction, the carbon molecule of glucose is ___________ to form carbon dioxide

and the oxygen molecule is ________ to form water.

C6H12O6 + 6 O2 6 CO2 + 6 H2O + Energy

a. oxidized, reduced b. reduced, oxidized c. oxidized, oxidized d. reduced, reduced e. This is not a REDOX reaction.

3. A genetically modified blue peach has the genotype BB and is autosomal dominant. The recessive

peaches of this variety are purple. Another gene in the peach turns it white when autosomal recessive. What is this interaction known as? a. Pleiotropy b. Epistasis c. Aneuploidy d. Incomplete Dominance e. Codominance

4. Which off the following can easily diffuse across the membrane?

a. Glucose b. Hydrogen ions c. Methane d. Potassium ions e. Sucrose

5. What is the final product of the Calvin cycle?

a. Biphosphoglycerate b. Pyruvate c. Carbon dioxide d. Glyceraldehyde phosphate e. Oxaloacetate

Alyssa Stowe BIOL 1103 AT 6. According to the second law of thermodynamics:

a. The total amount of energy in a closed system remains constant b. The disorder in a system tends to increase over time c. The total amount of energy in the universe remains constant d. The total amount of energy in the universe increases over time e. The disorder in a system tends to decrease over time

7. What is the driving force of facilitated diffusion?

a. A concentration gradient b. ATP c. Sucrose d. GDP e. Hydrophilic interactions

8. Which of the following polymer and linkage pairs are properly matched?

a. Nucleic acids – phosphodiester bonds b. Polypeptide – glycosidic linkage c. Polysaccharide – peptide bond d. Nucleic acids – ester linkages e. Polypeptide – ester linkages

9. A gene that normally encodes for a protein that is 50,000 g/mol in mass is exposed to a harmful

reagent. After it is transcribed into a protein, it is found that the protein is 18,000 g/mol in mass. What kind of mutation likely occurred? a. Missense mutation b. Frameshift mutation c. Nonsense mutation d. Silencing mutation e. Discontinuous mutation

10. Which of the following is a benefit of compartmentalization?

a. The isolation of potentially harmful products b. Organelles decrease quantity of membrane as a function of volume c. Allows cells to divide at a faster rate d. Simplification of metabolism e. Both a) and d) are correct

11. Which of the following describes a group of related genes in a prokaryote’s DNA?

a. Enhancer b. Inducer c. Promoter d. Operon e. Nucleus

Alyssa Stowe BIOL 1103 AT

12. What type of bond forms between complementary base pairs? a. Ionic bonds b. Hydrogen bonds c. Covalent bonds d. Disulfide bonds e. Peptide bonds

13. Rachel and Ross just got married. Ross was married once before and had albino child. Rachel has an

albino sister. Neither Ross, Rachel, nor any of their parents are albinos. Calculate the probability that Ross and Rachel will have an albino child. Albinism is an autosomal recessive disorder. a. 1/2 b. 1/4 c. 1/6 d. 2/3

14. How many different types of gametes could be produced through independent assortment by an

individual with a genotype AA Bb Cc DD Ee? a. 5 b. 6 c. 8 d. 16 e. 64

Use the following predigree to answer questions 15 and 16:

Alyssa Stowe BIOL 1103 AT

15. Which of the following best describes the disease in the above pedigree? a. X-linked dominant b. X-link recessive c. Autosomal dominant d. Autosomal recessive e. Y-link

16. In the above pedigree, what is the most likely genotype of the first generation male?

a. HH b. Hh c. hh d. XhY e. Either a or b

17. In a cross between a white-eyed female fruit fly and red-eyed male, what percent of the female

offspring will have white eyes? (White eyes are X-linked, recessive) a. 100% b. 75% c. 50% d. 25% e. 0%

18. A female Drosophila of unknown genotype was crossed with a white-eyed male fly, of genotype

(w = white eye allele is recessive, w+= red-eye allele is dominant.) Half of the male and half of the female offspring were red-eyed, and half of the male and half of the female offspring were white-eyed. What was the genotype of the female fly? a. Xw Y b. Xw Xw c. Xw+ Xw d. Xw+ Xw+ e. Xw+ Y

19. Hemophilia in humans is due to an X-chromosome mutation. What will be the results of mating

between a normal (non-carrier) female and a hemophiliac male? a. 50% of sons are hemophiliacs, 50% of daughters are hemophiliacs b. 100% of sons are hemophiliacs c. 100% of daughters are hemophiliacs d. 50% of sons are normal, 50% of sons are hemophiliacs and 100% of daughters are carriers e. 100% of daughters are carriers, 100% of boys are normal

20. 19. A _________ reaction occurs when a disaccharide is formed from two monosaccharides.

a. Dehydration b. Oxidation c. Hydrolysis d. Reduction e. Hydrophilic interaction

Alyssa Stowe BIOL 1103 AT

21. Where do genetic differences in prokaryotes arise from?

a. Crossing-over during prophase 1 b. Mutations that arise during DNA replication c. Through the independent assortment of chromosomes during meiosis d. Recombination through the processes of transformation, transduction or conjugation e. Both b and d are correct

22. A white flower (rr) is crossed with a red flower (RR), the F1 generation is 100% pink. What is this

pattern of inheritance called? a. Codominance b. Epistasis c. Incomplete dominance d. Polygenic inheritance e. Pleiotropy

23. Which of the following pathways involves the splitting of a water molecule?

a. Calvin Cycle b. Non-cyclic electron transport c. Cyclic electron transport d. Kreb’s cycle e. Light-independent reactions

24. Peroxisomes….

a. Contain hydrolytic enzymes b. Fuse with food vacuoles and digests the molecules c. Contain enzymes that transfer hydrogen from various substrates to oxygen d. Participate in DNA replication e. Both a and b are correct

25. During which phase of mitosis does the nuclear envelope fragment?

a. Prophase b. Prometaphase c. Metaphase d. Anaphase e. Telophase

26. When during the cell cycle is cyclin concentration highest?

a. End of mitosis b. Early G1 c. Late G1 / early S d. Late S / early G2 e. Beginning of mitosis

Alyssa Stowe BIOL 1103 AT 27. The dominant P allele of a gene that controls colour in pea flowers produces petals with a purple

colour; plants homozygous for a recessive p allele of this gene have white flowers. If a Pp plant and a

Pp plant were crossed, what would be the expected phenotypic ratios of the offspring?

a. 2 purple: 2 white

b. 1 purple : 3 white

c. 3 purple: 1 white

d. 3 white: 1 purple

e. 4 purple: 0 white

28. Which of the following consists of DNA wrapped about histone proteins?

a. Metaphase chromosome

b. Nucleosome

c. DNA double helix

d. Looped domains

e. 30 nm chromatin fibre

29. Which of the following statements describes the concept of “semi-conservative” DNA replication? a. The two parental strands reassociate after acting as templates for new strands, thus restoring

the parental double helix. b. Each strand of both daughter molecules contains a mixture of old and newly synthesized DNA. c. The two strands of the parental molecule separate, and each functions as a template for

synthesis of a new, complementary strand. d. DNA Polymerase III carries out synthesis by extending from the RNA primer (5’ to 3’) e. That the lagging strand of DNA is synthesized in short fragments called Okazaki fragments.

Use the following information to answer questions 32 through 34. The following sequence represents a non-transcribed strand of a gene. The transcription initiation sequence is at the first underlined T. There are introns present in between, but not including the first underlined C and second underlined T and another between but not including the underlined A and third underlined T.

5’ -GGCTTUTGTGGTATGTCATACAATTGGGCGGAGGATTTCCACATTTGTGGAGGGGTAGGCATGCC

GGTTAAAGGCCCTTAGAGTTAT – 3’

30. What would the transcribed mRNA strand leaving the nucleus look like? a. 5’ - G UGGUGUUAUUGAUAGAUGGGGAGGUGUUACACUCUA AAAAAAAA - 3’ b. 3’ – G UGUGGUAUGUCAUACUGUGGAGGGGUAUAGAGUUAU AAAAAAA – 5’ c. 5’ – G UGUGGUAUGUCAUACUGUGGAGGGGUAUAGAGUUAU AAAAAAA – 3’ d. 5’ – TGTGGTATGTCATACTGTGGAGGGGTATAGAGTTAT – 3’ e. 5’ – G UGUGGAUAGCAUGCCUUAAGUCCAUGCCUUAGCGUAU AAAAAAA – 3’

Alyssa Stowe BIOL 1103 AT 31. What would the translated protein sequence of the above mRNA strand look like? (genetic code on

last page) a. Met - Ser – Ser –Tyr – Gly – Val – His b. Met – Ser - Tyr – Cys – Gly – Gly – Val c. Gly – Cys – Met – Ser – Tyr – Cys – Gly – Gly – Val d. Gly – Ser – His – Val – Leu – Ile – Val e. Val – Gly – Leu – Trp – Cys – Ser – Gly – Gly – Val

32. If the underlined A was replaced with a C what would the resulting mutation be?

a. No mutation would occur b. Frameshift c. Nonsense d. Silent e. Missense

33. The tortoiseshell coat present on some female cats is the result of?

a. Incomplete dominance b. Polygenic inheritance c. X-inactivation d. Y-inactivation e. Codominance

34. In the fruit fly, the dominant and recessive traits for body colour and wing size are as follows:

Character Wild Type Mutant

Body Colour Grey (b+) Black (b)

Wing Size Normal (vg+) Vestigial (vg) The genes encoding body colour and wing size are linked. A wild-type fruit fly, heterozygous for grey body colour and normal wings, was bred with a black fruit fly with vestigial wings. The distribution of the offspring is as follows: 437 black with normal wings, 752 grey with normal wings, 263 grey with vestigial wings and 548 black with vestigial wings. What is the recombination frequency between the genes for the body colour and wing size? a. 15% b. 30% c. 35% d. 70% e. There is no recombination

35. How many centimorgans away from each other are the above loci?

a. 60 b. 66 c. 35 d. 70 e. 100

Alyssa Stowe BIOL 1103 AT 36. A human female "carrier" who is heterozygous for the recessive, X-linked trait red-green color

blindness, marries a normal male. What proportion of their female progeny will show the trait?

a. 1/4 b. 1/2 c. 0 d. All e. 3/4

37. What is the purpose of fermentation in the absence of oxygen?

a. To regenerate NAD+ from NADH, allowing for glycolysis to continue b. To regenerate FAD from FADH2, allowing for glycolysis to continue c. To generate the proton gradient for ATP synthesis d. To oxidize pyruvate e. To generate alcohol for alcoholic beverages

38. The trp operon is a ____________ operon and its default state is ___________.

a. Inducible, expression b. Inducible, repressed c. Repressible, repressed d. Repressible, expression e. Oxidizable, expression

39. Why do sex linked disorders predominantly affect males?

a. Because sex-linked disorders are created by interactions between the X and Y chromosomes b. Because a recessive X allele will always be expressed in a male c. Because sex-linked disorders are encoded on the Y chromosome d. Because the Y chromosome is smaller than the X chromosome and is more likely to experience

mutations e. Sex linked disorders affect women and men in equal proportions

40. Two unlinked loci affect mouse hair colour. At one locus, the ‘B’ allele (agouti coat) is dominant to

the ‘b’ allele (black coat). At the second locus, the ‘a’ allele can act to block expression from the ‘B/b’ locus to express albinism. Mice with genotype ‘aa’ are albino because all the pigment produced at the ‘B/b’ locus is blocked. What would the phenotype ratio be for the result of a cross between two agouti mice with the genotype AaBb? a. 8 agouti: 4 black : 4 albino b. 9 agouti: 3 black : 4 albino c. 3 agouti : 9 black : 4 albino d. 4 agouti : 8 black : 4 albino e. 9 agouti: 4 black : 3 albino

Alyssa Stowe BIOL 1103 AT

41. Which of the following statements is true about polyploidy?

a. It alters the genetic balance. b. Includes traits such as height and skin colour. c. Occurs when an organism had more than the diploid set of chromosomes. d. It appears as a bell curve in the population. e. b and d are both correct

42. If you have a plant with blue flowers and round seeds, Bb Rr, crossed with a plant with white flowers and round seeds, bb Rr, what is the probability of getting a plant with blue flowers and wrinkled seeds? a. 1/8 b. 1/4 c. 1/2 d. 3/4 e. 1/16

43. Which of the following is a source of genetic variability in meiosis?

a. Independent Assortment b. Transformation c. Recombination d. Random fertilization e. a, c and d are correct

44. What is required to regenerate RuBP in phase 3 of the Calvin Cycle?

a. 1 G3P, 9 ATP, 6 NADPH b. 5 G3P, 3 ATP c. 5 G3P, 9 ATP, 6 NADPH d. 1 G3P, 3 ATP e. 6 G3P, 3 AT

45. A plant that is heterozygous for the dominant “purple” colour is crossed with a plant that is

recessive for the “white” colour. In the F1 generation, 150 plants are purple. Approximately how many plants in the F1 generation are expected to be white? a. 150 b. 25 c. 50 d. 0 e. More information is required to answer the question

46. Which of the following statements about meiosis 1 is false?

a. During anaphase 1 homologous chromosomes are pulled to opposite poles b. During prophase 1 chromosomes condense c. Synapsis occurs during prophase 1 d. Separation of the cytoplasm occurs during anaphase 1 e. No replication occurs after meiosis 1

Alyssa Stowe BIOL 1103 AT

47. You have a purple, tall plant with yellow, round seeds, Pp TT Yr Rr crossed with a white, dwarf plant with yellow, wrinkled seeds, pp tt Yy rr. What is the probability of getting a purple tall plant with yellow wrinkled seeds? a. 1/4 b. 3/8 c. 3/16 d. 1/2 e. 0

48. Which of the following bridges the enhancer and the promoter?

a. Activators b. Co-Activators c. Repressors d. General transcription factors e. Enhancer

49. Which of the following is true about recombination frequency? a. Genes that are closer together have a higher rate of recombination b. Genes that are further apart have a higher rate of recombination c. All genes recombine at the same frequency d. Genes with a recombination frequency equal to 1 assort independently e. None of the above

50. What did the Frye-Edidin experiment demonstrate?

a. The membrane proteins are unable to move within the plane of the plasma membrane.

b. That some membrane proteins move sideways within the plane of the plasma membrane.

c. That phospholipids can “flip-flop” across the plasma membrane.

d. That phospholipids cannot move sideways within the plane of the plasma membrane.

e. None of the above.

51. Red-green colour blindness is a recessive, X-linked condition. A normal-vision daughter of a man

with red-green colour blindness marries a man who is also normal for the trait. If the couple has two

sons, what is the probability that both sons will be born with red-green colour blindness?

a. 1/4

b. 1/2

c. 1/16

d. 1/32

e. 0

52. Which of the following statements is true of the lac operon?

a. It operates when glucose is present but only if there is an absence of lactose

b. It operates when lactose is present but only if there is an absence of glucose

c. Expression will occur when an inducer binds to the repressor protein

d. a and c are both true

e. b and c are both true

Alyssa Stowe BIOL 1103 AT

53. Alternative RNA splicing is responsible for which of the following?

a. Creating mutations in a monocistronic RNA sequence b. Causing inhibition to slow down protein production c. Removing introns when regular RNA splicing cannot d. Using alternative codons for the same amino acids e. Creating multiple different polypeptides using the same polycistronic strand

54. In pyruvate oxidation, shown below, which compound is reduced?

Pyruvate + NAD+ + Coenzyme A CO2 + NADH + H+ + Acetyl CoA a. Pyruvate b. NAD+ c. CoA d. NADH e. Acetyl CoA

55. In the cell nuclei of female mammals, which structure is known as an inactive X-chromosome?

a. Condensed X-chromosome b. Heterochromatin c. Masked X-chromosome d. Barr body e. Vestigial X-chromosome

56. Ribosome synthesis occurs in which location?

a. Nucleus b. Nucleolus c. Nucleosome d. Proteosome e. Ribosomal Subunits

57. In mitosis ______________________ attach to the centromeres of the chromosomes while the

_______________________ serve to extend the cell, provide structure, and facilitate movement of organelles throughout the process. a. Centrosome; spindle fibres b. Nonkinetochore microtubules; kinetochore microtubules c. Kinetochore microtubules; nonkinetochore microtubules d. Spindle fibres; cytoskeleton e. Sister chromatids; cytokinesis

58. In _________________ , translation of proteins is initiated on ___________________ .

a. Prokaryotes; free ribosomes b. Eukaryotes; Rough Endoplasmic Reticulum c. Prokaryotes; Rough Endoplasmic Reticulum d. Eukaryotes; free ribosomes e. Options A and B are both correct

Alyssa Stowe BIOL 1103 AT

59. Which of the following statements regarding protein synthesis is true? a. Transcription involves the transfer of information from DNA to RNA, and translation involves the

transfer of information from RNA to amino acids b. Transcription involves the transfer of information from DNA to RNA, and translation involves the

transfer of information from DNA to amino acids c. Transcription uses nucleic acids exclusively to transfer information, while translation exclusively

uses protein monomers. d. Transcription involves the transfer of information from DNA to RNA, while translation only uses

RNA e. Options A and C are both correct

60. A difference between translation initiation in prokaryotes and eukaryotes is…

a. In prokaryotes translation begins at the first start codon in the RNA strand, and in eukaryotes translation occurs at the first start codon that the ribosomal subunit encounters.

b. In eukaryotes translation begins at the first start codon in the RNA strand, and in prokaryotes translation occurs at the first start codon that the ribosomal subunit encounters.

c. Prokaryotes and Eukaryotes have unique start and stop codons. d. In prokaryotes translation is right to left and in eukaryotes translation is left to right. e. There are no differences in translation between prokaryotes and eukaryotes.

61. Why can C3 plants not survive in hot and dry climates?

a. They undergo photorespiration b. They undergo phosphorespiration c. They do not have advanced control over their stomata like C4 and CAM plants d. They cannot get enough oxygen e. Their leaves are too big and would get dried out

62. Why is a testcross be performed?

a. To determine the phenotype(s) of an organism’s offspring b. To determine the genotype(s) of an organism’s offspring c. To determine the traits expressed by an organism d. To determine the genotype of an organism e. To determine which traits are dominant and which are recessive

63. John has hemophilia, but his daughter Lucy does not. Lucy marries a man with hemophilia named

Paul. If Lucy and Paul have two daughters and one son, what is the probability that none of their children will be affected by the disease? (Note that hemophilia is an X-linked recessive trait) a. 1/8 b. 1/4 c. 1/2 d. 3/4 e. 1

Alyssa Stowe BIOL 1103 AT 64. To what area of genetics did Gregor Mendel contribute the most?

a. Determining the dominant and recessive traits in pea plants b. Discovering the basic patterns of allele sorting into gametes during meiosis c. Discovering the principles of incomplete dominance in flowers d. Creating the Punnett square method to calculate possible genotypes e. Generating interest in the field to entice future researchers

65. The allele R codes for red flowers and r for white flowers. This species displays incomplete

dominance for colour resulting in pink flowers. The allele E codes for rough edges and the allele e for smooth edges. If a pink individual with smooth edges is crossed with a pink individual that is heterozygous for edge shape, what proportion of the offspring will display a pink phenotype? a. 0% b. 25 % c. 50 % d. 75 % e. 100 %

66. Mendel finds a stray green pea plant and performs a testcross. He discovers that all of the resulting

offspring are green. What are the genotypes of the parents in this cross? a. GG x GG b. GG x Gg c. Gg x Gg d. gg x Gg e. gg x GG

67. What important contribution did Thomas Hunt Morgan make to genetics?

a. He discovered that many traits are not segregated independently b. He determined the karyotype of drosophila c. He coined the term genetics d. He discovered that fruit flies have red and white eyes e. Options A and C are both correct

68. When a gene has more than two allelic forms, it can be referred to as…

a. Incomplete dominance b. Codominance c. Multiallelism d. Multiple alleles e. Dominant and recessive alleles

69. Which of the following statements regarding polygenic inheritance is false?

a. Several genes work together to influence a specific trait b. Produced phenotypes are displayed as a blend of many different alleles c. Polygenic inheritance is the same as incomplete dominance d. Produced phenotypes exist on a continuum and follow a bell-shaped curve e. All of these statements are true

Alyssa Stowe BIOL 1103 AT

70. Patau syndrome is caused by a trisomy of chromosome #13. Which process is responsible for this? a. Nondisjunction b. Monosomy c. Polyploidy d. Aneuploidy e. Mutations in DNA synthesis

71. The alleles A, B, C, and D are all on the same chromosome. Alleles A and B have a recombination frequency of 12%, alleles A and C have a recombination frequency of 10%, alleles C and D have a recombination frequency of 14%, and alleles B and D have a recombination frequency of 9%. In what order to these alleles appear on the chromosome. a. ACBD b. BADC c. DACB d. CADB e. CABD

72. The alleles A, B, C, and D are all on the same chromosome. Alleles A and B have a recombination

frequency of 12%, alleles A and C have a recombination frequency of 10%, alleles C and D have a recombination frequency of 14%, and alleles B and D have a recombination frequency of 9%. How far apart are the alleles A and D a. 3 cM b. 7 cM c. 16 cM d. 21 cM e. 24 cM

Consider the following cross for questions 73-75:

aaBbDdEE x AabbDDee 73. How many distinct genotypes are possible in the offspring?

a. 4 b. 8 c. 12 d. 16 e. 24

74. What is the probability that an offspring will display the phenotype ABDE?

a. 3/16 b. 1/8 c. 3/8 d. 1/4 e. 5/4

Alyssa Stowe BIOL 1103 AT

75. What is the probability that an offspring will have the genotype: aaBbDDEe?

a. 1/8 b. 1/6 c. 1/4 d. 3/4 e. 3/2

76. What is most likely the inheritance pattern shown

in the pedigree? a. Autosomal recessive b. Autosomal dominant c. X-linked dominant d. X-linked recessive e. Y-linked

77. What is the probability that the offspring from the individual

5IV will possess the trait? (Assuming an unaffected partner.) a. 0 b. 1/4 c. 1/2 d. 3/4 e. Impossible to determine

78. In a sample of 1000 progeny, how many must vary, phenotypically, from the parental phenotypes for the alleles in question to be deemed unlinked? a. 250 b. 500 c. 600 d. 750 e. More information is needed to answer this question.

79. What type of inheritance pattern is shown by skin colour and height? a. Natural selection b. Incomplete dominance c. Codominance d. Polygenic inheritance e. Blending inheritance

Alyssa Stowe BIOL 1103 AT

80. A certain flower variety shows phenotypes of red, white, and pink petal colours with smooth or rough petal edges. Red and rough are both dominant alleles. A cross was performed with a parent that was heterozygous for both traits and a parent that was homozygous recessive for both traits. If an offspring with pink, smooth petals is crossed with an offspring that has white, rough petals, what will the phenotype ratio be for the second-generation offspring? a. 1:2:1 b. 9:3:3:1 c. 6:3:3:3 d. 6:6:3:1 e. 1:1:1:1

81. BONUS: Have you filled out the feedback survey about PASS? You could win a gift certificate!

a. Yes! b. Not yet, but I will!

1.