Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested...
-
Upload
rosalind-harmon -
Category
Documents
-
view
219 -
download
2
Transcript of Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested...
![Page 1: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/1.jpg)
BioinformaticsWhy Can’t It Tell Us Everything?
![Page 2: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/2.jpg)
BioinformaticsWhat are our Data Sets?
• Interested in information flow with cells
• Currently, the key information is mostly a matter of biological macromolecules
• Eventually, information of interest will also include flow of nutrients, energy, and impact of small molecules on macromolecular function
![Page 3: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/3.jpg)
BioinformaticsWhat are our Questions?
• What is in there?• What does it do?• How similar is it to something else?• How does it fold?• Where does it go in a cell?• What does it interact with?• How it is regulated?• Level of confidence?
![Page 4: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/4.jpg)
* Function of organism is determined by function of its cells * Function of cells determined by chemical reactions that take place within them * Chemical reactions occur or not according to presence and activity of enzymes * Enzymes are proteins * Proteins are determined by genes * Therefore, genes determine organismal function
BioinformaticsLogical Reasoning Behind Data Sets
![Page 5: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/5.jpg)
Genomics
Proteomics
![Page 6: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/6.jpg)
Central DogmaFlow of Information
![Page 7: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/7.jpg)
Central DogmaDNA as the Blueprint for Life?
![Page 8: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/8.jpg)
Central DogmaDNA as the Blueprint for Life?
![Page 9: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/9.jpg)
Central Dogma
DNA RNA Protein
Genes & proteins are different molecular languages,
but they are colinear
![Page 10: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/10.jpg)
DNA
Basic Unit (alphabet): Nucleotide (base) Only 4: A, T, G, and C
Double-stranded: A<>T and G<>C
5’..AGCTGCATGCTAGCTGACGTCA….3’ 3’..TCGACGTACGATCGACTGCAGT….5’
“Words” (genes) to encode proteins, RNA
Double helical
![Page 11: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/11.jpg)
DNA Tower in Perth, AUS
DNAStructure Connected to Information
![Page 12: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/12.jpg)
DNAReplication & Transcription as Algorithms
• With rare exceptions, all DNA is replicated
• Crucial tool is ability to go from one strand to another
• Transcription uses same base-pairing rules with U instead of T, but occurs in packets
![Page 13: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/13.jpg)
Transcription = DNA to RNAWhere to Start is a Big Question
![Page 14: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/14.jpg)
Protein
Alphabet: amino acids
There are 20 amino acids
Met Cys Ser Leu Ala Ala Val
![Page 15: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/15.jpg)
ProteinsNumber of Possible 100-mer Peptides?20 possible residues at each
position
For 2-mers, 20 possible at position 1 and 20 possible at position 2, so 20 x 20 = 202 = 400
Same logic for 100-mers, 20100 = 2100 x 10100 =
(210) 10 x 10100 =
~ (103) 10 x 10100 = 10130
![Page 16: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/16.jpg)
beta-pleated sheet
ProteinsFolding Starts Local
alpha-helix
![Page 17: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/17.jpg)
ProteinsFolding Goes Global
![Page 18: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/18.jpg)
ProteinsPredictive Protein Folding as Holy Grail
![Page 19: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/19.jpg)
Protein
Alphabet: amino acids
There are 20 amino acidsEncoded by codons (triplets of nucleotides)
Met Cys
ATGTGCAGCCTAGCTGCCGTC
Ser
CTAGCTGCCGTC
Leu Ala Ala Val
![Page 20: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/20.jpg)
Genetic Code Found on Earth:How Does It Work?
5’-UCGACCAUGGUUGACCAUUGAUUACCACG-3’
![Page 21: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/21.jpg)
Genetic Code
• Triplet• Nonoverlapping• Comma-less• Redundant
![Page 22: Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets? Interested in information flow with cells Currently, the key information.](https://reader035.fdocuments.in/reader035/viewer/2022062719/56649eca5503460f94bd82b9/html5/thumbnails/22.jpg)
Bioinformatics:Mining a Mountain of Data
Where are the putative genes?