Bioinformatics and Malaria: How can the computer help in vaccine and drug design against Malaria?
-
Upload
shanna-heath -
Category
Documents
-
view
219 -
download
3
Transcript of Bioinformatics and Malaria: How can the computer help in vaccine and drug design against Malaria?
Bioinformatics and Malaria: How can the computer help in vaccine and drug design against Malaria?
The worldwide Malaria threat:
- 2 billions live at risk of malarial infection- 500 million individuals get infected per year- 2-3 millions die due to P. falciparum infections- Resistance is found against virtually all commercially available drugs- Vectors become resistant against pyrethroids- The only, highly functional vaccine to date is the administration of irradiated sporozoits- BUT, new, very promising drugs are in development (monkey trials/clinical trials)
from Good & Doolan 1998
Three different organism interact in malarial infections
2900 Mb25-30 Mb
280 Mb
from Good & Doolan 1998
Differing stages, different target structures
Knowing the genomes/transcriptomes of all involved species....
H. sapiens P. falciparum A. gambiae
... reveal structures at which an interference can take place, and this is a necessary a “computer job”
Part 1: Bioinformatics + drug target finding
Acalcidosome
Licensed drugs: pyrimethaminesQuinine derivates,Artemsisin drugs
Known “obvious” drug targets, for which some drugs arealready available
Olliaro & Yuthavong 2001
The DOXP pathway example
- In plants, isoprenoid precursors are synthesized via the DOXP pathway (in the chloroplast), in mammalians via the mevalonate pathway (in the cytosol)
- Fosmidomycin is a potent inhibitor of the plant DOXP reductoisomerase
BLAST and alignment analysis of some DOXP reductase genes identified a candidate P. falciparum sequence
Jooma et al. 1999, Science
Work hypothesis of Jooma and cols.:
- Is the already tested drug (non-toxic in human use) Fosmidomycin active against Malaria blood stages which synthesize a lot of isopentenyl precursors?
In vitro cultures of different strains of P. falciparum were effectively inhibited...
Jooma et al. 1999, Science
...and mice infected with lethal P. vinckei were cured at very low doses of either Fosmidomycin or its derivate
Jooma et al. 1999, Science
Advantageous would be the automated identification of all metabolic enzymes in Plasmodium, and the automatedassignment of all known inhibitors to these enzymes
Pf metabolic enzymes
Inhibitordatabase
High-throughputscreening
Even drugs that block both human and plasmodial enzymes can by considered, if the human enzyme is not active/presentin the tissues where the drug is bio-available
SAGE/Microarray data bank of human tissues
SAGE/Microarray data of blood stage plasmodium
Drug data bank
Science 295, 15/02/2002, p 1311-15
Compounds which are weak inhibitors may be modifiedby combinatorial chemistry in silico if the target structure(3-dimensional!) is known, minimizing the number of potential test compounds
N
H
CX
Y
Z
Target structure
A major drawback of alignment-based drug target searchis that some (how many?) enzymes are missed
5´-Taaaccctgaaccctaaaccctaaaccctgaaccctgaaccctaaa ccctgaaccctaaccctgaacccaacccaaaccctaaacctaaaccc taaaccctaaaccctgaaccctaaaccctgaaccctaaaccctaaa ccctaaaaccctaaaccctaaaccctaaaccctgaaccctaaaccc taaaccctaaaccctaaaccctgaaccctaaaccctaaaccctaaa cctaaaccctgaaccctaaaccctaaaccctg
1
ONE BEER FORTHE ONE WHO FINDSTELOMERASE!
Hoffman et al., Nature 2002
Part 2: Bioinformatics and vaccine research
Is a Malaria vaccine feasible?
Co60
Protection
What are known candidate structures:
- anti-infection: CSP, SSP2, STARP, SALSA- anti-hepatic stages CSP, SSP2, LSA1, LSA3, EXP1, STARP, SALSA- anti-merozoite: MSP1-4, PfEBA-175, DBP(Pv), AMA1 SERA, GLURP,Pf155-RESA, RAP1, RAP2- anti-IRBC: PfEMP1, RIFIN, Pf322 GPI- anti-infective stages: Pfs25, Pfs28, Pfs45/48, Pfs230
Richie and Saul, Nature 2002
Rappuoli 2001Curr. Opin. Microbiol.
Rappuoli 2001Curr. Opin. Microbiol.
Suggestion of Hoffmann et al.(Nature Medicine 4,1998, p 1351-53)
In the case of blood stage vaccine candidates: identify expressed genes
cDNA, EST data bank
2. Are they surface-expressed (either merozoite or IRBC)?
3. Express as rec. protein or deliver directly as a DNA vaccine in the rodent system
4. Find homologue in P. falciparum/vivax
5. Test efficacy in in vitro reinvasion assays and in the monkey model
6. Volunteer trials
Identified antigens must be checked for strain varyingpolymorphisms, these polymorphism must be representedin a anti-blood stage vaccine
Candidate protein X
Variants in strains A B C D
Protectiveepitope
By genome scanning, many novel candidate proteindomains potentially important in cell-cell interaction were found
Trends in Parasitology 17 (5), p 297-99
- An important antibody target are the erythrocyte surface-exposed antigens PfEMP1 and perhaps RIFIN and STEVOR (P. falciparum) and VIR (P. vivax)
DBL CIDR DBL DBL ATS
PfEMP1: Highly polymorphic, 50 copies per genome, 1is expressed per trophozoite stage parasite, mediate cytoadherence which can promote severe disease
Step1: Exploring the endless: Sequencing 500 var genes fromAmazonian isolates
Full length var genes
CIDRDBL DBL DBL
Patient data (diseaseseverity)
“Pathoarray”
Step 2: Checking the expressed repertoire against thePathoarray
Patient samples(var - cDNA)
Multiplex-PCR withdomain-specific/ degenerated oligomixes
Definition of “severe” or“non-severe” var domains
Patient data (diseaseseverity)
Step 3: Checking the immune response: Is there aanti-severe disease response?
Patient samples (Plasma)
Elisa
Anamnestic data
Vaccine subunitcandidate
Peptide array
Drawbacks in the genomic approach to vaccines
- Some structures may be lost because the prediction program (HexExon, Glimmer M, PHAT) did not recognize the coding region (see drug targets, too) of a potential antigen
- What if the highly effective vaccine target is a glycosid rest? --> SEE GPI!!!
Further reading:
From genomics to vaccines: Malaria as a model system(Nature medicine 4, 1351 f, 1998)Plasmodium, human and Anopheles genomics and Malaria(Nature 415, 702, this nature issue is particularly interesting, 2002)An overview of chemotherapeutic targets for antimalarial drug discovery(Pharmacol. Ther. 81, 91, 1999)Progress and Challenges for Malaria vaccinesNature 415, 694