Bio 1002 b Mar Feedback

7/28/2019 Bio 1002 b Mar Feedback

1/13

B I O L O G Y 1002BMarch 17, 2013 Time: 2 Hours

Student number Room Row

Print Name _____________________________________________________

I N S T R U C T I O N S - F O L L O W T H E C H E C K L I S T !

( ) On your Scantron sheet Fill the bubbles completely Use HBpencil only No stray marks or doodles Make all erasures completeYes - Calculators are permitted

(non-programmable only)

No Borrowing is not allowed

Print name Print clearly

Signature Do your best

Instructor Haffie

Course Bio 1002B

Student number Print clearly/ Bubble neatly

Exam Code 111 Very important

Section Leave it blank

Answer Sheet Leave it blank

( ) On your Test BookScantron answers will be emailed to you.

Marks will be posted

to OWL after all tests are finished.

Student number Legibly please

Name Print your name

Test Room The room youre in right now

Row number We will tell you this

Indicate your answers in the test book. Leave no questions blank.

1) Please place yourID prominently on your desk and sign theattendance sheet when it comes to you.

2) There are 11 pages in this test. Check your paper carefully.3) There is only one fully correct answer for each question. Part

marks may be awarded. Answer all questions. We do not

subtract wrong from right.

4) Indicate your answers in both the test paperand on theScantron.

5) It is your responsibility to transfer all answers from the testbook to the Scantron sheet within the 2 hour test period.

6) When finished, please stay seated and raise your hand.We will collect both your test book and Scantron sheet.

Warning

The Scantron marking program has a cheating analysis feature that compares answer patterns for all papers.

It alerts us to similarities. We then check seating arrangements.

Do not sit near your study partners or write the same test codes. Keep your work directly in front of you.

Please help us avoid any and all misunderstandings during these tests

Clarifications: Please defend your arguments on this pageonly. Comments will not be accepted after the test.

Q # Ans Clarification Alt Ans

40 D If you mean Denis has a dog named Watson, then my answer changes B


2/13


3/13

March 2013 Biology 1002B Page 1 of 11

Code 111 Code 111 Code 111

Circle the best single letter choice for each of the following questions before transferring

your answers to your computer sheet. Note: Questions may have 3, 4 or 5 choices.

1. One of the key transitions in the development of life occurred after the rise in O2 concentration

in the atmosphere.

What was the main source of this O2?

A. Respiration in archaea and bacteria.

B. Respiration in early eukaryotes.

C. Photosynthesis in bacteria.

D. Photosynthesis in chloroplasts.

2. Membrane surface area and cell volume are two physical variables that are relevant in

explaining the difference in size and complexity between prokaryotic and eukaryotic cells.

Which of the following statements about these variables is correct?

1. The ratio of plasma membrane area to total cell volume increased in early eukaryotes

which allowed for greater morphological complexity.

2. The total membrane area dedicated to oxidative phosphorylation is greater in eukaryotes.

3. Although physically smaller, prokaryotic cells have more total cell volume than a typical

eukaryotic cell.

4. In prokaryotic cells, the membrane location of ATP synthase is the same as that for

lactate transport.

A. 1,2 and 3

B. 1 and 3C. 2 and 4

D. 4 only

E. All of 1,2,3 and 4 are correct

3. Genomes sizes among related eukaryotes vary much more widely than genome sizes among

related bacteria.

How is this difference in variability best explained?

A. Evolutionary processes (e.g. natural selection) exert less constraint on genome size in eukaryotes

than in bacteria.

B. Genome size is proportional to energy production - cells that make more ATP have more DNA.

C. Eukaryotes have a much wider range of chromosome number than bacteria.

D. Organisms with greater morphological complexity have larger genomes.

4. Is it true that all known eukaryotes have mitochondria?

A. Yes, but some eukaryotes have mitochondria that do not contain DNA.

B. Yes, but some have only one mitochondrion per cell.

C. No, but all eukaryotes contain mitochondria-derived genes.

D. No, but those that don't contain mitochondria contain chloroplasts instead.


4/13



5. Once endosymbiosis was first established, it appears that selection favoured organisms with

smaller organelle genomes over evolutionary time. As a result, modern organelle genomes are

greatly diminished in size relative to those of free-living bacteria.

Which of the following is a likely explanation for why diminished genome size would have been

favoured?

1. Organelle proteins are smaller, requiring fewer amino acids. Therefore selection has

favoured organisms with fewer tRNA genes in organelles.

2. Proteins that are rapidly damaged by reactive oxygen species (ROS) can be replaced more

efficiently if their genes are located in the nucleus. Therefore, selection has favoured

organisms where these genes have transferred out of the organelles into the nucleus.

3. Organelles have typical prokaryotic gene structure. Therefore, selection has favoured

organisms in which organelle genes have lost their introns.

4. Following endosymbiosis, several genes would have been present in both the organelle and

nuclear genomes. Therefore, selection has favoured organisms that lost the organelle copy

of such redundant genes.

A. 1,2 and 3

B. 1 and 3

C. 2 and 4

D. 4 only


6. Human mitochondrial genomes code for 37 genes but mitochondria produce only 13 proteins.

What would most likely account for mitochondrial genomes having more genes than needed to

code for the proteins produced?

A. Several genes code for products that are not translated.

B. Several genes have been inactivated over evolutionary time and no longer code for proteins.

C. Several genes, and the proteins they code for, are of viral origin. They are not human

mitochondrial genes.

D. Several genes are coded on both the top and bottom strands of DNA. Therefore they code for

the same proteins.

7. Which of the following sequences in template DNA would likely code for a hairpin transcription

terminator loop?

A. 3 GCCCAAAGCTAGCTATTTGGGC

B. 3 GCGCGCGCGCATATATATATAT

C. 3 ATGCATGCTACGTACGTACGTA

D. 3 AUGCAUGCUAAUGCAUGCUAA


5/13



8. The rps10 gene codes for one of several protein components of the chloroplast ribosome.

This gene is found in the nuclear genome in some flowering plant species but remains in the

chloroplast genome of other species.

If the rps10 gene arrived in the nucleus in its DNA form, it contained several associated signals

related to its expression. Which of the following signals would have been present on rps10 and

likely functional in the nuclear/cytoplasmic environment?

1. enhancer

2. promoter

3. SD box

4. start codon

A. 1,2 and 3B. 1 and 3

C. 2 and 4D. 4 onlyE. All of 1,2,3 and 4 are correct

9. Using the section of the genetic code below, identify the sequence of DNA template that would

code for the polypeptide sequence of Pro-His-Arg.

A. 3CCACAACGG5

B. 3GGTGTGGCT5

C. 3GGUGUGGCU5

D. 3CCTCATCGT5

10. Some viruses that infect E. coliproduce an anti-terminator protein that causes RNA

polymerase to ignore the termination signal of one virus gene and continue transcribing right

into the next gene.

What might this anti-terminator protein do?

A. Bind to DNA, causing a loop that prevents the RNA polymerase from reaching the termination

signal in DNA.

B. Bind to mRNA to prevent it from complementary base pairing with itself at the terminator signal.

C. Bind to the termination factor, keeping it away from ribosomes that reach the stop codon.

D. Bind to the polyadenylation signal, preventing the action of the RNAase clipping enzyme.


6/13



11. Which of the following features is a characteristic of tRNA anticodons?

1. Are catalytic, making the tRNA a ribozyme.

2. For the codon of 5UAA, there is a complementary anticodon 3AUU.

3. Bind to specific amino acids.

4. Can be coded in DNA of mitochondrial genomes.

A. 1,2 and 3

B. 1 and 3

C. 2 and 4D. 4 only


12. Although most genes have been lost from mitochondria since the original endosymbiosis was

established, some remain in the mitochondrial genome.

Which of the following genes would you most likely find remaining in modern plant

mitochondria?

A. components of Rubisco

B. cytochrome C

C. snRNA

D. polyA polymerase

E. None, modern plants dont have mitochondria.

13. Ribosomes are ribonucloprotein particles in that they are composed mostly of rRNA with some

associated ribosomal proteins.

How would the genes coding for ribosomal RNAs be different than the genes coding for

ribosomal proteins?

A. Only the protein coding genes would have transcription termination signals.

B. Only the RNA coding genes would have anticodons.

C. Only the protein-coding genes would have polyT sequences giving rise to polyA tails.

D. Only the protein-coding genes could suffer a nonsense mutation.

14. Modern Chlamydomonas cells contain one large chloroplast that requires thousands

of proteins.

Where are these chloroplast proteins translated?

1. On the rough endoplasmic reticulum.

2. Inside the chloroplast.

3. In the nucleus.

4. In the cytoplasm.

A. 1,2 and 3


D. 4 only



7/13



15. This picture of the structure and expression of the lac operon, showing the coding regions of

lacI, Z, Y and A genes, in a different style than youve seen before.

If you were to label the location of the

transcription terminator sequence in thisimage, how many would there be in DNA?

A. 1

B. 2

C. 3

D. 4

16. This Figure shows the activity of the galactosidease

enzyme (coded by LacZgene) in a mutant strain of

E. colirelative to a normal strain.

Mutant (dotted line); Normal (solid line);

Arrow indicates the addition of lactose to

the growth medium.

Which sequence is likely affected by this mutation?

1. SD box of operon mRNA, such that translation efficiency is decreased.

2. lacY, such that lactose is not transported into the cell as well.

3. lacZ gene, such that the enzyme has a lower affinity for substrate.

4. lacI gene, such that the repressor has a lower affinity for DNA.

A. 1,2 and 3

B. 1 and 3C. 2 and 4D. 4 only



8/13



17. We discussed three types of boxes that are present as signals in DNA.

Which of the following boxes is transcribed?

1. homeobox

2. TATA box

3. SD box

A. 1 and 3

B. 2 and 3

C. 3 onlyD. All of 1,2 and 3

18. If you imagine a messenger RNA molecule in the cytoplasm of a zebra cell, which of the

following will likely affect how much protein is made by translation of this message?

A. The presence of appropriate snRNPs.

B. The length of the polyA tail.

C. The strength of hydrogen bonds holding the mRNA to ribosomal RNA.D. The ability of the mRNA to pair with itself to form a helix-turn-helix structure.

19. Promoters, promoter-proximal regions and enhancers are important regulatory sequences for

many eukaryotic protein-coding genes.

Which of the following characteristics do these three different sequences have in common?

1. Understood by the cell as double-stranded DNA.

2. Mutations in their sequence may result in increased gene expression.

3. Contain binding sites for proteins.

4. Must be upstream of the gene they influence.

A. 1,2 and 3

B. 1 and 3

C. 2 and 4D. 4 only


20. There are a variety of mechanisms of genetic regulation that all fall under the broad category of

RNA interference (RNAi).

When does this category of regulation occur during gene expression?

A. before/during transcription

B. after transcription; before/during translation

C. after translation


9/13



21. Imagine that a methylation survey reveals that the region of DNA

shown in this picture is frequently methylated in the brain cells of

biology students who do not attend lectures but is not methylated in

brain cells of students who regularly attend lectures.

What type of sequence do you see in this DNA?

A. promoter-proximal region

B. start codon

C. zinc-finger domain of gene coding a transcription factor

D. intron splice signal

22. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a

protein-coding gene.

Which of the following additional mutations will restore the reading frame back to normal such

that the original stop codon will still function?

(Note that the amino acid sequence will not necessarily be restored back to normal).

1. Adding a base pair into each of the next two codons.

2. Adding a GC base pair back in where the AT pair was deleted.

3. Adding one base to the next codon and deleting one base from the one after that.

4. Deleting a base pair from each of the next two codons.

A. 1,2 and 3

B. 1 and 3

C. 2 and 4

D. 4 only


23. Complementary DNA (cDNA) is frequently created during genetic engineering projects by

allowing reverse transcriptase to make double-stranded DNA from mature mRNA.

Imagine collecting mature mRNA from the cytoplasm of adult Drosophila wing cells and reverse

transcribing it all into a collection of double-stranded cDNAs.

Which of the following signals would you likely find (as DNA) among this collection of cDNAs?

1. promoter

2. Reaper gene start codon

3. intron4. 3UTR

A. 1,2 and 3

B. 1 and 3

C. 2 and 4

D. 4 only



10/13



24. The figure below shows four genes in the genome of a goldfish. Shaded areas represent the

binding site at each genes enhancer region for 6 different activator proteins.

Assuming that an enhancer is only functional if all activator proteins are bound, which pair of

genes can be selectively enhanced in a specific tissue without enhancing the remaining two

genes?

1. Genes L and W

2. Genes L and P

3. Genes T and P4. Genes T and W

A. 1,2 and 3B. 1 and 3

C. 2 and 4

D. 4 only


25. Which of the following cellular components is created on one side of the nuclear membrane but

functions on the other side?

1. snRNA

2. microRNA

3. peptide tag that targets proteins to mitochondria

4. histone deacetylase

A. 1,2 and 3


D. 4 only


26. Which of the following statements is consistent with the claim multi-cellularity is polyphyletic?

A. Multicellular plants are closely related to multicellular animals; unicellular plants are

closely related to unicellular animals.

B. Unicellular organisms have a common ancestor but multicellular organisms do not.

C. The common ancestor of all modern multicellular organisms was unicellular.

D. All unicellular organisms have the necessary genes to be multi-cellular.


11/13



27. In what way are identical twins not likely identical with respect to DNA and its expression?

1. One twin might be homozygous for a missense mutation; the other twin might be

heterozygous for this mutation.

2. One twin might show higher heritability for disease than the other twin.

3. One twin might inactivate one X chromosome; the other twin might inactivate both

X chromosomes.

4. One twin might make different gametes during meiosis than the other twin.

A. 1,2 and 3

B. 1 and 3

C. 2 and 4

D. 4 only


28. In class we made predictions about what information comparative genomic studies would reveal

about the genomes ofChlamydomonas vs. Volvox.

Which of the following predictions for a relatively dramatic increase in the Volvoxgenome wassupported by the data?

A. number of total base pairs

B. average number of genes in gene families

C. average number of base pairs per gene

D. number of chromosomes

29. This image shows the main gene products involved in programmed

cell death in the nematode worm model system, C. elegans.

If you discovered a mutant worm that did not show programmed cell

death during development, where might the mutation be?

1. Loss of function of death signal receptor gene

(no binding of death signal).

2. Loss of function of CED 4 (no interaction with CED 3)

3. Loss of function of CED 3 (no enzyme activity).

4. Loss of function of CED 9 gene (insensitive to signals from receptor).

A. 1,2 and 3

B. 1 and 3

C. 2 and 4

D. 4 only



12/13



30. Recall that a concentration gradient of BICOID protein in fertilized Drosophila eggs establishes

the anterior-posterior axis of developing embryos. Failure of this mechanism is lethal because

embryos do not develop a head.

If you imagine a male and female fly, both heterozygous for the same severe nonsense mutation

in the bicoidgene, what would happen to their homozygous recessive bicoid/bicoidmutant

offspring?

A. The homozygous recessive offspring would all die as headless embryos.

B. The homozygous recessive male and female offspring would all survive to adulthood but all of

theiroffspring would die as headless embryos.

C. The homozygous recessive female offspring would survive to adulthood but only theiroffspring

would die as headless embryos.

D. The homozygous recessive male offspring would survive to adulthood but only theiroffspring

would die as headless embryos.

31. This figure speculates on the possible

arrangement of homeobox-containing

genes in a hypothetical commonancestor ofDrosophila, Amphioxus

(amphibian) and Mouse. (Note that,

in mouse, the genes are present on

four different chromosomes.)

Which pair of genes is orthologous?

A. S and T

B. S and V

C. S and W (onAmphioxus)

D. T and V

32. In a chromatography investigation, which of the following data would you need if you wanted to

compare the Rf of a particular chlorophyll vs a particular carotenoid?

1. Distance travelled by the chlorophyll.

2. Distance travelled by the solvent.

3. Distance travelled by the carotenoid.

4. Average distance travelled by all chlorophylls and carotenoids.

A. 1,2 and 3

B. 1 and 3

C. 2 and 4D. 4 only



13/13



33. In response to shortened day length and cool temperatures, many trees begin a period of

senescence when the breakdown of chlorophyll exceeds chlorophyll production. The leaves of

these trees change colour from green to yellow and orange.

Based on your knowledge from the photosynthesis lab, which of the following explanations for

this change is most likely?

A. Total pigment production decreases at this time such that only yellowish to orange

wavelengths of light are reflected.

B. Chlorophyll breakdown at this time allows additional yellowish to orange pigments to

become visible.

C. When chlorophyll breaks down during this time, it appears yellowish to orange.

D. Chlorophylls that are yellowish to orange are produced during this time.

34. After the fermentation lab, Jamal and Laura decided to make some alcohol at home by mixing

table sugar with water and adding yeast. Although the fermentation got off to a good start, it

stopped before all of the sugar was consumed.

What should Jamal and Laura do differently in their second batch to prevent wasting sugar?

A. Add more yeast.

B. Reduce the sugar in the starting mix.

C. Add some sodium dodecyl sulfate.

D. Keep stirring the mix during fermentation to get more oxygen in.

35. The relationship between Elysia and Vaucheria makes an interesting story for

educational outreach.

Which of the following characteristics is found in this system?

A. An animal that makes its own reduced carbon.

B. An algae that grows photosynthetically, even after its chloroplasts have been stolen.

C. An underwater plant that makes oxygen by photosynthesis and then uses the oxygen as

a terminal electron acceptor in respiration.

D. A chloroplast that functions without any genes.

Bio 1002 b Mar Feedback

Documents

Transcript of Bio 1002 b Mar Feedback