Barrangou SOM

www.sciencemag.org/cgi/content/full/315/5819/1709/DC1

Supporting Online Material for

RISPR Provides Acquired Resistance Against Viruses in Prokaryotes

Rodolphe Barrangou, Christophe Fremaux, Hlne Deveau, Melissa Richards, Patrick Boyaval, Sylvain Moineau, Dennis A. Romero, Philippe Horvath*

*To whom correspondence should be addressed. E-mail: [email protected]

Published 23 March 2007, Science 315, 1709 (2007)

DOI: 10.1126/science.1138140

This PDF file includes

Materials and Methods Figs. S1 to S5 References

MATERIALS AND METHODS Isolation of phage-resistant mutants and confirmation of CRISPR sequences

Streptococcus thermophilus phage-resistant mutants were obtained by challenging the wild-type host strain DGCC7710 (also called RD534) with phage 2972 and/or phage 858 (1). The host strain was grown at 42C in 10 ml of M17 broth supplemented with 0.5% lactose (LM17). When the optical density (600 nm) reached 0.3, phages and calcium chloride 10mM were added at a final concentration of 107 pfu/ml and 50 mM, respectively. The phage-containing culture was incubated at 42C for 24 hours and monitored for lysis. Then, 100 l of the lysate were inoculated into 10 ml of fresh LM17. The remaining lysate was centrifuged and the pellet was inoculated into another tube containing 10 ml of fresh LM17. These two cultures were incubated at 42C for 16 hours. Finally, these cultures were diluted and plated on LM17. Isolated colonies were tested for phage sensitivity as previously described (2). The CRISPR loci of the resistant isolates were verified by sequencing PCR products, and using relevant phage genome information (1). CRISPR spacer engineering

Enzymes used to carry out restriction digests and PCR were purchased from Invitrogen and used according to the manufacturers instructions. PCRs were carried out on an Eppendorf Mastercycler Gradient thermocycler.

Gene inactivation and site-specific plasmid insertion via homologous recombination in the S. thermophilus chromosome were carried out by sub-cloning into the pCR2.1-TOPO system (Invitrogen), by subsequent cloning in the pORI system using Escherichia coli as a host, and the constructs were ultimately purified and transformed into S. thermophilus as previously described (3).

DNA from mutant WTF858+S1S2 was used as a template to amplify two distinct PCR fragments using P1 (5'-acaaacaacagagaagtatctcattg-3') and P2 (5'-aacgagtacactcactatttgtacg-3') in one reaction, and P3 (5'-tccactcacgtacaaatagtgagtgtactcgtttttgtattctcaagatttaagtaactgtacagtttgattcaacataaaaag-3') and P4 (5'-ctttccttcatcctcgctttggtt-3') in another reaction. Both PCR products were subsequently used as templates in another PCR reaction using primers P1 and P4 to generate the S1S2 construct (fig. S4).

The S1S2 construct was sub-cloned into the Invitrogen pCR2.1-TOPO system. This construct was digested with NotI and HindIII and subsequently cloned into pORI at the NotI and HindIII sites, providing the pS1S2 construct. Integration of pS1S2 into the CRISPR1 locus of strain WTF2972+S4 occurred via homologous recombination at the 3' end of cas7, to generate WTF2972+S4::pS1S2.

The pR construct was generated using the pS1S2 construct as a template. Specifically, the S1S2 construct sub-cloned into pCR2.1-TOPO was digested using BsrGI, which cuts within the CRISPR repeat. Then, the digest was religated and a plasmid containing a single repeat and no spacer was used subsequently for cloning into pORI using NotI and HindIII, generating pR. Integration of pR into the chromosome of strain WTF858+S1S2 at the 3' end of cas7 via homologous recombination generated WTF858+S1S2::pR, a mutant where the CRISPR1 locus is displaced and a unique repeat is inserted in its place.

The mutant WTF858+S1S2::pR was subsequently grown in the absence of erythromycin, and antibiotic-sensitive variants were analyzed to find a mutant that had a complete deletion of the CRISPR1 locus. The deletion was derived from homologous recombination occurring at the 3' end of ORF (as opposed to a recombination event occurring at the 3' end of cas7, which would have resulted

in restoration of the strain WTF858+S1S2), generating WTF858+S1S2DCRISPR1, a mutant where the CRISPR1 locus is deleted (fig. S5). Inactivation of cas genes

For cas5 inactivation, a 801-bp internal piece of cas5 was amplified by PCR using primers 5'-caaatggatagagaaacgc-3' and 5'-ctgataaggtgttcgttgtcc-3' and sub-cloned into Escherichia coli pCR2.1-TOPO (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently cloned into pORI at the EcoRV and HindIII sites. Integration of this construct into the cas5 gene of strain WTF858+S1S2 occurred via homologous recombination of the internal piece of the gene, resulting into WTF858+S1S2::pcas5-.

Similarly, a 672-bp internal piece of cas7 was amplified by PCR using primers 5'-ggagcagatggaatacaagaaagg-3' and 5'-gagagactaggttgtctcagca-3' and sub-cloned into Escherichia coli pCR2.1-TOPO (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently cloned into pORI at the EcoRV and HindIII sites. Integration of this construct into the cas7 gene of strain WTF858+S1S2 occurred via homologous recombination of the internal piece of the gene, resulting into WTF858+S1S2::pcas7-.

SUPPORTING FIGURES

StrainGenBankAccession

Lysotype Comment 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

LMD-9 CP000419 A L l u u u u u u n u u n u u u u uDGCC7689 EF434458 A L l u u u u u u n u u n u u u u uDGCC778 EF434459 A1 BIM of LMD-9 L u l u u u u u u n u u n u u u u u120-9 EF434460 A2 BIM of LMD-9 L u u l u u u u u u n u u n u u u u uDGCC8769 EF434461 A3 BIM of LMD-9 L u u l u u u u u u n u u n u u u u uDGCC1086 EF434462 A L u u u u u u u n u u n u u u u u

SMQ-301 EF434463 B L u l u u l u u n u u n u u u u uDGCC855 EF434464 B1 L u u u l u u l u u n u u n u u u u uDGCC1443 EF434465 B2 L u u l u u u u u l u u l u u n u u n u u u u u

DGCC8234 EF434466 C L u u l u u u l u u n u u u u u l u u u u l u u lDGCC7973 EF434467 C1 L u u u u u l u u x x x x x x u u u u u l u u l

CNRZ703 DQ072990 n.d. L u u l u u u u u u l u u u u u u u u u u u l n u u l u u u uDGCC7796 EF434468 E L u u l u u u u u u l u u u u u u u u u u u l n u u l u u u u

DGCC7710 EF434469 F L u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x uWTF858+S1S2 (= DGCC7778) EF434470 F1 BIM of DGCC7710 L u u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x uWTF858+S3 EF434471 F2 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x uWTF2972+S4 EF434472 F3 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x uWTF2972+S5 EF434473 F4 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x uWTF2972+S6 EF434474 F5 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x uWTF2972+S7 EF434475 F6 BIM of DGCC7710 L u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x uWTF2972+S8 EF434476 F7 BIM of DGCC7710 L l u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x uWTF858F2972+S9S10S11S12 EF434477 F8 BIM of DGCC7710 L u u u u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x uWTF858F2972+S13S14 EF434478 F9 BIM of DGCC7710 L u u u u u u u u u u u u u u u l u u u u u u u u u u u u u u u u u x u

DGCC7699 EF434479 G L u u u u u u u u l u x u u u uDGCC86 EF434480 G1 L u x u u u u l u x u u u uDGCC8170 EF434481 G2 L u u u u u u u u u x u u u u u u uDGCC8168 EF434482 G3 L u u u u u l u u u u u u uDGCC48 EF434483 G3 L u u u u l u u u u u u u

JIM1518 DQ073008 n.d. L l u u u u u u u u u u uJIM1560 DQ072996 n.d. L l u u u u u u u u u u uJIM1575 DQ072997 n.d. L l u u u u u u u u u u uJIM1588 DQ072999 n.d. L l u u u u u u u u u u u4035 DQ073006 n.d. L l u u u u u u u u u u uDGCC7790 EF434484 H L l u u u u u u u u u u uDGCC7852 EF434485 H L l u u u u u u u u u u uDGCC7873 EF434486 H L l u u u x x x x x x x u

CNRZ385 DQ072992 n.d. L u u u u u u u u u u u u u u u u l u u lDGCC7809 EF434487 J L u u u u u u u u u u u u u u u u l u u l

DGCC103 EF434488 K L u u u u l u u u u u u x x x x u u u u x uCNRZ1202 DQ072989 n.d. L u u u u u l u u u u u u u u x u u u u u u x x u u1205.3 DQ073005 n.d. L u u u u u l u u u u u u u u x x x x x x x x x x uCNRZ1205 DQ073004 n.d. L u u u u u l u u u u u u u u x x x x x x x x x x u

DGCC7842 EF434489 M L u u u u l u u u u u u

JIM1567 DQ072995 n.d. L u u u u u n u u u u u u u u u u l u u u u u u u uJIM76 DQ073003 n.d. L u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n u u u u u u u u u u u u u u u uCNRZ1066 CP000024 N L u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n x x x x x x x x x u x u u u uDGCC6297 EF434490 N L u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n x x x x x x x x x u x u u u uDGCC944 EF434491 N L u u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n x x x x x x x x x u x u u u uDGCC766 EF434492 N L u u u u u u u u u u u u u l u u u u u u p u l u u u u u n u u u u u u u u n x x x x x x x x x u x u u u u

DGCC7967 EF434493 Q L u u u u u u u u x l u u x u n u u lDGCC938 EF434494 Q1 L l n u u u u u u u u u u u u u x n u l u u x u n u u lCNRZ389 DQ072987 n.d. L u u u u u u u u l u u u u u u u u u u l n u u x uLMG18311 CP000023 n.d. L u u u u u u u u u n u u u u u l u x x x x u u u u u u u l u u u u n x x x x x x x u u lCNRZ1100 DQ072988 n.d. L u u u u l n u u u u u u u u u l u u u u n u l u u x u n u u lDGCC7785 EF434495 Q2 L u u u x x x x x x x x x x x x x x x x u n u l u u x u n u u lCNRZ388 DQ072986 n.d. L u u n u u u u u l u n u u l u u u u u l n u u u u u u u u x x x u u u n u l u u x u n u u lDGCC292 EF434496 Q3 L l u u u x x u u u u u u u u u l u u u u u u u u u u u x x x x x x x x x x x l

DGCC47 EF434497 R L u u u u u u u u u u u u l u u u u u u u u u u u l u u x x n u u lDGCC7806 EF434498 R L u u u u u u x x u u u u l u u u u u u u u u u u l u u x x n u u lJIM70 DQ073000 n.d. L u u l u l x x u u u u l u u u u u u u u u u u l u u x u n u u lDGCC7981 EF434499 R1 L u u l u l x x u u u u x u u u u u u u u u u u l u u x u n u u lDGCC66 EF434500 R2 L u u l u l x x u u u u l u u u u u u u u u u u l u u x u n u u lJIM72 DQ073002 n.d. L u u l u l x x u u u u l u u u u u u u u u u u l u u l u n u u l

DGCC7984 EF434501 S L u u u u u u u u u u u u n u n u u u u u u u u

DGCC8191 EF434502 T L u u u u u u u u u uDGCC5472 EF434503 T L u u u u u u u u u

DGCC3367 EF434504 U L u u

JIM71 DQ073001 n.d. L u u u l u u u u u u u u u u u u u u uJIM1584 DQ072998 n.d. L u u u l u u u u u u u u u u u u u u u

CNRZ302 DQ072985 n.d. L n u u u u u u u l l u u u u l u u u u u u u u uJIM1293 DQ073007 n.d. L n u u u u u u u l l u x u u l u u x x x u u u u

CNRZ1575 DQ072997 n.d. L u u u u u u u u u u u u u u u u u u u l u l u l u n u u u u u Fig. S1. Graphic representation of CRISPR1 spacers across a variety of S. thermophilus strains. Repeats are not included, only spacers are represented. Each spacer is represented by a combination of one select character in a particular font color, on a particular background color. The color combination allows unique representation of a particular spacer, whereby squares with similar color schemes (combination of character color and background color) represent identical spacers, whereas different color combinations represent distinguishable spacers. Missing spacers are represented by crossed squares. L (blue): CRISPR leader sequence. In the third column, a letter indicates strain lysotype, whereby the lysotype is defined as the spectrum of sensitivity of the strain to a set of phages; lysotypes that show minor differences for specific phages are distinguished by an additional number. n.d.: not determined. BIM: bacteriophage insensitive mutant.

S1 CAACACATTCAACAGATTAATGAAGAATAC F858 .............................. 31381 - 31410 (+) F2972 ....GAT.GATTTC.....T.AC...GA.. 30702 - 30731 (+) S2 TCCACTCACGTACAAATAGTGAGTGTACTC F858 .......................C...... 25442 - 25471 (-) F2972 .......................C...... 25432 - 25461 (-) S3 TTACGTTTGAAAAGAATATCAAATCAATGA F858 .............................. 17215 - 17244 (+) F2972 .............................. 17202 - 17231 (+) S4 CTCAGTCGTTACTGGTGAACCAGTTTCAAT F858 ......T..............T..G.TGG. 32292 - 32321 (+) F2972 .............................. 31582 - 31611 (+) S5 AGTTTCTTTGTCAGACTCTAACACAGCCGC F858 G..............T.............. 22124 - 22153 (+) F2972 .............................. 22075 - 22104 (+) S6 GCCCTTCTAATTGGATTACCTTCCGAGGTG F858 .............................. 35334 - 35363 (-) F2972 .............................. 34492 - 34521 (-) S7 AAGCAAGTTGATATATTTCTCTTTCTTTAT F858 .............................. 10280 - 10309 (-) F2972 .............................. 10270 - 10299 (-) S8 CGTTTTCAGTCATTGGTGGTTTGTCAGCG F858 .T.C...CTCAC.AAA..T......TTTA 30680 - 30708 (-) F2972 ............................. 29988 - 30016 (-) S9 TTACTAGAGCGTGTCGTTAACCACTTTAAA F858 .............................. 7882 - 7911 (+) F2972 .............................. 7874 - 7903 (+) S10 TTCGTTAAAGTCACCTCGTGCTAGCGTTGC F858 .............................. 20670 - 20699 (-) F2972 .............................. 20621 - 20650 (-) S11 ATAACGGTAGCAAATATAAACCTGTTACTG F858 .............................. 8368 - 8397 (+) F2972 .............................. 8360 - 8389 (+) S12 GAAGTAGCCATACAAGAAGATGGATCAGCA F858 .............................. 19047 - 19076 (+) F2972 .............................. 18998 - 19027 (+) S13 GATGTCACTGAGTGTCTAAGCATTGCGTAC F858 .............................. 34444 - 34473 (+) F2972 .............................. 33602 - 33631 (+) S14 TGAATAAGCAGTTCTTGACGACCAACCGAC F858 .............................. 4809 - 4838 (-) F2972 .............................. 4801 - 4830 (-)

Fig. S2. Alignment of the acquired CRISPR spacers with the corresponding genomic region of phage 858 and phage 2972. Identical bases are indicated by a dot, whereas nucleotide polymorphisms are specified. Positions (bp) and DNA strand relative to the phage genomes are indicated on the right.

S1 CAACACATTCAACAGATTAATGAAGAATAC F858 .............................. F858-A ............A................. F858-B ............................C.

Fig. S3. Alignment of CRISPR spacer S1 with the corresponding genomic region of phage 858 and the two mutant phages that have circumvented the CRISPR resistance of strain WTF858+S1S2.

Fig. S4. Schematic representation of the PCR strategy followed to generate the S1S2 construct. Genomic DNA of strain WTF858+S1S2 was used as a template in two distinct PCR reactions with primer pairs P1-P2, and P3-P4, respectively. The two PCR products were mixed and subjected to a third PCR reaction in the presence of primers P1 and P4.

cas5 cas1 cas6 cas7 repeat/spacer region

L S1

S2

P1 P2

TS2

P3 P4

L S1

S2

P1

TS2

P4

L S1

S2 T

ORFWTF858+S1S2

S1S2 construct:


L S1

S2

P1 P2

TS2

P3 P4

L S1

S2

P1

TS2

P4

L S1

S2 T

ORFORFWTF858+S1S2

S1S2 construct:

Fig. S5. Diagram representing the homologous recombination events that led to mutants WTF858+S1S2::pR and WTF858+S1S2DCRISPR1. Strain WTF858+S1S2::pR was generated through integration of the pR plasmid into cas7. Subsequently strain WTF858+S1S2DCRISPR1 was obtained after plasmid excision via homologous recombination at the 3' end of ORF. SUPPORTING REFERENCES 1. C. Lvesque et al., Appl. Environ. Microbiol. 71, 4057 (2005). 2. S. Moineau, J. Fortier, H.-W. Ackermann, S. Pandian. Can J. Microbiol. 38, 875 (1992). 3. W. M. Russell, T. R. Klaenhammer, Appl. Environ. Microbiol. 67, 4361 (2001). Supporting Online Material www.sciencemag.org Materials and Methods Figs. S1 to S5 References and Notes

Plasmid excisionwith deletionof CRISPR1

cas5 cas1 cas6 cas7 ORFWTF858+S1S2DCRISPR1


pORI

Integration of the pR plasmidvia homologous recombination

ORFWTF858+S1S2

repeat/spacer regioncas5 cas1 cas6 cas7 pORI ORFWTF858+S1S2::pR

cas5 cas1 cas6 cas7

repeat/spacer regionpORIPlasmid excisionwith deletionof CRISPR1

cas5 cas1 cas6 cas7 ORFWTF858+S1S2DCRISPR1

cas5 cas1 cas6 cas7 ORFcas5 cas1 cas6 cas7 ORFWTF858+S1S2DCRISPR1


pORI


ORFWTF858+S1S2


pORI


ORFcas5 cas1 cas6 cas7 repeat/spacer region

pORI


ORFORFWTF858+S1S2

repeat/spacer regioncas5 cas1 cas6 cas7 pORI ORFWTF858+S1S2::pR

repeat/spacer regioncas5 cas1 cas6 cas7 pORI ORFrepeat/spacer regioncas5 cas1 cas6 cas7 pORI ORFORFWTF858+S1S2::pR

cas5 cas1 cas6 cas7

repeat/spacer regionpORI

cas5 cas1 cas6 cas7

repeat/spacer regionpORI repeat/spacer regionpORI

Barrangou SOM

Documents

Transcript of Barrangou SOM