This is an electronic reprint of the original article.This reprint may differ from the original in pagination and typographic detail.

Powered by TCPDF (www.tcpdf.org)

This material is protected by copyright and other intellectual property rights, and duplication or sale of all or part of any of the repository collections is not permitted, except that material may be duplicated by you for your research use or educational purposes in electronic or print form. You must obtain permission for any other use. Electronic or print copies may not be offered, whether for sale or otherwise to anyone who is not an authorised user.

Bankar, Sandip B.; Jurgens, German; Survase, Shrikant A.; Ojamo, Heikki; Granström, TomGenetic engineering of Clostridium acetobutylicum to enhance isopropanol-butanol-ethanolproduction with an integrated DNA-technology approach

Published in:Renewable Energy

DOI:10.1016/j.renene.2015.05.052

Published: 30/11/2015

Please cite the original version:Bankar, S. B., Jurgens, G., Survase, S. A., Ojamo, H., & Granström, T. (2015). Genetic engineering ofClostridium acetobutylicum to enhance isopropanol-butanol-ethanol production with an integrated DNA-technology approach. Renewable Energy, 83, 1076–1083. https://doi.org/10.1016/j.renene.2015.05.052

1  

Genetic Engineering of Clostridium acetobutylicum to enhance isopropanol-1  

butanol-ethanol production with an integrated DNA-technology approach 2  

3  

Sandip B. Bankar*, German Jurgens*, Shrikant A. Survase, Heikki Ojamo, Tom Granström 4  

Aalto University, School Chemical Technology, Department of Biotechnology and Chemical 5  

Technology, POB 16100, 00076 Aalto, Finland 6  

7  

8  

*Corresponding authors: 9  

Sandip Bankar and German Jurgens 10  

Phone: +358-505293353; 11  

Fax: +358- 9 462 373; 12  

Email: sandipbankar@gmail.com, german.jurgens@alumni.aalto.fi 13  

14  

15  

2  

Abstract 16  

Acetone being a non-fuel solvent produced during the traditional acetone-butanol-ethanol (ABE) 17  

fermentation by Clostridium acetobutylicum; reduces the overall fuel alcohol yield. However, the 18  

conversion of acetone into isopropanol has been recommended to improve the process economy. 19  

The present study aims to develop an engineered C. acetobutylicum DSM 792 strain to convert 20  

acetone into isopropanol by introducing the secondary alcohol dehydrogenase gene from C. 21  

beijerinckii NRRL B593 using the allele-coupled exchange approach. Batch and continuous 22  

fermentation experiments were carried out with a modified strain C. acetobutylicum DSM 792-23  

ADH to improve the isopropanol yield and titer. The growth and production behavior of the 24  

modified strain in stationary flask culture and controlled batch culture was studied. Almost 50% of 25  

acetone was converted into isopropanol with highest total solvent yield to be 0.39 g.g-1 glucose. The 26  

modified strain also utilized sugar mixture and SO2–ethanol–water spent liquor as a substrate to 27  

produce the solvents. 28  

29  

Keywords: Clostridia, IBE, immobilization, isopropanol, fermentation, column reactor 30  

31  

3  

1. Introduction 32  

The demand for a clean and renewable biofuel has dramatically increased as a new benchmark on 33  

the petroleum industry from last few decades.   Butanol being a superior biofuel to ethanol has 34  

attracted an increased attention because of its chemical properties including higher energy density 35  

and less hygroscopicity [1]. However, the productivity and yields during biofuel production are 36  

limited by chaotropicity, which is reported to be extreme for butanol [2-5]. Butanol has traditionally 37  

been produced by acetone-butanol-ethanol (ABE) fermentation using clostridia [6]. However, ABE 38  

fermentation is currently considered as less economical process for biofuel production with respect 39  

to carbon recovery. The acetone produced during this process cannot be used as a fuel due to 40  

several reasons including its corrosiveness [7-11]. The co-production of acetone with butanol (and 41  

ethanol) is considered undesirable because of the reduction in butanol yield per unit mass of 42  

substrate utilized during the process [9]. Thus, a reduction in the acetone production has been an 43  

important objective of clostridial metabolic engineering. Hence, it is desirable to suppress the 44  

formation of acetone or to convert it into another fuel additive such as isopropanol. Isopropanol is a 45  

simple secondary alcohol that has been used as a cleaning agent and plasticizer in the plastics 46  

industry. Recently, it has been reported that isopropanol can also be used as a fuel additive for the 47  

preparation of high-octane gasoline [12,13]. 48  

Many bacterial metabolites released from bacterial cells, including alcohols, act as 49  

antimicrobials and they frequently presents an obstacle to biotechnologists [2,4,14]. Furthermore, 50  

the microorganisms used to carry out fermentations are already stressed by other factors including 51  

high sugar concentrations and temperature fluctuations [4,15,16]. However, isopropanol is 52  

considerably more polar and less chaotropic than butanol and, hence is typically less inhibitory to 53  

the bacterial cell [4,5,17]. The attempts to reduce the acetone production by metabolic engineering 54  

have so far resulted in decreased butanol production and large accumulation of acetic and butyric 55  

acids in the broth [7,10,11,18]. Acetone formation is essential in the cell culture for cytosolic 56  

4  

detoxification from carboxylic acids and protons to increase the culture pH in response to acetic 57  

acid and butyric acid to produce butanol and ethanol [19]. Hence the conversion of acetone into 58  

isopropanol is desirable instead of suppressing the acetone production in metabolic pathway. The 59  

conversion of acetone into isopropanol is a single reduction step biochemical reaction, which 60  

improves the total yield of fuel alcohols [9,13]. The conversion of acetone into isopropanol in ABE 61  

fermentation can produce mixed alcohols as IBE (isopropanol-butanol-ethanol) without the 62  

disruption of pathway that can directly be used as a biofuel mixture. Isopropanol is produced in 63  

nature by several solventogenic clostridia which simultaneously produce butanol and ethanol 64  

[20,21]. However, the IBE production in these natural isopropanol producers is still low (total 65  

solvent concentration of 5.87 g.l-1) and slow (productivity of 0.12 g.l-1.h) in batch cultures [22,23]. 66  

The future of fuels produced by fermentation largely depends on the availability of 67  

inexpensive and abundant raw materials as well as efficient conversion process. For sustainable 68  

industrial scale IBE production, a number of obstacles such as choice of feedstock, low product 69  

yield and product toxicity need to be overcome. Lignocellulosic biomass being abundantly available 70  

in the nature offers great potential for the production of biofuels with clostridial strains. SEW 71  

(SO2–ethanol–water) pulping as a fractionation process for lignocellulosic fibrous material such as 72  

spruce wood chips, fiber crops or waste paper has been used as a promising pretreatment method 73  

[24-26]. The use of SEW spent liquor for the production of solvents can promote the biorefinery 74  

industry which harvests and processes the trees for their subsequent use. The SEW process which 75  

has a potential to use hardwood, softwood and recycled fibers can minimize the feedstock cost and 76  

also help in improving the current waste water treatment. 77  

The present work was aimed to develop an improved IBE producing strain of C. 78  

acetobutylicum and to optimize its bioprocess. Clostridium acetobutylicum is a commonly used 79  

microorganism for ABE fermentation. It does not possess a gene for secondary alcohol 80  

dehydrogenase (adh) which is required to produce 2-propanol (isopropanol) from acetone [27]. In 81  

5  

order to modify the organism to produce isopropanol the adh gene for isopropanol dehydrogenase 82  

from other species belonging to clostridium genus [28,29] can be inserted into C. acetobutylicum. 83  

For example, C. beijerinckii NRRL B593 and C. aurantibutyricum NCIB 10659 are capable to 84  

produce a mixture of isopropanol and n-butanol with standard production media [29]. These strains 85  

contain a NADPH dependent primary/secondary alcohol (isopropanol) dehydrogenase (EC 1.1.1.1), 86  

which convert both acetone and butyraldehyde to the corresponding alcohols isopropanol and n-87  

butanol, respectively. The adh gene for primary/secondary alcohol dehydrogenase has been 88  

characterized, cloned and sequenced from Clostridium beijerinckii (NRRL B593 and NESTE 255) 89  

by various researchers [30,31]. 90  

The modified strain C. acetobutylicum DSM 792-ADH was developed by 91  

incorporating the gene encoding the secondary alcohol dehydrogenase (adh) from C. beijerinckii 92  

NRRL B593 into the C. acetobutylicum DSM 792 chromosome using allele-coupled exchange 93  

approach [32]. The engineered strain was further used in the optimization of fermentation 94  

parameters to evaluate its performance and stability in industrially pertinent conditions. It was also 95  

attempted to further intensify the total alcohol production in batch and continuous fermentations to 96  

increase the titer and productivity of the solvents. The use of SEW spent liquor from spruce chips 97  

for the production of IBE as described here will help to promote the biorefinery concept. 98  

Genetically modified clostridium strains capable of producing isopropanol could be used in 99  

industrial production of “green” chemicals from renewable and sustainable resources, such as 100  

lignocellulosic biomass. 101  

2. Materials and methods 102  

2.1. Materials 103  

All the nutritional components required for the fermentation were purchased from the 104  

local vendors from Finland [33]. PCR amplification was done with Phusion Flash High-Fidelity 105  

6  

PCR Master Mix (Thermo Fisher Scientific Inc., USA). Restriction (FastDigest) and ligation 106  

enzymes for DNA cloning were obtained from Thermo Fisher Scientific Inc., USA. Vector pUC18 107  

was from Thermo Fisher Scientific Inc., (USA). Oligonucleotides for the cloning were synthesized 108  

by Oligomer Oy (Finland). QIAquick PCR Purification Kit (QIAGEN, USA) was used for 109  

purification of the products after PCR reaction and Wizard® Genomic DNA Purification Kit 110  

(Promega, USA) for the isolation of genomic DNA. One Shot® TOP10 Electrocomp™ Escherichia 111  

coli competent cells were from Invitrogen (USA). Plasmids pMTL-JH16 and pAN2 were obtained 112  

from Prof. Nigel Minton, The University of Nottingham, University Park, Nottingham, NG7 2RD, 113  

UK. The SO2–water–ethanol (SEW) spent liquor was obtained from the Department of Forest 114  

Products Technology, School of Chemical Technology, Aalto University, Finland. 115  

2.2. Microorganism and medium 116  

C. beijerinckii NRRL B593 (synonym: DSM6423) and C. acetobutylicum DSM792 117  

(synonym: ATCC 824) strains were procured from DSMZ (Germany). The cultures were 118  

maintained on a reinforced clostridia medium (RCM) as explained earlier [34]. The production 119  

medium reported by Tripathi et al. [35] was modified to use a sugar mixture as a carbon source 120  

containing glucose, mannose, arabinose, galactose, and xylose as a replacement to sole glucose (60 121  

g L-1). Other medium components were (in g L-1), magnesium sulfate 0.2, sodium chloride 0.01, 122  

manganese sulfate 0.01, iron sulfate 0.01, potassium dihydrogen phosphate 0.5, potassium hydrogen 123  

phosphate 0.5, ammonium acetate 2.2, biotin 0.01, thiamin 0.1, and p-aminobenzoic acid 0.1. Sugar 124  

mixture contained (g L-1) glucose 32.73, mannose 14.78, arabinose 2.14, galactose 3.95, and xylose 125  

6.41 to get total sugars to be 60 g L-1. The medium was adjusted to pH 6.5 with HCl, if necessary 126  

and purged with nitrogen and autoclaved at 203.4 kPa (121 °C) for 20 min. 127  

128  

129  

7  

2.3. SEW spent liquor preparation and conditioning 130  

The SEW spent liquor was produced and conditioned as reported by Sklavounos et al. 131  

[25]. The fractionation of spruce wood chips was carried out by using SEW method and the spent 132  

liquor obtained from it was processed further. The spent SEW liquor was further conditioned with 133  

evaporation, steam stripping, liming and catalytic oxidation to be directly used for the fermentation. 134  

The concentrations of fermentation inhibitors including acetic acid, formic acid, furfural and 135  

hydroxy methyl furfural (HMF) were below the lethal level for clostridia [25]. The pH of spent 136  

liquor was finally adjusted to 6.5 with Ca(OH)2 before the addition of medium components. The 137  

total sugar concentration in final liquor was approximately 43.65 g.l-1. The individual sugar 138  

concentrations were (in g.l-1) glucose 12.4, mannose 16.88, galactose 4.18, arabinose 2.95 and 139  

xylose 7.24. This liquor was diluted to 4 times to further reduce the inhibitory components and was 140  

supplemented with other nutritional components as detailed in previous section 2.2. to make final 141  

sugar concentration to be 60 g.l-1. 142  

2.4. Bacterial plasmids and maintenance 143  

Actively growing cells of C. beijerinckii after overnight incubation were transferred 144  

(5% v/v) into larger volume of RCM medium to produce higher biomass for DNA isolation. 145  

Clostridial cells were harvested after 24 h by centrifugation (4500×g, 10 min) and further used for 146  

DNA extraction by Wizard® Genomic DNA Purification Kit (Promega Corporation, USA). C. 147  

acetobutylicum DSM792 aliquots were activated and inoculated (2% v/v) under anaerobic 148  

conditions into MSS media [36]. 149  

Transformants of E.coli were grown aerobically in Luria–Bertani (LB) medium at 150  

37°C. The media were supplemented with antibiotics as required in the following concentrations: 151  

for C. acetobutylicum, erythromycin (40 µg.ml-1) and thiamphenicol (15 µg.ml-1); for E.coli, 152  

ampicillin (100 µg.ml-1), tetracycline (10 µg.ml-1) and chloramphenicol (25 µg.ml-1). Plasmid DNA 153  

8  

was isolated from E. coli and C. acetobutylicum transformants using QIAprep Spin Miniprep Kit 154  

(QIAGEN, USA). 155  

2.4.1. Plasmid construction 156  

The plasmids and primers used in this study are shown in Table 1 and Table 2. For the 157  

pMTL-JH16-ADH construction first the adc terminator and promoter of the C. acetobutylicum were 158  

cloned into plasmid pUC18 creating pUC-adcP-adcT plasmid. For this the fragment containing an 159  

EagI site and the adc terminator region was created by annealing primers P01 and P02. To obtain 160  

plasmid pUC-adcT the fragment was BamHI-EcoRI digested, ligated with BamHI-EcoRI digested 161  

pUC18 and transformed into E.coli TOP10. Further, the adc promoter region was amplified from 162  

the C. acetobutylicum genomic DNA using primers P03 and P04 and purified with Qiagen PCR 163  

purification kit. The PCR product and pUC-adcT were digested with PstI-BamHI, ligated and 164  

transformed into E.coli TOP10 to obtain plasmid pUC-adcP-adcT. Then, the adh gene was 165  

amplified from C. beijerinckii NRRL B-593 genomic DNA using P05 and P06 as primers. The PCR 166  

product was digested with BamHI-EagI, ligated with BamHI-EagI digested plasmid pUC-adcP-167  

adcT and transformed into E.coli TOP10 to obtain pADH. On further step, using the primers P07 168  

and P08, the ‘adc promoter-adh-adc terminator’ fragment was amplified from pADH, digested with 169  

NotI-NheI, ligated with digested with NotI-NheI plasmid pMTL-JH16 [32] and transformed into 170  

E.coli TOP10 to obtain pMTL-JH16-ADH. 171  

2.4.2. Transformation and integration procedures 172  

Plasmid pMTL-JH16-ADH was methylated by the methyltransferase from pAN2 [37] 173  

in E. coli TOP10 prior to transformation of C. acetobutylicum DSM 792 as described before [38]. 174  

C. acetobutylicum DSM792 was grown in MSS media until the exponential growth stage (OD 1.2 175  

for about 4 hours). All manipulations were carried out in a specially constructed anaerobic chamber 176  

equipped with a mini-centrifuge, heating block and electroporation device. The cells were 177  

9  

centrifuged at 4.5×g for 10 min at 4°C and washed in cold electroporation buffer (EPB) (270mM 178  

sucrose 15 ml; of 686mM NaH2PO4 110µL (pH 7.4)). The cells were centrifuged further and re-179  

suspended in 1.5 ml of cold EPB. The cells (500 µl) were mixed subsequently with DNA (0.8 µg) 180  

in 50µl of water and transferred into cold 0.4 cm gap electroporation cuvette which was chilled for 181  

1 min. After the pulse was applied (600 Ω, 1.8 kV, 50µF) [39] the cells were diluted with 1 ml of 182  

warm MSS medium and incubated for 4h at 37°C for outgrowth. Aliquots of 100 µl were spread on 183  

MSS plates supplemented with 15 µg.ml-1 thiamphenicol to select the plasmid-borne resistance 184  

marker catP. Plates were incubated anaerobically for 2-3 days at 37 °C. The clones were transferred 185  

to MSS plates supplemented with 40 µg.ml-1 erythromycin in order to specifically select double-186  

crossover clones [32]. 187  

2.5. Batch experiments 188  

The preliminary experiments to check the growth and production profile with the 189  

modified strain were carried out as batch experiments in 125 ml screw cap bottles with 50 ml 190  

standard production medium. The medium was inoculated (5% v/v) with 20 h old actively growing 191  

seed culture and incubated at 37 °C for 210 h. The samples were taken after every 12 h and 192  

analyzed for the solvent production and sugar utilization. 193  

The batch experiments in the bioreactor were also carried out under controlled pH and 194  

zero oxygen conditions. These experiments with both pure glucose and sugar mixture as a carbon 195  

source were carried out with otherwise standard production medium to study the behavior of the 196  

modified strain and its solvent production abilities. The samples were analyzed after every 12 h for 197  

the solvent production and sugar utilization. All the experiments were carried out at least in 198  

triplicates and the results reported are the average of them. 199  

200  

201  

10  

2.6. Continuous fermentation 202  

In order to improve the solvent productivity and reduce the operational cost of the 203  

process, the continuous production of IBE solvents are desirable. Chemostat cultivations were 204  

carried out in 1 L jacketed glass bioreactor with a 500 mL fermentation volume. The bioreactor was 205  

inoculated with 10 % inoculum of highly motile cells of C. acetobutylicum DSM792-ADH. After 206  

cultivating the cells in batch mode for 24 h, the fermentation feed medium was continuously 207  

pumped into the bioreactor at different dilution rates. Dilution rates were varied from 0.01 h-1 to 208  

0.14 h-1 with reactor temperature of 37 °C. During the course of fermentation, samples were 209  

collected at regular intervals and analyzed for biomass, acetone, isopropanol, butanol, ethanol, 210  

residual sugar and acids. Unless otherwise stated, all the continuous fermentations were carried out 211  

in duplicates and results reported are the average of two fermentations. Samples for biomass and 212  

product analysis were taken after five reactor volumes for three consecutive days at steady state 213  

condition. The steady state was confirmed by stable biomass and product concentrations at a 214  

specific dilution rate. The continuous fermentations were carried out in three sets of experiments 215  

viz. glucose as a carbon source, sugar mixture as a carbon source and SEW spent liquor as a carbon 216  

source in addition to the standard production medium [33,34]. 217  

2.7. Determination of substrates and products 218  

The solvents (n-butanol, isopropanol, acetone and ethanol) and acids (acetic acid and 219  

butyric acid) were quantified by gas chromatography (Hewlett Packard series 6890) [26]. Glucose, 220  

mannose, arabinose, galactose, and xylose were determined by high-performance liquid 221  

chromatography (Bio-Rad Laboratories, Richmond, CA), equipped with an Inores S 259-H column 222  

(Inovex, Vienna, Austria) packed with Inores cation exchanger (particle size, 9 µm) [33]. The 223  

bioprocess parameters including the solvent productivity and yield were calculated as explained 224  

earlier [33,34]. 225  

11  

3. Results and discussion 226  

Metabolic engineering of the C. acetobutylicum DSM792 strain was carried out with 227  

an aim to convert acetone to isopropanol, and consequently produce mixed fuel alcohols. The 228  

intracellular conversion of acetone into isopropanol is an attractive alternative to avoid acetone 229  

excretion to produce a valuable alcohol. As genetic tools are available for C. acetobutylicum 230  

ATCC824 [40,41], there is a strong interest to transform this native and industrially recognized 231  

ABE producer, into an efficient IBE producer. Although some C. beijerinckii strains reduce acetone 232  

naturally with an endogenous adh gene, the final titers of the solvents have been lower than those of 233  

the best ABE producers [23,29,42]. 234  

3.1. Introduction of adh gene into C. acetobutylicum 235  

C. acetobutylicum being an industrial organism producing commercial biofuels such 236  

as butanol, demands robust fermentation conditions and strains for a feasible and economic 237  

bioprocess. The use of genetic engineering tools to enhance the yield, specificity and feedstock 238  

utilization in the fermentation process is an attractive way to improve its feasibility. 239  

Traditional introduction of adh gene into C. acetobutylicum using replicative plasmids 240  

[9,43,44] was tried (unpublished data) and found not promising from economics and industrial point 241  

of view because of major additional cost of antibiotics required in the growth media and inherently 242  

unstable nature of the plasmid carrying the adh gene. Hence, there was a need to opt for an 243  

economic process with a more effective genetically engineered microorganism. Allele-coupled 244  

exchange approach as a novel DNA integration method into a chromosome was tried with C. 245  

acetobutylicum to enhance the solvent titer and productivity. As a result, the modified C. 246  

acetobutylicum DSM792-ADH was constructed and tested on new SEW spent liquor and sugar 247  

mixture during batch and continuous experiments. 248  

249  

12  

3.2. IBE production in batch fermentation 250  

The preliminary batch experiments containing pure glucose as a carbon source in 251  

stationary flask culture were performed to observe the microbial behavior during the fermentation. 252  

The time course of batch fermentation (Fig. 1) showed that the solvent production started at the end 253  

of the exponential phase. The flask culture resulted in maximum level of total solvents 15 g.l-1 after 254  

144 h. At this time interval the amount of isopropanol observed was 2.51 g.l-1. The production 255  

profile of acetone, isopropanol, ethanol and butanol can be seen in Fig. 1. The flask culture utilized 256  

70.0 % of the sugars and yielded 0.34 g.g-1 of total solvents (supplementary Fig. 1; Table 1). 257  

Although, the acid production and solvent ratio of IBE with remaining acetone formation during the 258  

flask culture were close to standard behavior (supplementary Table 2), the lower total solvent titers 259  

recommended to use controlled batch fermentation in a bioreactor and continuous fermentation as 260  

optional approaches. The time course of batch fermentation in a controlled bioreactor can also be 261  

observed in Fig. 1. When using glucose and the sugar mixture as the substrate for the fermentation 262  

with C. acetobutylicum DSM792-ADH the growth and production profiles were similar to those 263  

with Clostridium wild type strains [34,45]. The batch fermentation in the controlled bioreactor with 264  

medium containing pure glucose resulted in the maximum total solvent titer to be 18 g.l-1 with 2.51 265  

g.l-1 and 10.78 g.l-1 isopropanol and butanol respectively after 72 h fermentation with no further 266  

significant increase thereafter (Fig. 1). Almost 81 % of the glucose was utilized after 72 h 267  

fermentation with the total solvent yield of 0.37 g.g-1. The highest total solvent titer with the sugar 268  

mixture as a substrate in the controlled bioreactor was 15.18 g.l-1 after 72 h fermentation and 269  

resulted in total solvent yield of 0.30 g.g-1. C. acetobutylicum DSM792-ADH could utilize both 270  

pentose as well as hexose sugars as detailed in supplementary Table 2. The order of utilization of 271  

sugars was found to be – glucose˃arabinose˃mannose˃xylose˃galactose (supplementary Table 2). 272  

The conversion efficiency (with respect to acetone) during controlled batch fermentation, with 273  

glucose and the sugar mixture as a substrate was found to be almost similar (̴ 50%). Moreover, the 274  

13  

fermentation profile and performance of the C. acetobutylicum DSM792-ADH were similar to wild 275  

type strains of C. acetobutylicum DSM792 and C. beijerinckii DSM 6423 [23,26,34,45].The results 276  

indicated that C. acetobutylicum DSM792-ADH could successfully utilize hexose and pentose 277  

sugars during the fermentation and can be best suited for the use in biorefinery processes. A 278  

behavioral pattern of the modified strain encouraged us to perform the continuous fermentation 279  

studies with SEW spent liquor as a substrate. 280  

3.3. IBE production in continuous fermentation 281  

The use of SEW spent liquor for the production of ABE solvents have been studied 282  

previously [26]. SEW pulping is a fractionation process for lignocellulosics to fractionate them into 283  

pulp, lignin and monomeric hemicellulose sugar mixtures for further production of value-added 284  

chemicals [25]. The limitations of batch fermentation such as low productivity and high solvent 285  

toxicity were expected to be partly overcome with continuous fermentation of C. acetobutylicum 286  

DSM792-ADH. Three independent continuous experiments were carried out with pure glucose, 287  

sugar mixture and SEW liquor as a substrate to produce AIBE 288  

(acetone:isopropanol:butanol:ethanol). The effect of different dilution rates on IBE production is 289  

shown in Fig. 2. The concentrations of solvents and acids were decreased with increase in dilution 290  

rate in all the three experiments as expected because of increasing share of unconsumed 291  

monosaccharides. The isopropanol concentration at a dilution rate of 0.01 h-1 was found to be 1.5 292  

g.l-1 and 1.3 g.l-1 with pure glucose and the sugar mixture as a substrate. Since the modified strain 293  

have already proved its capability to use sugar mixture for the production of solvents, the studies 294  

with SEW liquor were also carried out to confirm its suitability of to the continuous fermentation 295  

process. C. acetobutylicum DSM792-ADH could utilize the sugars (64.05 %) from SEW liquor and 296  

produced total solvents to the concentration of 6.7 g.l-1 with 0.9 g.l-1 isopropanol at the dilution rate 297  

of 0.01 h-1 (Fig. 2). The results obtained with C. acetobutylicum DSM792-ADH are in accordance 298  

with the results obtained with the wild type isopropanol producing strain C. beijerinckii DSM 6423 299  

14  

[23]. The other solvent titers as well as solvent yield and productivities with SEW liquor were 300  

found to be lower than those with pure glucose and the sugar mixture as a substrate (Fig. 2, Fig. 3 301  

and Fig. 4). A general trend of increase in solvent productivity with increase in dilution rate up to 302  

0.075 h-1 followed by decrease in productivity with higher dilution rates, was observed with all the 303  

fermentation experiment. The highest solvent yield with pure glucose, sugar mixture and SEW 304  

liquor as a substrate, with continuous fermentation were found to be 0.39 g.g-1, 0.29 g.g-1 and 0.17 305  

g.g-1 respectively (Fig. 4). The highest solvent yield, when glucose was used as a substrate in flask 306  

cultivation, controlled batch fermentation and continuous fermentation were found to be 0.34 g.g-1, 307  

0.36 g.g-1, 0.39 g.g-1 respectively. This confirms that the solvent yield based on substrate 308  

consumption did not depend on the genetic modifications, but rather on the physiological conditions 309  

of the culture. Interestingly the solvent ratio (acetone:isopropanol:butanol:ethanol) remained 310  

consistent with all the three continuous experiments as with the wild type strain except the decrease 311  

in acetone concentration (Table 3). Table 3 also depicts the percent conversion of acetone into 312  

isopropanol during the continuous fermentation of C. acetobutylicum DSM792-ADH. Acid 313  

assimilation was also comparable in the modified culture, to improve the C3 compound (acetone or 314  

isopropanol) in the solvents. The conversion of acetone with pure glucose as a substrate was 315  

observed to be in the range between 45 – 50 %. When the sugar mixture was used as substrate the 316  

percentage conversion decreased slightly with increase in the dilution rate and varied in between 40 317  

– 50 %. Besides, the percentage acetone conversion with SEW liquor as a substrate was further 318  

reduced, and observed in the range between 28 – 43 %. Table 3 clearly depicts that, the solvent 319  

conversion ratio remains stable at around 40 – 50 % when all the favorable conditions produced 320  

higher solvent amounts. As the dilution rate increased, the concentration of total solvents was found 321  

to be decreased, which disturbs the standard ratio of solvents (acetone:isopropanol:butanol:ethanol) 322  

as well as the percentage conversion of acetone into isopropanol. The disturbance in conversion 323  

15  

efficiency of the modified strain from acetone into isopropanol was probably due to the imbalance 324  

in cofactor regeneration for the secondary alcohol dehydrogenase [30]. 325  

A study to develop an engineered strain suitable for IBE production by introducing a 326  

primary/secondary alcohol dehydrogenase from C. beijerinckii NRRL B-593 has been tried recently 327  

by several researchers [9,32,44]. The performance of the modified strain C. acetobutylicum 328  

DSM792-ADH was better than that of a natural IBE producer (C. beijerinckii) as detailed in a 329  

previous study [23,45]. Although the complete conversion of acetone into isopropanol was not 330  

achieved in the present study, the conversion up to 50% was in accordance with the other reports 331  

[46,47]. The incomplete conversion of acetone into isopropanol with the modified strain is probably 332  

due to the cofactor imbalance, as the secondary alcohol dehydrogenase is NADPH dependent [30]. 333  

Further increase in IBE yield and productivities were observed with advanced bioprocessing such as 334  

use of immobilized column reactors [48]. 335  

4. Conclusions 336  

The fuel alcohol yield with clostridia can be improved by converting acetone to 337  

isopropanol, and producing mixed IBE instead of ABE. The exclusive production of fuel alcohols 338  

in fermentation broth can significantly reduce the downstream processing cost. Hence, a modified 339  

C. acetobutylicum strain was developed to produce IBE with improved titer and yield. The adh gene 340  

from C. beijerinckii NRRL B593 was constitutively expressed in C. acetobutylicum DSM 792 to 341  

convert acetone into isopropanol. The efficient consumption of glucose in batch and continuous 342  

fermentation without strain degeneration suggests that the engineered strain can be used for long-343  

term fermentation. Moreover, the effective use of sugar mixture and SEW liquor by C. 344  

acetobutylicum DSM792-ADH made it suitable for a cost effective industrial application. The 345  

modified strain converted almost 50 % of the acetone into isopropanol with higher solvent yields. 346  

However, the complete conversion of acetone into isopropanol was not achieved in this study. Since 347  

16  

the secondary alcohol dehydrogenase is NADPH dependent enzyme, increased availability of the 348  

cofactor may improve the conversion efficiency. Moreover, the use of advanced bioprocesses for 349  

IBE solvent production such as the use of immobilized column technique and in-situ solvent 350  

recovery module can further improve the yield as well as productivity of the process. 351  

5. Acknowledgments 352  

Authors are thankful to Professor Adriaan van Heiningen (University of Maine, USA) 353  

and Evangelos Sklavounos, Ph.D. student (Aalto University, Finland) for providing the SEW spent 354  

liquor for this study. We thank Dr. V. Zverlov (Department of Microbiology, Technische 355  

Universität München, Germany) and Dr. O. Berezina (State Research Institute of Genetics and 356  

Selection of Industrial Microorganisms, St. Petersburg, Russia) for their valuable clostridia work 357  

advices. 358  

6. References 359  

1. Bankar SB, Survase SA, Ojamo H, Granström T. Biobutanol: the outlook of an academic 360  

and industrialist. RSC Adv 2013a; 3: 24734–57. 361  

2. Hallsworth JE. Ethanol-induced water stress in yeast. Journal of Fermentation and 362  

Bioengineering 1998; 85: 125-137. 363  

3. Bhaganna P, Volkers RJM, Bell ANW, Kluge K, Timson DJ, McGrath JW, Ruijssenaars 364  

HJ, Hallsworth JE. Hydrophobic substances induce water stress in microbial cells. Microbial 365  

Biotechnology 2010; 3: 701-716. 366  

4. Cray JA, Stevenson A, Ball P, Bankar SB, Eleutherio ECA, Ezeji TC, Singhal RS, 367  

Thevelein JM, Timson DJ, Hallsworth JE. Chaotropicity: a key factor in product tolerance 368  

of biofuel-producing microorganisms. Current Opinions in Biotechnology 2015; In press 369  

(doi: 10.1016/j.copbio.2015.02.010). 370  

17  

5. Cray JA, Russell JT, Timson DJ, Singhal RS, Hallsworth JE. A universal measure of 371  

chaotropicity and kosmotropicity. Environmental Microbiology 2013; 15: 287-296. 372  

6. Jones DT, Woods DR. Acetone-butanol fermentation revisited. Microbiol Rev 1986; 50: 373  

484–524. 374  

7. Jiang Y, Xu C, Dong F, Yang Y, Jiang W, Yang S. Disruption of the acetoacetate 375  

decarboxylase gene in solvent-producing Clostridium acetobutylicum increases the butanol 376  

ratio. Metab Eng 2009; 11: 284–91. 377  

8. Lee JY, Jang YS, Lee J, Papoutsakis ET, Lee SY. Metabolic engineering of Clostridium 378  

acetobutylicum M5 for highly selective butanol production. Biotechnol J 2009; 4: 1432–40. 379  

9. Lee J, Jang YS, Choi SJ, Im JA, Song H, Cho JH, Seung do Y, Papoutsakis ET, Bennett 380  

GN, Lee SY. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for 381  

isopropanol-butanol ethanol fermentation. Appl Environ Microbiol 2012; 78: 1416–23. 382  

10. Tummala SB, Junne SG, Papoutsakis ET. Antisense RNA downregulation of coenzyme A 383  

transferase combined with alcohol-aldehyde dehydrogenase overexpression leads to 384  

predominantly alcohologenic Clostridium acetobutylicum fermentations. J Bacteriol 2003a; 385  

185, 3644 –53. 386  

11. Tummala SB, Welker NE, Papoutsakis ET. Design of antisense RNA constructs for 387  

downregulation of the acetone formation pathway of Clostridium acetobutylicum. J 388  

Bacteriol 2003b; 185: 1923–34. 389  

12. Rassadin V, Shlygin O, Likhterova N, Slavin V, Zharov A. Problems in production of high-390  

octane, unleaded automotive gasolines. Chem. Tech. Fuels Oil 2006; 42: 235–42. 391  

13. Gu, Y. Jiang Y, Wu H, Liu X, Li Z, Li J, Xiao H, Shen Z, Dong H, Yang Y, Li Y, Jiang W, 392  

Yang S. Economical challenges to microbial producers of butanol: feedstock, butanol ratio 393  

and titer. Biotechnol J 2011; 6: 1348–1357. 394  

18  

14. Suryawanshi RK, Patil CD, Borase HP, Narkhede CP, Stevenson A, Hallsworth JE, Patil 395  

SV. Towards an understanding of bacterial metabolites prodigiosin and violacein and their 396  

potential use in commercial sunscreens. International Journal of Cosmetic Science 2015; 37: 397  

98-107. 398  

15. Lievens B, Hallsworth JE, Belgacem ZB, Pozo MI, Stevenson A, Willems KA, Jacquemyn 399  

H. Microbiology of sugar-rich environments: diversity, ecology, and system constraints. 400  

Environmental Microbiology 2015; 17(2): 278-298. 401  

16. Cray JA, Bell ANW, Bhaganna P, Mswaka AY, Timson DJ, Hallsworth JE. The biology of 402  

habitat dominance; can microbes behave as weeds? Microbial Biotechnology 2013; 6: 453-403  

492. 404  

17. Ball P, Hallsworth JE. Water structure and chaotropicity: their uses, abuses, and 405  

implications for biology. Physical Chemistry Chemical Physics 2015; In press 406  

(doi:10.1039/C4CP04564E). 407  

18. Sillers R, Al-Hinai MA, Papoutsakis ET. Aldehyde-alcohol dehydrogenase and/or thiolase 408  

overexpression coupled with CoA transferase downregulation lead to higher alcohol titers 409  

and selectivity in Clostridium acetobutylicum fermentations. Biotechnol Bioeng 2009; 102: 410  

38–49. 411  

19. Zhao Y, Tomas CA, Rudolph FB, Papoutsakis ET, Bennett GN. Intracellular butyryl 412  

phosphate and acetyl phosphate concentrations in Clostridium acetobutylicum and their 413  

implications for solvent formation. Appl Environ Microbiol 2005; 71: 530–7. 414  

20. Chen J-S, Hiu SF. Acetone-butanol-isopropanol production by Clostridium beijerinckii 415  

(synonym, Clostridium butylicum). Biotechnol Lett 1986; 8: 371–6. 416  

21. George HA, Johnson JL, Moore WE, Holdeman LV, Chen JS. Acetone, isopropanol, and 417  

butanol production by Clostridium beijerinckii (syn. Clostridium butylicum) and 418  

Clostridium aurantibutyricum. Appl Environ Microbiol 1983; 45: 1160 –3. 419  

19  

22. Dusséaux S, Croux C, Soucaille P, Meynial-Salles I. Metabolic engineering of Clostridium 420  

acetobutylicum ATCC824 for the high-yield production of a biofuel composed of an 421  

isopropanol/butanol/ethanol mixture. Metab Eng 2013; 18: 1–8. 422  

23. Survase SA, Jurgens G, van Heiningen A, Granström T. Continuous production of 423  

isopropanol and butanol using Clostridium beijerinckii DSM 6423. Appl Microbiol 424  

Biotechnol 2011a; 91:1305–13. 425  

24. Rakkolainen M. Iakovlev M, Teräsvuori A-L, Sklavounos E, Jurgens G, Granström TB, Van 426  

heiningen A. SO2-ethanol-water fractionation of forest biomass and implications for biofuel 427  

production by ABE fermentation. Cell Chem Technol 2010; 44(4-6): 139–45. 428  

25. Sklavounos E, Iakovlev M, Yamamoto M, Teräsvuori, Jurgens G, Granström T, van 429  

Heiningen A. Conditioning of SO2–ethanol–water spent liquor from spruce for the 430  

production of chemicals by ABE fermentation. Holzforschung 2011; 65(4): 551–8. 431  

26. Survase SA, Sklavounos E, Jurgens G, van Heiningen A, Granström T. Continuous acetone–432  

butanol–ethanol fermentation using SO2–ethanol–water spent liquor from spruce. Bioresour 433  

Technol 2011b; 102: 10996–1002. 434  

27. Nölling, J, Breton G, Omelchenko MV, Makarova KS, Zeng Q, Gibson R, Lee HM, Dubois 435  

J, Qiu D, Hitti J, Wolf YI, Tatusov RL, Sabathe F, Doucette-Stamm L, Soucaille P, Daly 436  

MJ, Bennett GN, Koonin EV, Smith DR. Genome sequence and comparative analysis of the 437  

solvent-producing bacterium Clostridium acetobutylicum. J Bacteriol 2001; 183(16): 4823–438  

38. 439  

28. Dürre P. New insights and novel developments in clostridial acetone/butanol/isopropanol 440  

fermentation. Appl Microbiol Biotechnol 1998; 49: 639–48. 441  

29. George HA, Johnson JL, Moore WE, Holdeman LV, Chen JS. Acetone, isopropanol, and 442  

butanol production by Clostridium beijerinckii (syn. Clostridium butylicum) and 443  

Clostridium aurantibutyricum. Appl Environ Microb 1983; 45: 1160–3. 444  

20  

30. Ismaiel AA, Zhu CX, Colby GD, Chen JS. Purification and characterization of a primary-445  

secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. J Bacteriol 446  

1993; 175: 5097–105. 447  

31. Peretz M, Bogin O, Tel-Or S, Cohen A, Li GS, Chen J-S, Burstein Y. Molecular cloning, 448  

nucleotide sequencing, and expression of genes encoding alcohol dehydrogenases from the 449  

thermophile Thermoanaerobacter brockii and the mesophile Clostridium beijerinckii. 450  

Anaerobe 1997; 3: 259–70. 451  

32. Heap JT, Ehsaan M, Cooksley CM, Ng YK, Cartman ST, Winzer K, Minton NP. Integration 452  

of DNA into bacterial chromosomes from plasmids without a counter-selection marker. 453  

Nucleic Acids Res 2012; 40(8): e59. 454  

33. Bankar SB, Survase SA, Ojamo H, Granström T. The two stage immobilized column reactor 455  

with an integrated solvent recovery module for enhanced ABE production. Bioresour. 456  

Technol 2013b; 140: 269–76. 457  

34. Bankar SB, Survase SA, Singhal RS, Granström T. Continuous two stage acetone–butanol–458  

ethanol fermentation with integrated solvent removal using Clostridium acetobutylicum B 459  

5313. Bioresour Technol 2012; 106: 110–116. 460  

35. Tripathi A, Samia H, Jain SR, Viloria-Cols M, Zhuravleva N, Nilsson G, Jungvid H, Kumar 461  

A. Improved bio-catalytic conversion by novel immobilization process using cryogel beads 462  

to increase solvent production. Enzyme Microb Technol 2010; 47: 44–51. 463  

36. Berezina OV, Sineoki SP, Velikodvorskaya GA, Schwarz W, Zverlov VV. Extracellular 464  

glycosyl hydrolase activity of the Clostridium strains producing acetone butanol, and 465  

ethanol. Appl Biochem Microbiol 2008; 44: 42–7. 466  

37. Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. The ClosTron: a universal 467  

gene knock-out system for the genus Clostridium. J Microbiol Methods 2007; 70: 452–64. 468  

21  

38. Mermelstein LD, Papoutsakis ET. In vivo methylation in Escherichia coli by the Bacillus 469  

subtilis phage φ3T I Methyltransferase to protect plasmids from restriction upon 470  

transformation of Clostridium acetobuttylicum ATCC 824. Appl Environ Microbiol 1993; 471  

59: 1077–81. 472  

39. Nakotte S, Schaffer S, Böhringer M, Dürre P. Electroporation of, plasmid isolation from and 473  

plasmid conservation in Clostridium acetobutylicum DSM 792. Appl Microbiol Biotechnol 474  

1998; 50: 564–7. 475  

40. Lehmann D, Lütke-Eversloh T, Switching Clostridium acetobutylicum to an ethanol 476  

producer by disruption of the butyrate/butanol fermentative pathway. Metab Eng 2011; 13: 477  

464–73. 478  

41. Soucaille P, Figge R, Croux C. Process for chromosomal integration and DNA sequence 479  

replacement in Clostridia. 2006; Patent WO2006EP66997 20061003. 480  

42. Qureshi N, Blaschek HP. Production of acetone butanol ethanol (ABE) by a hyper-481  

producing mutant strain of Clostridium beijerinckii BA101 and recovery by pervaporation. 482  

Biotechnol Prog 1999; 15(4): 594-602. 483  

43. Collas F, Kuit W, Clément B, Marchal R, López-Contreras AM, Monot F. Simultaneous 484  

production of isopropanol, butanol, ethanol and 2,3-butanediol by Clostridium 485  

acetobutylicum ATCC 824 engineered strains. AMB Express 2012; 2: 45. 486  

44. Jang Y-S, Malaviya A, Lee J, Im JA, Lee SY, Lee J, Eom MH, Cho JH, Seung do Y. 487  

Metabolic engineering of Clostridium acetobutylicum for the enhanced production of 488  

isopropanol-butanol-ethanol fuel mixture. Biotechnol Progress 2013; 29: 1083–8. 489  

45. Survase SA, van Heiningen A, Granström T. Wood pulp as an immobilization matrix for the 490  

continuous production of isopropanol and butanol. J Ind Microbiol Biotechnol 2013; 40: 491  

209–15. 492  

22  

46. Hanai T, Atsumi S, Liao JC. Engineered synthetic pathway for isopropanol production in 493  

Escherichia coli. Appl Environ Microbiol 2007; 73: 7814–8. 494  

47. Jojima T, Inui M, Yukawa H. Production of isopropanol by metabolically engineered 495  

Escherichia coli. Appl Microbiol Biotechnol 2008; 77: 1219–24. 496  

48. Bankar SB, Jurgens G, Survase SA, Ojamo H, Granström T. Enhanced isopropanol–497  

butanol–ethanol (IBE) production in immobilized column reactor using modified 498  

Clostridium acetobutylicum DSM792. Fuel 2014; 136: 226–32. 499  

49. Yanisch-Perron C, Vieira J, Messing J. Improved M13 phage cloning vectors and host 500  

strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985; 33: 103–19. 501  

Figure legends 502  

Figure 1 The solvents produced in the flask cultivation and controlled batch fermentation with C. 503  

acetobutylicum DSM 792-ADH 504  

Figure 2 The solvent production with respect to dilution rate in continuous fermentations of C. 505  

acetobutylicum DSM 792-ADH with glucose as a substrate (a); sugar mixture as a substrate (b); 506  

and SEW spent liquor as a substrate (c) 507  

Figure 3 Total sugars consumed and total solvents produced in a continuous culture of C. 508  

acetobutylicum DSM 792-ADH  509  

Figure 4 Overall solvent productivity and solvent yield in a continuous culture of C. 510  

acetobutylicum DSM 792-ADH  511  

512  

23  

Table 1 List of strains and plasmids used 513  

Strain or plasmid Relevant characteristicsa Reference or source

Strains

Clostridium beijerinckii NRRL B593

Contains adh-gene

DSMZb

Clostridium acetobutylicum DCM 792

Type strain

DSMZb

E. coli TOP10 Invitrogenc

Plasmids

pUC18 Apr; pMB1 origin [49]

pAN2 Tcr, φ3tI gene; pl5A origin UNd, [37]

pMTL-JH16 ermB lacking promoter, lacZ MCS UNd, [32]

pUC-adcT pUC18 derivative with adc terminator insertion

This study

pADH pUC-adcT derivative with adc promoter insertion

This study

pUC-adcP-adcT pUC-adcP-adcT derivative with adh gene under adc promoter

This study

pMTL-JH16-ADH pMTL-JH16 derivative containing adc promoter, adh gene and adc terminator

This study

a Abbreviations: Apr, ampicillin resistant; Cmr, chloramphenicol resistant; adh, a primary/secondary 514  

alcohol dehydrogenase gene; ermB, macrolide–lincosamide–streptogramin (MLS) antibiotic-515  

resistance marker; MCS, multiple cloning site; adc, acetoacetate decarboxylase gene from C. 516  

acetobutylicum. 517  b Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (German Collection of 518  

microorganisms and Cell Cultures), Germany 519  c Life Technologies Corporation, Invitrogen, USA 520  d The University of Nottingham, University Park, Nottingham, NG7 2RD, UK. 521  

522  

24  

523  

Table 2 List of primers used in this study 524  

525  

526  

Primer Sequence from 5’to 3’ Reference

P01

GATCCACTACGGCCGTAAAAATAAGAGTTACCTTAAAT

GGTAACTCTTATTTTTTTAATGC

[9]

P02 AATTGCATTAAAAAAATAAGAGTTACCATTTAAGGTAA

CTCTTATTTTTACGGCCGTAGTG

[9]

P03 ATATCTGCAGAAGTGTACTTTTATTTTCGAAAGC [9]

P04 ATATGGATCCTAATAATGTTTAGCTTTTCTAACAT [9]

P05 ATATGGATCCTAAGGAGGAACATATTTTATGAAAG [9]

P06 ATATCGGCCGTTATAATATAACTACTGCTTTAATTA [9]

P07 ATGGCGGCCGCTTCGCTATTACG This study

P08 ATATGCTAGCGGAATTGTGAGCGGATAAC This study

25  

Table 3 Solvent ratio and percent acetone conversion into isopropanol during the continuous 527  

fermentation of C. acetobutylicum DSM 792-ADH 528  

DR (h-1) Acetone:Isopropanol:Butanol:Ethanol (% acetone conversion to isoproanol)

Pure glucose Sugar mixture SEW liquor

0.010 1.5:1.4:6.1:1.0 (47.803) 1.6:1.4:6.0:1.0 (46.737) 1.8:1.3:5.9:0.9 (43.209)

0.025 1.4:1.4:6.2:1.0 (49.958) 1.5:1.5:6.2:0.9 (49.877) 1.9:1.3:6.0:0.9 (40.991)

0.050 1.4:1.3:6.3:1.0 (48.014) 1.4:1.3:6.3:0.9 (48.181) 1.8:1.3:6.0:1.0 (40.707)

0.075 1.5:1.3:6.1:1.0 (46.595) 1.7:1.4:6.0:0.9 (45.900) 1.8:1.1:6.2:1.0 (37.035)

0.100 1.6:1.3:6.1:1.0 (44.709) 2.0:1.3:5.9:0.9 (39.562) 1.8:0.7:6.2:1.2 (28.555)

0.120 1.7:1.4:6.1:0.8 (45.219) 2.1:1.4:5.8:0.6 (40.307) -

0.140 1.8:1.5:5.8:0.9 (45.303) 2.3:1.4:6.1:2.0 (37.282) -

529  

530  

531  

532  

533  

534  

535  

536  

537  

538  

26  

539  

 540  

 541  

Figure 1The solvents produced in the flask cultivation and controlled batch fermentation withC. 542  acetobutylicum DSM 792-ADH 543  

   544  

27  

 545  

Figure 2The solvent production with respect to dilution rate in continuous fermentations of C. 546  acetobutylicum DSM 792-ADH with glucose as a substrate (a); sugar mixture as a substrate (b); 547  and SEW spent liquor as a substrate (c). 548  

28  

549  

 550  

 551  

Figure 3 Total sugars consumed and total solvents produced in a continuous culture of C. 552  acetobutylicum DSM 792-ADH  553  

554  

0

5

10

15

20

25

30

35

40

45

50

0

2

4

6

8

10

12

0 0.02 0.04 0.06 0.08 0.1 0.12 0.14 0.16

Tota

l util

ized

suga

rs (g

.l-1)

Tota

l sol

vent

s (g.

l-1)

Dilution rate (h-1)

Total solvents (glucose) Total solvents (sug. mix.) Total solvents (liquor) Total utilized sugars (glucose) Total utilized sugars (sug. mix.) Total utilized sugars (liquor)

29  

555  

Figure 4 Overall solvent productivity and solvent yield in a continuous culture of C. 556  acetobutylicum DSM 792-ADH  557  

558  

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45

0.5

0 0.02 0.04 0.06 0.08 0.1 0.12 0.14 0.16

Solv

ent p

rodu

ctiv

ity (g

.l-1h-1

); So

lven

t yie

ld (g

.g-1

)

Dilution rate (h-1)

Solvent productivity (glucose) Solvent productivity (sug. mix.) Solvent productivity (liquor) Solvent yield (glucose) Solvent yield (sug. mix.) Solvent yield (liquor)