B Kim et al. Nature 000 , 1-5 (2012) doi:10.1038/nature11546

1
B Kim et al. Nature 000, 1-5 (2012) doi:10.1038/nature11546 DARPin E2_79 binds IgE-C3 domains outside the FcRI binding site.

TAGS:

description

DARPin E2_79 binds IgE-C e 3 domains outside the Fc e RI a binding site. B Kim et al. Nature 000 , 1-5 (2012) doi:10.1038/nature11546. - PowerPoint PPT Presentation

Transcript of B Kim et al. Nature 000 , 1-5 (2012) doi:10.1038/nature11546

Page 1: B Kim et al. Nature 000 , 1-5 (2012) doi:10.1038/nature11546

B Kim et al. Nature 000, 1-5 (2012) doi:10.1038/nature11546

DARPin E2_79 binds IgE-C3 domains outside the FcRIbinding site.

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The ...

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The ...

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

GI Motility online (May 2006) | doi:10.1038/gimo48

GI Motility online (May 2006) | doi:10.1038/gimo48

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×− ...

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×− ...

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

doi:10.1038/nature06481 LETTERS

doi:10.1038/nature06481 LETTERS

JB Kim et al. Nature 461 , 649 - 653 (2009) doi:10.1038/nature08 436

JB Kim et al. Nature 461 , 649 - 653 (2009) doi:10.1038/nature08 436

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

DOI: 10.1038/ncomms1280 molecular dynamics of single ...

DOI: 10.1038/ncomms1280 molecular dynamics of single ...

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015