of February 12, 2018.This information is current as

Independent of Antibody SecretionSalmonellaProtective Immunity against

Cutting Edge: B Cells Are Essential for

Stephen J. McSorleyMinelva R. Nanton, Sing Sing Way, Mark J. Shlomchik and

ol.1201413http://www.jimmunol.org/content/early/2012/11/11/jimmun

published online 12 November 2012J Immunol 

MaterialSupplementary

3.DC1http://www.jimmunol.org/content/suppl/2012/11/12/jimmunol.120141

        average*  

4 weeks from acceptance to publicationSpeedy Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2012 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on February 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Cutting Edge: B Cells Are Essential for ProtectiveImmunity against Salmonella Independent of AntibodySecretionMinelva R. Nanton,* Sing Sing Way,† Mark J. Shlomchik,‡,x andStephen J. McSorley{

Typhoid fever and nontyphoidal bacteremia caused bySalmonella remain critical human health problems.B cells are required for protective immunity to Salmo-nella, but the mechanism of protection remains un-clear. In this study, we immunized wild-type, B cell–deficient, Ab-deficient, and class-switched Ab-deficientmice with attenuated Salmonella and examined protec-tion against secondary infection. As expected, wild-typemice were protected and B cell–deficient mice suc-cumbed to secondary infection. Interestingly, micewith B cells but lacking secreted Ab or class-switchedAb had little deficiency in resistance to Salmonella in-fection. The susceptibility of B cell–deficient mice cor-related with marked reductions in CD4 T cell IFN-gproduction after secondary infection. Taken together,these data suggest that the primary role of B cells inacquired immunity to Salmonella is via the develop-ment of protective T cell immunity. The Journal ofImmunology, 2012, 189: 000–000.

Typhoid fever is caused by infection with Salmonellatyphi and is a serious health concern worldwide,causing an estimated 21 million cases and 216,000

deaths per year (1). Nontyphoidal salmonellosis (NTS) iscaused by other Salmonella serovars and is a growing prob-lem among HIV-infected adults and HIV-negative childrenin Africa and Asia (2–5). Currently, there are two vaccines fortyphoid fever that each provide limited protection but arenot widely used in endemic areas (6, 7). There is no availablevaccine for NTS, although numerous target Ags have recentlybeen defined (8). The development of novel, effective vaccinesfor typhoid and NTS requires greater understanding of Sal-monella-specific T and B cell responses (9).

Immunity to Salmonella is studied using a well-establishedmurine model of typhoid, in which Salmonella typhimuriumcauses fatal disseminated disease in susceptible, Nramps mice(10, 11). After oral infection, Salmonella can gain access to themammalian host by invading M cells in the Peyer’s patches ofthe small intestine (10). Salmonella subsequently disseminatesvia the lymphatic system and replicates within phagocytic cellsof the spleen, liver, and bone marrow. Salmonella activelyinhibits phagolysosomal fusion, and infected macrophagesrequire activation via IFN-g to kill bacteria (12). Salmonella-specific Th1 cells that produce IFN-g are essential for con-trolling bacterial growth, and mice lacking ab CD4 T cells,Th1 cells, or IFN-g eventually succumb to primary infectionwith attenuated bacteria (13, 14). Patients with primary ge-netic deficiencies in IL-12 or IFN-g receptor signaling sufferfrom repeated disseminated Salmonella infections (15, 16).Thus, Th1 cells play an important role in mediating protec-tive immunity in both human and murine salmonellosis.The resolution of primary Salmonella infection confers ro-

bust protective immunity against secondary challenge. CD4T cells are essential for this acquired resistance, and depletionof CD4 T cells eliminates the protective effect of vaccinationwith attenuated Salmonella (17). More surprisingly, for anintramacrophage infection, B cells are also essential for ac-quired immunity to Salmonella, and immunized B cell–deficientmice display enhanced susceptibility to secondary infection(18–20). However, the protective role of Abs in secondaryimmunity is somewhat controversial. Passive transfer of Absis reported to be protective in some studies, whereas othershave observed no protective effect (18, 19, 21). Furthermore,neither IgA nor mucosal Igs are required for protective immu-nity to Salmonella (8, 22). B cells can contribute to protectiveimmunity via Ag presentation to Salmonella-specific Th1 cells(18, 23) or as an important source of inflammatory cyto-kines during infection (24, 25). However, it remains unclear

*Department of Pediatric Infectious Disease, Center for Infectious Diseases and Micro-biology Translational Research, University of Minnesota Medical School–Twin Cities,Minneapolis, MN 55455; †Division of Infectious Diseases, Cincinnati Children’s Hos-pital Medical Center, Cincinnati, OH 45229; ‡Department of Laboratory Medicine,Yale University School of Medicine, New Haven, CT 06510; xSection of Immunobiol-ogy, Yale University School of Medicine, New Haven, CT 06510; and {Department ofAnatomy, Physiology and Cell Biology, Center for Comparative Medicine, University ofCalifornia Davis, Davis, CA 95616

Received for publication May 25, 2012. Accepted for publication October 18, 2012.

This work was supported by National Institutes of Health Grants AI091298 (toM.R.N.), AI087830 (to S.S.W.), AI043603 (to M.J.S.), AI055743 and AI073672(to S.J.M.), and T32 GM008244 (to the University of Minnesota Medical ScientistTraining Program).

Address correspondence and reprint requests to Minelva R. Nanton or Dr. Stephen J.McSorley, University of Minnesota Medical School, Center for Infectious Diseases andMicrobiology Translational Research, McGuire Translational Research Facility, 20016th Street SE, Minneapolis, MN 55455 (M.R.N.) or Center for Comparative Medicine,Department of Anatomy, Physiology and Cell Biology, University of California Davis,Davis, CA 95616 (S.J.M.). E-mail addresses: nanto001@umn.edu (M.R.N.) andsjmcsorley@ucdavis.edu (S.J.M.)

The online version of this article contains supplemental material.

Abbreviations used in this article: HKST, heat-killed Salmonella typhimurium; mIgM,membrane IgM; m+s IgM, membrane and secretory IgM; NTS, nontyphoidal salmo-nellosis.

Copyright� 2012 by TheAmerican Association of Immunologists, Inc. 0022-1767/12/$16.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1201413

Published November 12, 2012, doi:10.4049/jimmunol.1201413 by guest on February 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

whether the contribution of B cells to protective immunityis largely mediated by Ab-dependent or Ab-independentmechanisms.In this study, we examined the role of B cells in protection

against infection with virulent Salmonella using transgenicmouse strains that lack B cells, class-switched Ab, or Ab secre-tion and demonstrate that Ab production is largely dispens-able for protection against secondary Salmonella infection. Incontrast, B cells are required for optimal priming of Salmonella-specific Th1 cells that mediate bacterial clearance.

Materials and MethodsMice

BALB/c (wild-type) and JhD/BALB/c (B cell–deficient) mice (NationalCancer Institute, Frederick, MD) were used at 6–12 wk age. Transgenicmembrane and secretory (m+s) IgM and membrane IgM (mIgM) use theB1–8 H chain, have a restricted BCR repertoire, were maintained on a JhD/BALB/c background (26). Transgenic mice were intercrossed with JhD/BALB/c mice and were used at 6–12 wk age. Homozygosity at the JHDlocus was maintained by interbreeding with JhD mice, and PCR screeningof the mIgM H chain was done using the following primers: Vh186.2 59,CTACTGGATGCACTGGGTGA and Vh186.2 39, TTGGCCCCAGTA-GTCAAAGTA. All mice were housed in specific pathogen-free conditionsfor breeding and experimentation.

Bacteria and infection

Attenuated S. typhimurium BRD509 (DaroA/DaroD) and parental virulentstrain SL1344 were grown overnight in Luria–Bertani broth and diluted inPBS after estimating bacterial counts by spectrophotometry. Mice were im-munized i.v. with 5 3 105 BRD509 and challenged orally with 5 3 107

SL1344 after oral administration of 100 ml 5% NaHCO3. Infection doseswere confirmed by plating serial dilutions onto MacConkey agar plates. Anymoribund infected mice were euthanized as stipulated in our InstitutionalAnimal Care and Use Committee protocol. Bacterial growth in vivo wascalculated by plating serial dilutions of organ homogenates onto MacConkeyagar, and bacterial counts were determined after overnight incubation at 37˚C.

Detection of in vivo cytokine production and flow cytometry

Salmonella-specific CD4 and CD8 T cell responses were visualized as previ-ously described (27). Immunized mice were injected i.v. with 1 3 108 heat-killed S. typhimurium (HKST) and spleens were harvested 3 or 5 h later.A single-cell suspension was surface stained using FITC-, PE-, PE-Cy5–,PE-Cy7-, allophycocyanin-, eF450-, AF700-, and allophycocyanin-eF780–conjugated Abs to CD3, CD4, CD8, Gr-1, CD11c, CD11b, F4/80, B220,and CD44 in Fc block (spent 24G2 supernatant, 2% rat serum, 2% mouseserum). Cells were fixed, permeabilized, and stained intracellularly using PE-conjugated anti–IFN-g. All staining reagents were purchased from BDBiosciences (San Jose, CA) or eBioscience (San Diego, CA). Samples wereanalyzed by flow cytometry using a FACSCanto, and data were analyzedusing FlowJo software (Tree Star).

Salmonella-specific Ab response

Blood was collected by retro-orbital bleeding, and sera were prepared andstored at 220˚C. Salmonella-specific IgM and IgG Abs were measured byELISA, as previously described (27).

Statistical analysis

Statistical analysis was performed using unpaired t tests (Prism 4; GraphPadSoftware, La Jolla, CA). Survival data were compared using a log-rank (Mantel–Cox) test (Prism 4). Statistical differences between groups are delineated asfollows: *p , 0.05, **p , 0.01, and ***p , 0.001.

Results and DiscussionClass-switched Abs are not required for secondary protection againstSalmonella

Defining protective immune responses to Salmonella infectionis a prerequisite for development of new effective vaccinesagainst typhoid and NTS (10). Although CD4 T cells arecritical for protective immunity to Salmonella, the contribu-tion of B cells has not been clearly defined. Salmonella-specific

Ab production, inflammatory cytokine production, and directAg presentation to T cells have each been proposed asmechanisms to explain the protective role of B cells duringsecondary infection (18, 19, 23, 24, 28). We sought to in-vestigate whether B cells provide secondary protective im-munity against Salmonella primarily in an Ab-dependent or-independent manner. Given previous data showing that se-rum transfer can protect against Salmonella (19), but thatneither IgA nor mucosal Ig is required (8), we hypothesizedthat systemic IgG is essential for secondary clearance ofbacteria. To test this hypothesis, we examined immunity inB cell–deficient mice (JhD), transgenic mice with B cells thatcannot class switch or secrete Ab (mIgM), and mice withB cells that cannot class switch but are able to secrete IgM(m+s IgM) (26). Although the mIgM and m+s IgM transgenicmice have a restricted BCR repertoire, they do not have sig-nificant deviations in naive B cell and T cell subsets (Sup-plemental Fig. 1A–D and Ref. 29). All four strains (wild-type,B cell–deficient, mIgM, and m+s IgM mice) survived vacci-nation with attenuated S. typhimurium and had largely clearedbacteria from the spleen 44 d later (Supplemental Fig. 1E).This confirmed previous reports that resolution of primaryinfection with attenuated Salmonella does not require B cells(18, 19).To examine acquired immunity to secondary Salmonella

infection, naive and immunized mice from all four strainswere challenged orally with virulent S. typhimurium (Fig. 1A).Regardless of the B cell compartment, all naive mice suc-cumbed to primary infection with virulent Salmonella at

FIGURE 1. Class-switched Abs are not necessary for immunity to Salmo-nella. (A) Naive wild-type, JhD, m+s IgM, and mIgM mice were infected

orally with 5 3 107 S. typhimurium (SL1344) and survival was monitored.

Wild-type, JhD, m+s IgM, and mIgM mice were immunized i.v. with 5 3105 S. typhimurium (BRD509 DaroA/DaroD). Forty-two to 66 d later, mice

were challenged orally with 5 3 107 S. typhimurium (SL1344) and survival

was monitored. Data are pooled from three separate experiments and show

the percentage of surviving mice in each group. The total number of mice is

indicated. Survival of immunized wild-type, m+s IgM, and mIgM mice was

statistically different (***p , 0.001) from JhD mice using a log-rank

(Mantel–Cox) test. Survival of mIgM was also statistically different by log-

rank test when compared with wild-type mice but not when compared with

m+s IgM mice (*p , 0.05). (B) Mice were immunized i.v. with 5 3 105

BRD509, and at day 42 they were challenged orally with 5 3 107 SL1344

and serum was collected 9 d later. Data show levels of heat-killed Salmonella-specific IgM and IgG as determined by ELISA (n = 4–5 mice/group).

2 CUTTING EDGE: THE ROLE OF B CELLS IN SALMONELLA IMMUNITY

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

a similar rate (Fig. 1A). In contrast, immunized wild-typemice resisted secondary infection with virulent Salmonella,whereas B cell–deficient mice succumbed to secondary chal-lenge (Fig. 1A). Surprisingly, m+s IgM mice that lack class-switched Ab also survived secondary infection with Salmo-nella, demonstrating a similar degree of protective immunityto wild-type mice (Fig. 1A). Furthermore, most mIgM micethat lack all secreted Abs were resistant to secondary Salmo-nella infection. However, ∼25% of these mice eventually diedof infection, and this was statistically different from the sur-vival of wild-type and B cell–deficient mice (Fig. 1A). Takentogether, these data confirm that B cells are essential for re-sistance to secondary infection with virulent Salmonella, andthey surprisingly demonstrate that production of class-switchedAbs is not required for protective immunity. Additionally, al-though secreted IgM Abs may contribute to secondary protec-tion, the mechanism of B cell–mediated protection againstsecondary Salmonella infection is largely Ab-independentin this vaccination and rechallenge model.Given these findings, it was important to confirm the ab-

sence of circulating Salmonella-specific Ab in each B cell–deficient strain examined above. Serum was collected 9 d aftersecondary infection, and Salmonella-specific Ab responses wereexamined. Nine days after secondary infection, both wild-typemice and IgM Ab only (m+s IgM) mice had modest levels ofcirculating Salmonella-specific IgM (Fig. 1B), but only wild-type mice developed Salmonella-specific IgG (Fig. 1B). Theseresults confirm that only wild-type mice produced a class-switched Ab response to Salmonella, but that IgM Ab onlymice developed low Salmonella-specific IgM responses duringsecondary infection.

Secondary bacterial clearance does not require class-switched Abs

Given the fact that mice lacking all Abs had a 25% death ratefollowing virulent challenge, it seemed likely that bacterialclearance was hindered at late time points in these mice,perhaps because IgM is required for clearance from a partic-ularly persistent anatomical site such as the mesenteric lymphnodes (30). Thus, we examined the rate of bacterial clearancein immunized mice lacking B cells, class-switched Abs, or allAbs. Three days after secondary infection, wild-type mice hadlower bacterial loads in the spleen than did B cell–deficientmice (Fig. 2A), demonstrating that B cells are required forrapid secondary clearance of bacteria. At this early time point,no significant differences were apparent between Ab-deficientstrains and B cell–deficient mice, but Ab-deficient mice hada trend toward lower CFUs in the spleen (Fig. 2A). No sig-nificant differences were detected in liver CFUs at this sameearly time point (Fig. 2B). Nine days after secondary in-fection, mice lacking B cells had much higher bacterial loadsin both the spleen and liver compared with wild-type mice(Fig. 2). In marked contrast, mIgM and m+s IgM micehad lower CFUs in both spleen and liver (Fig. 2). Takentogether, these data demonstrate that the rate of bacterialclearance during secondary infection is largely unaffected bythe absence of Abs, despite a requirement for B cells. Thisfinding contrasts with prior studies that showed a protectiveeffect of serum transfer (19, 21). However, these studies werenot designed to test an Ab-independent role of B cells, andboth studies described protection against low dose challenge.Our finding has broad implications because the measure-

ment of circulating Ig is often used as an indicator of vaccineefficacy.

B cell–deficient mice have reduced CD4 T cell responses to Salmonella

It is clear from previous work that secretion of IFN-g by Th1cells is critical for the resolution of Salmonella infections (14,

FIGURE 2. Rapid bacterial clearance does not require Abs. (A and B) Mice

were immunized i.v. with 5 3 105 BRD509 and 42–66 d later challenged

orally with 5 3 107 SL1344. Three and 9 d later bacterial counts were de-

termined in (A) spleen and (B) liver. Data show mean log10 CFUs per organ

(n = 6–26 mice per group/time point; *p , 0.05, **p , 0.01, ***p , 0.001).

FIGURE 3. Ab is not required for optimal Salmonella-specific Th1 cells. (Aand B) Mice were immunized i.v. with 5 3 105 BRD509 and 42–47 d later

injected i.v. with 108 HKST to stimulate T cell responses. Bar graphs showing

mean number of (A) CD4 or (B) CD8 T cells producing IFN-g after stim-

ulation with HKST (**p , 0.01, ***p , 0.001).

The Journal of Immunology 3

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

31). We confirmed this by depleting CD4 and CD8 T cells inimmunized wild-type mice and challenging them with a viru-lent strain of Salmonella. T cell depletion caused a significantincrease in bacterial loads during secondary infection (Sup-plemental Fig. 2A). It has been suggested that Abs can enhanceT cell responses to Salmonella by allowing bacterial uptake viaFc receptors on dendritic cells (32). B cells also can present Agand secrete cytokines that shape the development of protectiveT cell responses. Thus, we examined the effect of B cell or Abdeficiency on the generation of Salmonella-specific Th1 cells.Wild-type, B cell–deficient, m+s IgM, and mIgM mice

were immunized with attenuated Salmonella, and Salmonella-specific CD4 T cell responses were examined 42 d later. Aspreviously reported (33, 34), immunized wild-type mice hada large population of CD4 T cells that produced IFN-g inresponse to HKST stimulation (Fig. 3A, Supplemental Fig.2B). In marked contrast, immunized B cell–deficient micehad lower numbers of IFN-g–producing Th1 cells in responseto HKST (Fig. 3A, Supplemental Fig. 2B). This differencewas Ab-independent, as immunized m+s IgM and mIgMmice had similar levels of IFN-g–producing CD4 T cells asdid wild-type mice (Fig. 3A, Supplemental Fig. 2B). In fact,mIgM mice, which lack all secreted Abs, had a largerpopulation of Salmonella-specific IFN-g–producing CD4 Tcells. Interestingly, IFN-g–producing CD8 T cells were alsoslightly reduced in immunized B cell–deficient mice, but thiswas not statistically significant (Fig. 3B, Supplemental Fig.2B). Taken together, these data indicate that B cells, but notAbs, are required for shaping the development of protectiveCD4 Th1 responses to Salmonella. A similar role for B cellshas been reported in other infection models such as lym-phocytic choriomeningitis virus and Pneumocystis (35, 36).Although B cells may directly present Ag and drive Salmo-nella-specific Th1 responses, a recent study demonstrated thatB cell production of IL-6 is important for maximal Th17responses, and B cell production of IFN-g contributed to Th1development (24). A recent study has also shown that B cellscan negatively affect secondary responses to Salmonella in-fection via an MyD88- and IL-10–dependent mechanism(37). Thus, B cells likely contribute to protective CD4responses via Ag presentation and production of specificcytokines that drive effector lineage commitment duringprimary responses. It is not yet clear whether these requiredB cells are necessarily Salmonella-specific, but the limitedB cell repertoire in IgM only mice and in no Ab mice did notaffect protective immunity. We also attempted to address thisissue using in vitro restimulation and B cell tetramer pull-down experiments in previously infected mice, but we didnot detect an elevated frequency of Salmonella-specific B cellsusing either of these approaches. However, it remains possiblethat expanded Salmonella-specific B cells contribute to im-munity to secondary infection.Collectively, our data demonstrate that Ab production plays

only a minor role in Salmonella immunity in our live vacci-nation model, whereas B cells are required for the develop-ment of protective T cell immunity. These findings will beimportant for the development of new effective vaccinesagainst typhoid and NTS.

DisclosuresThe authors have no financial conflicts of interest.

References1. Crump, J. A., S. P. Luby, and E. D. Mintz. 2004. The global burden of typhoid

fever. Bull. World Health Organ. 82: 346–353.2. Gordon, M. A., A. M. Kankwatira, G. Mwafulirwa, A. L. Walsh, M. J. Hopkins,

C. M. Parry, E. B. Faragher, E. E. Zijlstra, R. S. Heyderman, and M. E. Molyneux.2010. Invasive non-typhoid salmonellae establish systemic intracellular infection inHIV-infected adults: an emerging disease pathogenesis. Clin. Infect. Dis. 50: 953–962.

3. Graham, S. M. 2010. Nontyphoidal salmonellosis in Africa. Curr. Opin. Infect. Dis.23: 409–414.

4. MacLennan, C. A., J. J. Gilchrist, M. A. Gordon, A. F. Cunningham, M. Cobbold,M. Goodall, R. A. Kingsley, J. J. van Oosterhout, C. L. Msefula, W. L. Mandala,et al. 2010. Dysregulated humoral immunity to nontyphoidal Salmonella in HIV-infected African adults. Science 328: 508–512.

5. MacLennan, C. A., E. N. Gondwe, C. L. Msefula, R. A. Kingsley, N. R. Thomson,S. A. White, M. Goodall, D. J. Pickard, S. M. Graham, G. Dougan, et al. 2008.The neglected role of antibody in protection against bacteremia caused by non-typhoidal strains of Salmonella in African children. J. Clin. Invest. 118: 1553–1562.

6. Black, R. E., M. M. Levine, C. Ferreccio, M. L. Clements, C. Lanata, J. Rooney,and R. Germanier; Chilean Typhoid Committee. 1990. Efficacy of one or two dosesof Ty21a Salmonella typhi vaccine in enteric-coated capsules in a controlled fieldtrial. Vaccine 8: 81–84.

7. Fraser, A., M. Paul, E. Goldberg, C. J. Acosta, and L. Leibovici. 2007. Typhoidfever vaccines: systematic review and meta-analysis of randomised controlled trials.Vaccine 25: 7848–7857.

8. Lee, S. J., L. Liang, S. Juarez, M. R. Nanton, E. N. Gondwe, C. L. Msefula,M. A. Kayala, F. Necchi, J. N. Heath, P. Hart, et al. 2012. Identification ofa common immune signature in murine and human systemic salmonellosis. Proc.Natl. Acad. Sci. USA 109: 4998–5003.

9. Pasetti, M. F., J. K. Simon, M. B. Sztein, and M. M. Levine. 2011. Immunology ofgut mucosal vaccines. Immunol. Rev. 239: 125–148.

10. Griffin, A. J., and S. J. McSorley. 2011. Development of protective immunity toSalmonella, a mucosal pathogen with a systemic agenda. Mucosal Immunol. 4:371–382.

11. Tsolis, R. M., M. N. Xavier, R. L. Santos, and A. J. Baumler. 2011. How to becomea top model: impact of animal experimentation on human Salmonella disease re-search. Infect. Immun. 79: 1806–1814.

12. Mastroeni, P., A. Grant, O. Restif, and D. Maskell. 2009. A dynamic view of thespread and intracellular distribution of Salmonella enterica. Nat. Rev. Microbiol. 7:73–80.

13. Hess, J., C. Ladel, D. Miko, and S. H. Kaufmann. 1996. Salmonella typhimuriumaroA- infection in gene-targeted immunodeficient mice: major role of CD4+ TCR-ab cells and IFN-g in bacterial clearance independent of intracellular location. J.Immunol. 156: 3321–3326.

14. Ravindran, R., J. Foley, T. Stoklasek, L. H. Glimcher, and S. J. McSorley. 2005.Expression of T-bet by CD4 T cells is essential for resistance to Salmonella infection.J. Immunol. 175: 4603–4610.

15. Dorman, S. E., and S. M. Holland. 2000. Interferon-g and interleukin-12 pathwaydefects and human disease. Cytokine Growth Factor Rev. 11: 321–333.

16. MacLennan, C., C. Fieschi, D. A. Lammas, C. Picard, S. E. Dorman, O. Sanal,J. M. MacLennan, S. M. Holland, T. H. Ottenhoff, J. L. Casanova, andD. S. Kumararatne. 2004. Interleukin (IL)-12 and IL-23 are key cytokines forimmunity against Salmonella in humans. J. Infect. Dis. 190: 1755–1757.

17. Nauciel, C. 1990. Role of CD4+ T cells and T-independent mechanisms in acquiredresistance to Salmonella typhimurium infection. J. Immunol. 145: 1265–1269.

18. Mastroeni, P., C. Simmons, R. Fowler, C. E. Hormaeche, and G. Dougan. 2000.Igh-62/2 (B-cell-deficient) mice fail to mount solid acquired resistance to oralchallenge with virulent Salmonella enterica serovar typhimurium and show impairedTh1 T-cell responses to Salmonella antigens. Infect. Immun. 68: 46–53.

19. McSorley, S. J., and M. K. Jenkins. 2000. Antibody is required for protectionagainst virulent but not attenuated Salmonella enterica serovar typhimurium. Infect.Immun. 68: 3344–3348.

20. Mittrucker, H. W., B. Raupach, A. Kohler, and S. H. Kaufmann. 2000. Cuttingedge: role of B lymphocytes in protective immunity against Salmonella typhimuriuminfection. J. Immunol. 164: 1648–1652.

21. Mastroeni, P., B. Villarreal-Ramos, and C. E. Hormaeche. 1993. Adoptive transferof immunity to oral challenge with virulent salmonellae in innately susceptibleBALB/c mice requires both immune serum and T cells. Infect. Immun. 61:3981–3984.

22. Wijburg, O. L., T. K. Uren, K. Simpfendorfer, F. E. Johansen, P. Brandtzaeg, andR. A. Strugnell. 2006. Innate secretory antibodies protect against natural Salmonellatyphimurium infection. J. Exp. Med. 203: 21–26.

23. Ugrinovic, S., N. Menager, N. Goh, and P. Mastroeni. 2003. Characterization anddevelopment of T-Cell immune responses in B-cell-deficient (Igh-62/2) mice withSalmonella enterica serovar Typhimurium infection. Infect. Immun. 71: 6808–6819.

24. Barr, T. A., S. Brown, P. Mastroeni, and D. Gray. 2010. TLR and B cell receptorsignals to B cells differentially program primary and memory Th1 responses toSalmonella enterica. J. Immunol. 185: 2783–2789.

25. Barr, T. A., S. Brown, P. Mastroeni, and D. Gray. 2009. B cell intrinsic MyD88signals drive IFN-g production from T cells and control switching to IgG2c. J.Immunol. 183: 1005–1012.

26. Chan, O. T., L. G. Hannum, A. M. Haberman, M. P. Madaio, andM. J. Shlomchik. 1999. A novel mouse with B cells but lacking serum antibodyreveals an antibody-independent role for B cells in murine lupus. J. Exp. Med. 189:1639–1648.

27. Griffin, A., D. Baraho-Hassan, and S. J. McSorley. 2009. Successful treatment ofbacterial infection hinders development of acquired immunity. J. Immunol. 183:1263–1270.

4 CUTTING EDGE: THE ROLE OF B CELLS IN SALMONELLA IMMUNITY

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

28. Cunningham, A. F., F. Gaspal, K. Serre, E. Mohr, I. R. Henderson, A. Scott-Tucker, S. M. Kenny, M. Khan, K. M. Toellner, P. J. Lane, and I. C. MacLennan.2007. Salmonella induces a switched antibody response without germinal centersthat impedes the extracellular spread of infection. J. Immunol. 178: 6200–6207.

29. Hannum, L. G., A. M. Haberman, S. M. Anderson, and M. J. Shlomchik. 2000.Germinal center initiation, variable gene region hypermutation, and mutant B cellselection without detectable immune complexes on follicular dendritic cells. J. Exp.Med. 192: 931–942.

30. Griffin, A. J., L. X. Li, S. Voedisch, O. Pabst, and S. J. McSorley. 2011. Dissem-ination of persistent intestinal bacteria via the mesenteric lymph nodes causes ty-phoid relapse. Infect. Immun. 79: 1479–1488.

31. Mastroeni, P., B. Villarreal-Ramos, and C. E. Hormaeche. 1992. Role of T cells, TNFaand IFNg in recall of immunity to oral challenge with virulent salmonellae in micevaccinated with live attenuated aro- Salmonella vaccines. Microb. Pathog. 13: 477–491.

32. Tobar, J. A., P. A. Gonzalez, and A. M. Kalergis. 2004. Salmonella escape fromantigen presentation can be overcome by targeting bacteria to Fc gamma receptorson dendritic cells. J. Immunol. 173: 4058–4065.

33. Griffin, A. J., and S. J. McSorley. 2011. Generation of Salmonella-specific Th1 cellsrequires sustained antigen stimulation. Vaccine 29: 2697–2704.

34. Srinivasan, A., J. Foley, and S. J. McSorley. 2004. Massive number of antigen-specific CD4 T cells during vaccination with live attenuated Salmonella causesinterclonal competition. J. Immunol. 172: 6884–6893.

35. Whitmire, J. K., M. S. Asano, S. M. Kaech, S. Sarkar, L. G. Hannum,M. J. Shlomchik, and R. Ahmed. 2009. Requirement of B cells for generating CD4+

T cell memory. J. Immunol. 182: 1868–1876.36. Lund, F. E., M. Hollifield, K. Schuer, J. L. Lines, T. D. Randall, and B. A. Garvy.

2006. B cells are required for generation of protective effector and memoryCD4 cells in response to Pneumocystis lung infection. J. Immunol. 176: 6147–6154.

37. Neves, P., V. Lampropoulou, E. Calderon-Gomez, T. Roch, U. Stervbo,P. Shen, A. A. Kuhl, C. Loddenkemper, M. Haury, S. A. Nedospasov, et al.2010. Signaling via the MyD88 adaptor protein in B cells suppresses pro-tective immunity during Salmonella typhimurium infection. Immunity 33:777–790.

The Journal of Immunology 5

by guest on February 12, 2018http://w

ww

.jimm

unol.org/D

ownloaded from