Auxin Metabolism and Function in the Multicellular Brown Alga ...

Auxin Metabolism and Function in the MulticellularBrown Alga Ectocarpus siliculosus1[W]

Aude Le Bail, Bernard Billoud, Nathalie Kowalczyk, Mariusz Kowalczyk, Morgane Gicquel,Sophie Le Panse, Sarah Stewart, Delphine Scornet, Jeremy Mark Cock,Karin Ljung, and Benedicte Charrier*

CNRS-Universite Pierre et Marie Curie, UMR 7139 Marine Plants and Biomolecules (A.L.B., B.B., N.K., M.G.,S.S., D.S., J.M.C., B.C.), and Platform of Cytology, CNRS FR2424 (S.L.P.), Station Biologique de Roscoff, 29682Roscoff cedex, France; and Department of Forest Genetics and Plant Physiology, Umea Plant Science Centre,Swedish University for Agricultural Sciences, S–901 83 Umea, Sweden (M.K., K.L.)

Ectocarpus siliculosus is a small brown alga that has recently been developed as a genetic model. Its thallus is filamentous,initially organized as a main primary filament composed of elongated cells and round cells, from which branches differentiate.Modeling of its early development suggests the involvement of very local positional information mediated by cell-cellrecognition. However, this model also indicates that an additional mechanism is required to ensure proper organization of thebranching pattern. In this paper, we show that auxin indole-3-acetic acid (IAA) is detectable in mature E. siliculosus organismsand that it is present mainly at the apices of the filaments in the early stages of development. An in silico survey of auxinbiosynthesis, conjugation, response, and transport genes showed that mainly IAA biosynthesis genes from land plants havehomologs in the E. siliculosus genome. In addition, application of exogenous auxins and 2,3,5-triiodobenzoic acid had differenteffects depending on the developmental stage of the organism, and we propose a model in which auxin is involved in thenegative control of progression in the developmental program. Furthermore, we identified an auxin-inducible gene calledEsGRP1 from a small-scale microarray experiment and showed that its expression in a series of morphogenetic mutants waspositively correlated with both their elongated-to-round cell ratio and their progression in the developmental program.Altogether, these data suggest that IAA is used by the brown alga Ectocarpus to relay cell-cell positional information andinduces a signaling pathway different from that known in land plants.

Brown algae are multicellular organisms that belongto the phylum Heterokontophyta, which also includesthe oomycetes. The divergence between heterokontsand other phyla comprising multicellular organisms,such as Opisthokonta (metazoa and fungi), Viridiplan-tae, and the red algal lineage, is dated to more than1,000 million years ago (Yoon et al., 2004). On the onehand, brown algae share several obvious features withland plants, such as the presence of a cell wall, al-though with a different composition (Kloareg andQuatrano, 1988), and similar growth metabolism andresponse (i.e. photosynthesis and phototropism). Onthe other hand, brown algae share subcellular featureswith animal cells, such as the presence of centrosomes(Katsaros et al., 2006), and some aspects of theirmetabolism (production of eicosanoid oxylipins; Ritteret al., 2008). Brown algae are coastal organisms, re-

quiring strong attachment or adherence to rocks orother substrates (other algae, etc.) in order to survive.Their economic potential is important in some areas ofthe globe, with Asia considering them as a central partof their diet (wakame, kombu) and Europe using themas a source of fertilizers, cosmetics, pharmacologicalproducts, and defense elicitors (Klarzynski et al., 2000;Abad et al., 2008; Holtkamp et al., 2009).

Diverse morphologies are observed in brown algae,from crust-like forms to the large thallus blades foundin giant kelps. Fucales have long been good models forinvestigating brown alga and land plant embryogen-esis. Given its large size and its ease of manipulation,the Fucales zygote has been particularly amenable tocytological and pharmacological experiments (Kropf,1997). Polarization of the zygote after fertilizationinvolves several subcellular components (cell wall,microtubules, centrioles, and actin; for review, seeKropf, 1992) and is affected by auxin, which alters thepolarity of the embryo and its developmental pattern(Basu et al., 2002; Sun et al., 2004). However, Fucus isnot amenable to genetic studies, limiting its utility infurther investigations of the processes controllingmorphogenesis in brown algae.

Recently, Ectocarpus siliculosus (order Ectocarpales)was chosen as a genetic and genomic model of brownalgae (Peters et al., 2004). It is a small macroscopicfilamentous alga that grows in temperate regions

1 This work was supported by the French Ministry of NationalEducation and Research (to A.L.B.) and the French Groupementd’Interet Scientifique “Europole Mer.”

* Corresponding author; e-mail [email protected] author responsible for distribution of materials integral to the

findings presented in this article in accordance with the policydescribed in the Instructions for Authors (www.plantphysiol.org) is:Benedicte Charrier ([email protected]).

[W] The online version of this article contains Web-only data.www.plantphysiol.org/cgi/doi/10.1104/pp.109.149708

128 Plant Physiology�, May 2010, Vol. 153, pp. 128–144, www.plantphysiol.org � 2010 American Society of Plant Biologists www.plantphysiol.orgon March 23, 2018 - Published by Downloaded from

Copyright © 2010 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

throughout the globe, and knowledge on this organ-ism has been compiled over the last two centuries(Charrier et al., 2008). Its relatively small (200 Mb) ge-nome has been sequenced and annotated (http://www.genoscope.cns.fr/spip/Ectocarpus-siliculosus,740.html).Unlike Fucus, fertilization is isogamous in E. siliculosus,which entails little, if any, parental influence on thedevelopment of the zygote (Stern, 2006). For organ-isms with isogamous fertilization, the perception ofphysical factors such as gravity and light is determi-nant for organismal development (Cove, 2000). How-ever, the perception of these factors is diminished in amarine environment, making the embryonic develop-mental mechanisms in E. siliculosus a particularlypertinent issue worthy of investigation.E. siliculosus develops uniseriate filaments, resulting

in one of the simplest architectures of multicellularorganisms. Its sporophyte body is composed of twomains parts: the prostrate body (Fig. 1, A–C) and theupright body (Fig. 1, D–E). The prostrate body is madeof crawling filaments composed of two cell types.Elongated (E) cells are localized at the apices, wherethey ensure the apical growth by cell division andelongation. They then progressively differentiate cen-tripetally to produce the second cell type, the round(R) cells, thereby generating filaments with E cells onthe edges and R cells in the center (Fig. 1B; Le Bailet al., 2008a). Then, secondary growth axes develop,preferentially in the center of the primary filament andon the R cells (Fig. 1C; Le Bail et al., 2008a). Uprightfilaments then develop from the prostrate body andultimately differentiate into sporangia (Fig. 1, D andE). This early developmental pattern is subject to asignificant level of stochasticity in terms of the pro-portion and position of the two cell types along the

filament, leading to a morphologically heterogeneouspopulation. Nevertheless, the pattern is controlled bybiological mechanisms, because statistical studieshave identified several intrinsic constraints leadingto a characteristic architecture (Le Bail et al., 2008a).Furthermore, modeling of these development stepsindicates that local positional information, corre-sponding to the cell identity of the two neighboringcells, is sufficient to account for most features of thisearly differentiation pattern (Billoud et al., 2008). Moreprecisely, based on observations, it has been postu-lated that the presence of an R cell in the immediateneighborhood is necessary to allow E-to-R cell differ-entiation. However, spontaneous differentiation of anisolated R cell in the center of the filament is some-times observed. This cannot be accounted for by themodel and implies that local positional information,while being the main mechanism controlling cell dif-ferentiation in the early stages, operates in synergywith an integrated mechanism involving the percep-tion of the overall body organization.

Despite the absence of characterized algal mutantsimpaired in phytohormone biosynthesis or signaling,several types of phytohormones (auxins, cytokinins,and abscisic acid) have been reported to be present inbrown algae and to interfere with their development(for review, see Tarakhovskaya et al., 2007). Thus, wesought to investigate the possible role of phytohor-mones in the development of E. siliculosus.

In this paper, we present data that suggest that auxinplays a role as a signaling molecule controlling theprogression of development in this macroalga, and weaddress the issue of its conservation in eukaryotes, atopic of increasing interest in the plant community(Lau et al., 2008, 2009).

Figure 1. Morphology of the E. silicu-losus sporophyte. The body of theE. siliculosus sporophyte is composedof two main parts: (1) the prostratebody attached to the substratum, cor-responding to the vegetative phase;and (2) the upright body, correspond-ing to filaments growing vertically inseawater and ultimately differentiatingsporangia. The prostrate body (PB)originates from germinating zygotes(or mitospores or unfertilized gametes;A), which produce a uniseriate fila-ment composed of two cell types (B):E cells located at the apices and R cellsat the center. About 10 d after germi-nation (dag), the primary filament dif-ferentiates secondary prostrate axes(C). Upright filaments (UF) differentiatefrom the prostrate body, and these arecomposed of squared, large cells (D),ultimately developing sporangia (E).

Auxin in the Brown Algal Model Ectocarpus siliculosus

Plant Physiol. Vol. 153, 2010 129 www.plantphysiol.orgon March 23, 2018 - Published by Downloaded from



RESULTS

Presence of Auxin Compounds in E. siliculosus andPossible Metabolic Pathways

Axenic filaments of E. siliculosus sporophytes werecollected, and the levels of several auxin compoundswere measured by both liquid chromatography-massspectrometry and gas chromatography-mass spec-trometry. Table I shows that E. siliculosus containslow but significant amounts of auxin indole-3-aceticacid (IAA), indole-3-carboxylic acid (ICA), and indole-3-propionic acid (IPA), with IAA being the mostabundant (3.6 ng g21). No other free indoles (especiallyIAA catabolites, 4-chloroindole-3-acetic acid, indole-3-butyric acid [IBA], and indole-3-acetamide [IAM])were detected in algal tissues. In addition, alkalinehydrolysis did not reveal any IAA conjugates, norwere any detected by direct measurement.

The localization of IAA within the filaments of E.siliculosus was determined by immunolocalization atthe early stages of development. Compared with thenegative control (Fig. 2A), immunolocalization of thea-tubulin protein showed homogeneous distributionwithin the whole filament (Fig. 2B). In contrast, IAAseemed to be preferentially localized in the apices ofthe filaments, with a lower concentration in the centralcells (Fig. 2, C and D).

As IAAwas present in E. siliculosus sporophytes, weinvestigated the possibility of a biosynthetic pathwayoperating in E. siliculosus. Knowledge of its genomicsequence allowed the search for homologs of genesencoding enzymes involved in IAA biosynthesis inland plants (for review, see Woodward and Bartel,2005). Considering the phylogenetic distance betweenland plants and brown algae (Baldauf, 2008), thesignificance of E values was difficult to estimate.Nevertheless, Figure 3 and Table II show that homo-logs of several enzymes of the Trp-dependent pathwaywere found in the genome of this alga, with similarsequences forming in several cases a bidirectional besthit (BBH), which is a good indication of orthology(Overbeek et al., 1999). In addition, we searched forconserved functional domains by systematically com-

paring the sequence signatures in Arabidopsis (Arabi-dopsis thaliana) proteins with their counterparts in E.siliculosus (Table II).

Among the enzymes involved in the terminal stepsof IAA biosynthesis, myrosinase and AAO1 displayedsignificant similarities with E. siliculosus proteins.However, the similarity with nitrilase and CYP71A13was lower. Enzymes synthesizing Trp (IGPS, TSA1,and TSB1) also seemed well conserved, and moreinterestingly, Trp decarboxylase and YUCCA of theTAM pathway had homologs in the E. siliculosusgenome that were supported by a BBH. The cyto-chrome P450 monooxygenases CYP79B2, CYP79B3,and CYP83B1 were moderately conserved. Less con-servation was observed for the enzymes of two addi-tional alternative pathways, the IPA and the IAMpathways. In agreement with the lack of indole-3pyruvic acid in E. siliculosus filaments, no reliablehomologs of Trp aminotransferases (TAA1-like genes;Stepanova et al., 2008) or of IPA decarboxylase werefound. The lack of Trp monooxygenase homologscorroborates the absence of IAM in E. siliculosus.However, a putative IAM hydrolase (AMI1 homolog)was found at a low significance level. Altogether, thesedata support the existence of a Trp-dependent IAAbiosynthesis pathway in E. siliculosus, with the TAMand IAOx subpathways being the most probable ones(Fig. 3).

Very low conservation with IAA conjugation en-zymes having sugar or amino acid moieties (GH3family, ILL, ICR, ILR; Table II) was found, which is in

Table I. Auxin compounds detected in the E. siliculosussporophyte tissues

GC-MS, Gas chromatography-mass spectrometry; LC-MS, liquidchromatography-mass spectrometry; NQ, not quantified (detectedbelow the level of quantification).

Compound CAS No.LC-MS Transition LC-MS Level

GC-MS Transition GC-MS Level

pg mg21

IAA 87-51-4 190.09 / 130.07 3.66 6 0.26261.12 / 202.11 2.80 6 0.32

ICA 771-50-6 176.07 / 118.07 0.59 6 0.10245.12 / 216.08 NQ

IPA 830-96-6 204.10 / 130.07 NQ275.13 / 202.11 0.71 6 0.16

Figure 2. Immunolocalization of IAA along the filaments of E. silicu-losus. IAA was immunolocalized in very young sporophytic organisms(10 d old; blue-purple color; see “Materials andMethods”). A, Negativecontrol corresponding to the omission of the primary antibody. B,a-Tubulin immunolocalization showing overall labeling. C, IAA im-munolocalization showing the absence of IAA in the center of the fila-ments, corresponding mainly to R cells (stars). D, Detail of a filamentapex after IAA immunolabeling, showing the absence of labeling inthe central R cells. In these cells, the chloroplast is particularly visibleas a golden brown area. Bars = 50 mm.

Le Bail et al.

130 Plant Physiol. Vol. 153, 2010 www.plantphysiol.orgon March 23, 2018 - Published by Downloaded from



accordance with the lack of detectable IAA-conjugatedcompounds in the E. siliculosus extracts. In contrast,the machinery used for IAA conversion into IBA in theperoxisome of land plants is significantly representedin E. siliculosus, at least at the genome level.An in silico search for homologs of IAA transporters

in E. siliculosus revealed a lack of conservation of theauxin efflux transporter PIN and the auxin influxtransporter AUX1. The same result was obtained forthe ABP1 glycoprotein located in the endoplasmic re-ticulum membrane. On the contrary, the multidrug re-sistance protein ABCB19 (also named MDR1, MDR11,and PGP19; Titapiwatanakun et al., 2009) had twomatches with very significant similarity (BLAST P = 0).In E. siliculosus, a large family codes for these trans-porters (103 members), and 18 of them display sig-nificant similarity with ABCB19 (P , 10230; Table II;Supplemental Table S1).Finally, despite the fact that a complete suite of

Cullin, ASK1, and RUB1-associated proteins (SCFcomplex) and its regulators (CAND1, SGT1b) seemedto be conserved, no IAA-specific F-box protein TIR1homolog was detected (Table II). Furthermore, nosignificant similarity was found with the transcription

factors of the auxin-response factor (ARF) and theAUX/IAA families.

Auxin Modifies the Branching Pattern inE. siliculosus Sporophytes

The effect of auxin on the growth and developmentin E. siliculosus was tested at different stages of its lifecycle. E. siliculosus development follows a complexheteromorphic haplodiploid life cycle (Muller, 1967).Diploid sporophytes produce both meiospores (from ameiotic event) and mitospores, which ensure vegeta-tive propagation. Mobile meiospores generate inde-pendent male or female gametophytes (dioecism),which, once sexually mature, produce isogamousmobile gametes that fuse in the environment. Never-theless, both female and male unfertilized gametes areable to germinate and generate an organism with thesame morphology as the diploid sporophyte. Thishaploid organism does not produce cells that can fuse,and it is called a parthenosporophyte.

Auxin compounds had no effect on meiospore ger-mination. In contrast, the application of IAA (50 mM)on mitospores prevented germination by 100%. Partial

Figure 3. Indole compounds and putative enzymes involved in the synthesis of IAA in E. siliculosus. Substrates (black) andenzymes (blue) of the four biosynthetic pathways known or predicted in land plants (Woodward and Bartel, 2005; Nafisi et al.,2007; Sugawara et al., 2009) are presented. The indole product quantified in E. siliculosus sporophytes is framed in red.Putatively conserved enzymes inferred from genome sequence analysis of E. siliculosus are indicated by red dots. A yellow starindicates a BBH (see “Materials and Methods”).





Table II. Sequence conservation between Arabidopsis and E. siliculosus

Proteins of Arabidopsis involved in the different steps of auxin synthesis and function were used to query the whole proteome of E. siliculosus. Foreach function, only the best-matching pairs are reported (the complete analysis results are available as Supplemental Table S1). The Ath in Esicolumn shows the BLAST E values for the search of Arabidopsis proteins within the E. siliculosus proteome. A second BLAST search was performedfor each best-matching protein of E. siliculosus in the complete proteome of Arabidopsis. The E value for this reverse BLAST query is reported in thecolumn Esi in Ath in cases when the best hit is the initial Arabidopsis protein (the sequence pair is a bidirectional best hit). The EST column showswhether an EST for the E. siliculosus sequence is known. The Conserved Domains column gives the domains shared by the E. siliculosus andArabidopsis similar proteins, found by InterProScan in the following databases: Gene3D, HAMAP, Pfam, PIRSF, PRINTS, ProSite, Panther,Superfamily, and TIGR, for which entries begin with G3DSA, MF, PF, PIRSF, PR, PS, PTHR, SSF, and TIGR, respectively.

FunctionArabidopsis UniProt Entry Protein in

E. siliculosus

BLAST E ValueEST Conserved Domains

Accession No. Identifier Ath in Esi Esi in Ath

IAA biosynthesisIGPS P49572 TRPC_ARATH Esi0000_0449 5 3 10–36 + G3DSA:3.20.20.70; PF00218;

PTHR22854:SF2TSA1 Q42529 Q42529_ARATH Esi0036_0051a 8 3 10–41 + G3DSA:3.40.50.1100;

MF_00131; MF_00133;PF00290; PF00291;PS00168; PTHR10314:SF3;SSF51366; SSF53686;TIGR00262; TIGR00263

TSB1 Q0WUI8 Q0WUI8_ARATH Esi0036_0051a 1 3 10–137 4 3 10–137

Trpdecarboxylase

Q8RY79 TYDC1_ARATH Esi0099_0045 4 3 10–94 1 3 10–88 + G3DSA:1.20.1340.10;G3DSA:3.40.640.10;G3DSA:3.90.1150.10;PF00282; PR00800;PTHR11999:SF11; SSF53383

YUCCA Q9LMA1 FMO1_ARATH Esi0350_0023 1 3 10–46 1 3 10–48 + G3DSA:3.50.50.60;PIRSF000332;PTHR23023:SF4; SSF51905

CYP79B2/3 Q501D8 C79B3_ARATH Esi0063_0068 7 3 10–14 + G3DSA:1.10.630.10; PF00067;PR00385; PR00463; PS00086;PTHR19383:SF143; SSF48264

CYP71A13 O49342 C71AD_ARATH Esi0063_0067 3 3 10–17 + G3DSA:1.10.630.10; PF00067;PR00385; PR00463; PS00086;PTHR19383:SF143; SSF48264

CYP83B1 (SUR2) O65782 C83B1_ARATH Esi0063_0067 1 3 10–24

C-S lyase (SUR1) Q9SIV0 Q9SIV0_ARATH Esi0002_0157 2 3 10–20 + G3DSA:3.40.640.10; PF00155;PR00753; SSF53383;PTHR11751

Myrosinase P37702 MYRO_ARATH Esi0176_0045 2 3 10–81 + G3DSA:3.20.20.80; PF00232;PR00131; PTHR10353:SF6;SSF51445

Nitrilase P32961 NRL1_ARATH Esi0003_0068 9 3 10–15 + G3DSA:3.60.110.10; PF00795;PTHR23088; PS50263;SSF56317

AAO1 Q7G193 ALDO1_ARATH Esi0058_0108 6 3 10–107 + G3DSA:1.10.150.120;G3DSA:3.10.20.30;G3DSA:3.30.365.10;G3DSA:3.30.390.50;G3DSA:3.30.465.10;G3DSA:3.90.1170.50;PF00111; PF00941; PF01315;PF01799; PF02738; PF03450;PS00197; PS51085;PS51387; PTHR11908;SSF47741; SSF54292;SSF54665; SSF55447;SSF56003; SSF56176

IAM hydrolase Q9FR37 Q9FR37_ARATH Esi0082_0071 9 3 10–14 + PS00571; PTHR11895TAA1 Q9SB62 Q9SB62_ARATH None

IAA metabolismILL1 P54969 ILL1_ARATH NoneILL2 P54970 ILL2_ARATH None

(Table continues on following page.)

Le Bail et al.




Table II. (Continued from previous page.)


E. siliculosus



ILL3 O81641 ILL3_ARATH NoneILL4 O04373 ILL4_ARATH NoneILL5 Q9SWX9 ILL5_ARATH NoneICR1 Q8LE98 ICR1_ARATH NoneICR2 Q9ZQC5 ICR2_ARATH NoneICR3 Q9LSS5 ICR3_ARATH NoneACX1 Q9ZQP2 ACO12_ARATH Esi0493_0006 2 3 10–101 6 3 10–102 + G3DSA:1.10.540.10;

G3DSA:1.20.140.10;G3DSA:2.40.110.10;PF01756; PF02770;PTHR10909:SF11; SSF47203;SSF56645

ACX4 Q96329 ACOX4_ARATH Esi0005_0083 2 3 10–36 + G3DSA:1.10.540.10;G3DSA:1.20.140.10;G3DSA:2.40.110.10;PF00441; PF02770;PF02771; PS00072;PS00073;PTHR10909:SF10;SSF47203; SSF56645

AIM1 Q9ZPI6 Q9ZPI6_ARATH Esi0063_0042 2 3 10–93 3 3 10–82 + G3DSA:1.10.1040.10;G3DSA:3.40.50.720;G3DSA:3.90.226.10;PF00378; PF00725;PF02737; PTHR23309;SSF48179; SSF51735;SSF52096

IAR1 Q9M647 IAR1_ARATH Esi0005_0095 1 3 10–12 6 3 10–16 2 PF02535IAR4 Q8H1Y0 ODPA2_ARATH Esi0122_0080 3 3 10–86 6 3 10–91 + PF00676; PTHR11516:SF4;

SSF52518KAT1 Q8LF48 THIK1_ARATH Esi0320_0011 1 3 10–80 2 3 10–14 + PF00108; PF02803;

PIRSF000429;PS00098; PS00099;PS00737; PTHR18919:SF15;SSF53901; TIGR01930

PEX5 O82467 O82467_ARATH Esi0002_0040 2 3 10–62 + PTHR10130PEX6 Q8RY16 O48676_ARATH Esi0016_0105 2 3 10–94 1 3 10–65 + G3DSA:1.10.8.60;

G3DSA:3.40.50.300;PF00004; PS00674;PTHR23077:SF9;SM00382; SSF52540

PEX7 Q9XF57 Q9XF57_ARATH Esi0120_0004 8 3 10–41 2 G3DSA:2.130.10.10;PF00400; PR00320;PS00678; PS50082;PS50294; PTHR22850:SF4;SM00320; SSF50978

PEX14 Q9FE40 Q9FE40_ARATH Esi0063_0064 9 3 10–9 4 3 10–8 + PF04695IBR3 Q67ZU5 Q67ZU5_ARATH Esi0223_0017 1 3 10–106 + G3DSA:1.10.540.10;

G3DSA:1.20.140.10;G3DSA:2.40.110.10;PF00441; PF02770; PF02771;PTHR10909; SSF47203;SSF56645

IAA transportPIN1-7 6 components NoneMDR1 Q9ZR72 AB1B_ARATH Esi0109_0017 0 + PF00005; PF00664; PS00211;

PS50893; PS50929; SM00382;PTHR19242:SF96; SSF52540;SSF90123

MDR1 Q9LJX0 AB19B_ARATH Esi0109_0017 0

(Table continues on following page.)





Table II. (Continued from previous page.)


E. siliculosus



BIG Q9SRU2 Q9SRU2_ARATH Esi0038_0043 1 3 10238 3 310238 2 PF00569; PS01357;PS50135;PS51157; PTHR21725;SM00291

AXR4 Q9FZ33 AXR4_ARATH NoneAuxin signaling: SCFTIR1 Q8RWQ8 FBX14_ARATH Esi0053_0061 2 3 10–11 2ASK1 O65674 ASK12_ARATH Esi0046_0039 5 3 10–38 9 3 10–35 + G3DSA:3.30.710.10;

PF01466; PF03931;PIRSF028729; PTHR11165;SM00512; SSF54695;SSF81382

Cullin Q8LGH4 Q8LGH4_ARATH Esi0207_0055 0 0 + G3DSA:1.10.10.10;G3DSA:1.20.1310.10;G3DSA:4.10.1030.10;PF00888;PF10557; PS01256; PS50069;SM00182; SSF46785;SSF74788; SSF75632;PTHR11932:SF22

Cullin Q9C9L0 Q9C9L0_ARATH Esi0245_0022 0 0 + G3DSA:1.10.10.10;G3DSA:1.20.1310.10;PF00888; PF10557;PS50069; PTHR11932:SF23;SM00182; SSF46785;SSF74788; SSF75632

RBX1A Q940X7 RBX1A_ARATH Esi0079_0058 6 3 10–26 3 3 10–26 + G3DSA:3.30.40.10;PF00097; PS50089;PTHR11210:SF2;SM00184; SSF57850

RCE2 Q9ZU75 UB12L_ARATH Esi0007_0140 1 3 10–48 2 3 10–48 + G3DSA:3.10.110.10;PF00179; PS00183; PS50127;PTHR11621:SF17;SM00212; SSF54495

SGT1b Q9SUT5 Q9SUT5_ARATH Esi0014_0174 1 3 10–25 + G3DSA:1.25.40.10;G3DSA:2.60.40.790;PF04969; PF05002;PS50005; PS50293;PS51048; PS51203;PTHR22904:SF10;SM00028; SSF48452

ECR1 O65041 UBA3_ARATH Esi0069_0046 1 3 10–62 1 3 10–62 + G3DSA:3.40.50.720;PF00899; PS00865;PTHR10953:SF6; SSF69572

ULA1 P42744 ULA1_ARATH Esi0358_0003 7 3 10–34 + G3DSA:3.40.50.720;PTHR10953; SSF69572

CSN5 Q9FVU9 CSN5A_ARATH Esi0055_0013 3 3 10–47 4 3 10–47 + PF01398;PTHR10410:SF6;SM00232; SSF102712

CAND1 O64720 O64720_ARATH Esi0168_0022 0 0 + G3DSA:1.25.10.10;PF08623; PTHR12696;SSF48371

Transcription factorsAux/IAA 29 family members NoneARF9 Q9XED8 ARFI_ARATH Esi0079_0037 7 3 10–9 2ARF10 Q9SKN5 ARFJ_ARATH Esi0079_0037 2 3 10–6

ARF11 Q9ZPY6 ARFK_ARATH Esi0079_0037 1 3 10–5

ARF 20 other family members None

aIn E. siliculosus, a single gene encodes a long protein that corresponds to both TSA1 (N-terminal half) and TSB1 (C-terminal half).

Le Bail et al.




inhibition of germination (60%) was obtained with2-methoxy-3,6-dichlorobenzoic acid (dicamba; 50 mM),and the spores that did germinate showed severegrowth inhibition. Concentrations of IAA and dicamba1 and 2 orders of magnitude lower had no effect ongermination. The other auxin compounds tested alteredthe development of young sporophytes without affect-ing their growth. Application of 50 mM 1-naphthaleneacetic acid (NAA) at early stages modified both celltypes and cell positions along the filament and fila-ment polarization (Fig. 4A). While control specimenswere composed of R cells clustered in the center of thefilament and E cells in the apices, treated organismsdisplayed abnormal cell shapes. Furthermore, overalldisorganization of the filament architecture was ob-served, with the initiation of numerous branching pointsand unusual localization of E cells. Similar effects wereobserved with IBA (50 mM), but at a weaker intensity,and with 2-phenyl-acetic acid (PAA; 50 mM), whichproduced very long cells in the apices (Fig. 4A). Nomodification was observed in response to 4-chlorophe-noxyacetic acid, 2,4-dichlorophenoxyacetic acid, andthe auxin transport inhibitors 2,3,5-triiodobenzoic acid(TIBA) andN-1-naphthylphthalamic acid (NPA). There-fore, while IAA and dicamba mainly inhibited germi-nation and growth, NAA, IBA, and PAA modified thearchitecture of E. siliculosus at early developmentalstages by changing cell patterning, filament polariza-tion, and inducing numerous ectopic branches.When applied at later stages (20 d after germina-

tion), 50 mM IAA induced an increase in the rate of pros-trate branching compared with controls, and 50 mM

TIBA induced earlier and more frequent differentia-tion of upright reproductive filaments (Fig. 4B).

Because IAA seemed localized preferentially in theapical E cells, we investigated the impact of E cells oncentral R cell fate, and vice versa, in the presence andabsence of auxin. Thus, E cell extremities were ablatedand separated from the central R cells, and eachsection was grown in artificial seawater (ASW). Eand R sections were grown for 1 week with or withoutIAA or NAA (5 mM each, R sections only), and themorphology of the resulting organisms was observed1 week later. For the E sections, spontaneous differen-tiation of R cells in the center of the section wasobserved, thereby reconstituting filament organizationsimilar to controls without ablation (data not shown).In the R sections, E cells regenerated at the extremitiesof the sections (Fig. 5, control), both in the absence orpresence of exogenous auxins. Thus, both E and Rsections were able to readjust their differentiationprogram to regenerate the missing cells and reform anormally structured filament. However, the branchingpattern observed from the R sections differed depend-ing on the supply of NAA (Fig. 5). On average, 4.6lateral branches were produced on the primary fila-ments in the control medium, while 1.8 were producedin the presence of NAA, which is similar to thebranching rate of intact filaments at the same stage.Therefore, when added at the ablation time, NAAsignificantly inhibited lateral branching (x2 test, P =1.6 3 1029). IAA showed similar but weaker effects(data not shown).

In all these experiments, differences between theresponse to IAA and NAA were observed. Thesemolecules have different physicochemical properties,and their transport or diffusion in the organism isknown, at least in land plants, to require different

Figure 4. Effects of auxin compounds on the development of E. siliculosus sporophytes. Different auxin compounds wereapplied to E. siliculosus spores at germination time (A) or 20 d after germination (B). The effects on morphology were observed2 weeks later. Application of 50 mM NAA on mitospores resulted in the differentiation of cells with an abnormal shape. Growthpolarity was also affected. Application of IBA led to a similar effect, yet weaker, and PAA produced organisms with very longterminal cells and an altered branching pattern. When auxin compounds were added later during development (at 20 d aftergermination), the observed effects were different. While IAA increased the production of prostrate filaments, TIBA induced thedifferentiation of upright filaments (UF) earlier than in the control.





processes (Yamamoto and Yamamoto, 1998; Woodwardand Bartel, 2005). A lower penetration of exogenousIAA comparedwith NAA through the E. siliculosus cellwall may explain why NAA had more effects on E.siliculosus development. Moreover, the sensitivity ofcells to IAA may be higher, explaining why spores,which lack cell walls, died upon application of IAAwhile they germinated with NAA at the same concen-tration.

Morphogenetic Mutants Are Altered in the AuxinPerception and Signaling Pathway

To demonstrate the role of auxin in the develop-mental pattern of E. siliculosus sporophytes, we ana-lyzed four mutants impaired in cell differentiationgenerated by UV-B mutagenesis on mitospores. Themutant asparagus (asp) looked quite similar to the wildtype (Fig. 6A), but both its branching pattern and itscell distribution were different. Fewer secondary fila-ments were produced (Fig. 6B), and the E cell propor-tion measured between the two- and 10-cell stageswas higher than in the wild type (Fig. 6, A and C),suggesting that the E-to-R cell differentiation processhad been altered. On the other hand, the mutantsbaguette (bag), grissini1 (gri1), and gri2 developed aprostrate body very different from the wild type (Fig.6). All three mutants displayed altered growth polar-ity, with cells dividing in several axes, especially ingri1, where the body looked like a callus (Fig. 6A). TheE cell identity was lost in gri1 and gri2 (both 0% E cells)and was strongly reduced in bag (24% E cells; Fig. 6, Aand C). Their developmental program was character-ized by an extremely early emergence of uprightfilaments in the bag and gri1 mutants and by a highabundance of secondary prostrate filaments in gri2(Fig. 6B).

To investigate whether these morphological altera-tions were related to auxin metabolism, these mutants

were treated with 50 mM IAA, NAA, and TIBA. Mod-ifications of the developmental pattern were observedin gri1 and gri2 mutants only. While in gri1, NAA and,to a lesser extent, IAA reduced the emergence ofupright filaments, in gri2, less and longer secondaryprostrate filaments grew (Fig. 7). TIBA slightly in-creased the differentiation of sporangia in gri1, while ithad no noticeable effects in gri2. Therefore, gri1 andgri2 were able to respond to auxin, in contrast to aspand bag, which were insensitive to it.

Quantifying the amount of auxin in these mutantswould be helpful to better decipher the link betweenthe phenotype and auxin metabolism. However, be-cause gri1 and gri2 grew slowly, the amount of bio-logical material was too small to quantify IAA in them.Therefore, we searched for auxin-inducible genes,which could be used as auxin-reported genes. A small-scale microarray experiment was performed withRNAs extracted from tissues treated with 50 mM

NAA for 30 min or 3 h. Out of 24 ESTs initiallyselected from the microarray data as being either up-regulated or down-regulated by the NAA treatment,the overexpression of only one, named EsGRP1, wasconfirmed by quantitative real-time PCR.

PCR amplification of 3 kb upstream of the EsGRP1EST (located in the 3# untranslated region) led to theidentification of an open reading frame. In the de-duced protein sequence, two main domains sharedsimilarity with extensin and Gly-rich proteins (Fig. 8).The central part of the protein sequence contained aseries of 8.5 adjacent repeats of 32 amino acidssharing similarity with extensin from Zea diploperennis(UniProt-KB accession no. Q41719; lalign local align-ment, E = 1.5 3 10234). In the C-terminal part of thesequence, 10 repeated Gly-rich sequences were clus-tered, separated by several hydrophilic sequences ofeight to 19 amino acids. In land plants, extensins areHyp-rich proteins present in the extracellular matrix,where they are thought to play a role in plant cell wall

Figure 5. Impact of NAA on branching. Pieces offilaments containing only R cells were isolated andgrown in the presence or absence of 5 mM NAA(right). The developmental pattern of the filamentswas observed 1 week after ablation, and the numberof secondary filaments was counted (see text) andcompared with the number obtained from intactfilaments (left).

Le Bail et al.




stiffness (Kieliszewski and Lamport, 1994), and Gly-rich proteins are secreted proteins involved in adhe-sion and extension of differentiating vascular cells(Ringli et al., 2001).A kinetics study in response to NAA showed that

the transcript level of EsGRP1 was more than four

times higher than the control 30 min after the additionof NAA, and it slowly decreased to its basal level after24 h (Fig. 9A). In the mutant asp, the EsGRP1 transcriptlevel was higher than in the wild type, while levels inbag, gri1, and gri2 mutants were significantly reduced(Fig. 9B).

Figure 6. Morphology of the morphogenesis mutants. Phenotypes of the four mutants asp, bag, gri1, and gri2 compared with thewild type (WT). The phenotypes are shown 5 (A) and 15 (B) d after germination. UF, Upright filaments. Bars = 15 mm in A and50 mm in B. C, Proportion of R cells. Both R cells and E cells were counted in 36 sporophytes from the two- to the 10-cell stage,and the ratio of the total number of each cell type was calculated (no. of cells . 200).

Figure 7. Response of E. siliculosusmorphogenesis gri1 and gri2mutants to auxin compounds. Fifty micromolar IAA, NAA, andTIBA were applied to gri1 and gri2 cultures. The morphology was observed 14 d later and compared with the control cultures(1024

M NaOH for IAA and NAA and 0.1% dimethyl sulfoxide [DMSO] for TIBA). In gri1, upright branching was reduced uponapplication of IAA and inhibited in response to NAA. In response to TIBA, no significant change in morphology was observed. Ingri2, IAA and NAA reduced the number of short secondary filaments and induced the growth of longer filaments. Bars = 50 mm.





A summary of the data obtained with the mutants ispresented in Figure 10.

DISCUSSION

Role of Auxin in E. siliculosus Development

Some studies have already investigated the role ofauxin in brown alga development. At the embryostages, exogenous application of IAA has been shownto reduce cell polarization in Fucus vesiculosus (orderFucales) and to induce numerous ectopic rhizoid dif-ferentiations when grown in the dark (Basu et al.,2002). In this study, exogenous NAA also induced bodypolarity impairment and numerous ectopic brancheswhen applied at the germination stage in E. siliculosus.Therefore, in both algal models, exogenous auxinapplied before the division of the initial cell triggersgeneral disorganization of the growing thallus.

In our experiments, when auxin was applied laterduring the development of E. siliculosus, differentdevelopmental responses were observed. Becausecells acquire either an E or an R identity immediatelyafter the first division, we investigated the effects ofauxin on these differentiated cells. Our approach ofisolating R or E sections from the rest of the primaryfilament helped better understand how cell fate isdictated and how auxin may regulate morphogeneticpatterns in early developmental stages. In normal

growth medium, ablated R cell fragments were ableto reconstitute the initial filament with the correctdevelopmental pattern. More specifically, in responseto ablation, the resulting apical R cell reinitiated celldivision toward both extremities of the filament whilemaintaining initial growth polarity. In addition, thedaughter cells acquired the E cell identity. Interest-ingly, in intact filaments, R cells divide very rarely atthis stage, and the differentiation of R to E cells isnever observed (Billoud et al., 2008; Le Bail et al.,2008a). Therefore, this indicates that following abla-tion, R cells modify their identity and behavior tofollow the intrinsic developmental program. In thebrown alga Pelvetia compressa (order Fucales), ablationexperiments at the two-cell embryo stage showed thatcell lineage is already established at this stage (Kropfet al., 1993). However, the identity of the cell seems todepend on molecular determinants present in its cellwall, because additional experiments performed onthe brown alga Fucus spiralis show that remnants ofcell wall from the ablated cell dictate cell fate to thenew cell growing in contact with it (Berger et al., 1994).In E. siliculosus, R cell fragments were cut from withina larger R zone, thereby precluding contact withremnant cell walls from excised E cells. Therefore,cell fate in E. siliculosus is completely independent ofthe presence of E cell determinants, contrary to whathas been observed in the Fucales. These differences inthe mechanisms and determinants of cell fate may be

Figure 8. Structure of the EsGRP1 protein. Four functional domains are identified in the peptide sequence of EsGRP1 predictedfrom the genome sequence. The signal peptide (amino acids 1–27) can be used to address the protein to the membrane. Theextensin-like domain (amino acids 115–384) is made of 8.5 repeats (shown as boxes a–i) of a 32-amino acid module. Every threemodules, the sequence contains an RGDmotif (marked as vertical lines). The complete sequence of the repeats is shown below,with the RGD motif shaded. The alignment of the first module with one of the eight repeats of the Pro-rich extensin motif ofZ. diploperennis (Q41719) shows a partial sequence similarity. The TNFR region (amino acids 406–444) matches with Prositepattern PS00652, which is found in tumor necrosis factors and nerve growth factors. However, in tumor necrosis factor and nervegrowth factor proteins, this pattern is present in three or four copies, usually located in the N-terminal part of the protein, which isnot the case in EsGRP1. The Gly-rich region (amino acids 477–860, with the Gly residues marked as vertical lines) is made of 10approximate repeats (boxes a–j). The complete sequence of this region is shown below the map, with the Gly residues shaded.Each repeat can be divided into two parts: the first eight to 19 amino acid residues correspond to a complex pattern, which canappear in more or less complete forms; the remaining 17 to 27 amino acid residues are mainly Gly.

Le Bail et al.




related to differences in body architecture between thespecies, as both Fucus and Pelvetia develop three-dimensionally growing thalli while Ectocarpus is com-posed of uniseriate filaments. This determinationprocess was independent of the addition of exogenousauxin and may rely on local positional information assuggested by Billoud et al. (2008; Fig. 11).In contrast, auxin seems to negatively control the

progression in the developmental program. At theearly prostrate stage, ablated R cell fragments inducedthe growth of more branches than in intact filaments.Addition of NAA to these fragments resulted in re-duced branching, suggesting that auxin inhibitsbranching in the intact filament. In situ immunolocal-ization experiments showed that actively proliferatingapices of the filaments did have higher concentrationsof IAA. Similar results have been obtained in filamentsof the bryophyte Physcomitrella patens, where the ex-pression of GH3::GUS and DR5::GUS transgenes indi-cates higher concentrations of auxin in the young,actively growing cells of the protonemal filaments(Bierfreund et al., 2003), similarly located at the apices(Cove et al., 2006). Therefore, a possible scenario inagreement with the data from the ablation experimentis that, in an intact filament, there is an IAA gradientthat reaches its maximum at both extremities of the

filament, where E cells are located. As the organismgrows, central cells move farther from the IAA source,progressively differentiate into R cells in response tothe decrease in IAA concentration, and ultimatelyinitiate branching. Hence, only the apical positionand a high IAA content in E cells would result in thedevelopmental pattern observed in culture, as pro-posed in the model in Figure 11. The analysis ofmutants provides support for this scenario, wherethe higher the percentage of E cells, the higher theEsGRP1 transcript levels are and the lower the rate ofemergence of prostrate filaments is. This is well illus-trated in the mutant asp, which contains 83% of E cells,overexpresses EsGRP1, and displays a lower branch-ing rate, contrary to gri2, which has an extremely highnumber of secondary axes borne on a callus bodymade of only R cells expressing a very low level ofEsGRP1 transcripts (Fig. 10). In response to auxin, gri2decreases its rate of branching, providing evidencethat auxin negatively controls hyperbranching of pros-trate filaments. The asp mutant was insensitive to theauxin treatment, possibly due to overinduction of itsauxin signaling pathway (potentially due to an over-accumulation of IAA), which is concordant with theoverexpression of EsGRP1.

At mature vegetative stages (approximately 20–40 dafter germination), addition of exogenous auxin onwild-type cultures triggered an increase in the emer-gence of prostrate filaments, while addition of TIBAincreased the emergence of upright filaments. This isan indication that auxin may negatively control thetransition from the branching of prostrate filaments tothe branching of upright filaments and that this effectrelies on auxin transport within the prostrate body(Fig. 11). Again, the observation of mutants supportsthis hypothesis. The two mutants bag and gri1 dis-

Figure 10. Summary of the phenotypic characterization of the mutantsasp, bag, gri1, and gri2. The mutant phenotypes are summarized interms of the proportion of E cells, branching features, response to auxin,and EsGRP1 transcript levels. For the branching features, note that itdescribes both prostrate filaments (gray) and upright filaments (white).R cells are shown as black ovals. WT, Wild type.

Figure 9. Transcript levels of EsGRP1. The levels of transcripts ofEsGRP1 were quantified by real-time reverse transcription-PCR onthree independent biological replicates. Each transcript level wasnormalized to EsEF1a transcripts, as recommended by Le Bail et al.(2008b), and averaged (SD indicated). Asterisks indicate P, 0.05 with at test. A, In response to NAA. Mature sporophytes were incubated for24 h in 50 mM NAA, and tissues were collected at different times. Afteraveraging, the transcript levels were normalized to the T0 value. B, Inmorphological mutants. WT, Wild type.





played a pronounced reduction in the vegetativephase, since upright filaments and sporangia differ-entiate as soon as the prostrate body is composed of afew cells (10 d old). Most or all of the cells of prostratebodies are of the R type, which again was correlatedwith a reduction in EsGRP1 transcript levels. While bagwas insensitive to auxin treatment, gri1 responded bydecreasing the number of upright filaments, somehowreverting the effect of the mutation by slowing downthe emergence of upright filaments (Fig. 11). Theabsence or the weak effect of TIBA on the developmentof these mutants may be due to the fact that they werestill in an early growth stage, despite their advancedmorphological features.

Altogether, these results support a role of auxin as aninhibitor of the progression of the developmentalprograms in E. siliculosus, as illustrated in our modelin Figure 11. Interestingly, in the brown alga Laminariajaponica, which is phylogenetically closely related tothe Ectocarpales (Phillips et al., 2008), auxin levels arelower in the reproductive tissues than in the vegetativetissues, and the formation of sori is delayed in responseto 50 mM IAA (Kai et al., 2006). This illustrates that thedevelopmental role of auxin observed in E. siliculosusmay be common to other complex brown algae.

Synthesis and Transport of Auxin in E. siliculosus

The model illustrated in Figure 11 is based on a highconcentration of IAA in the apical E cells and on adiffusion of IAA along the primary filament in earlydevelopmental stages relayed by active transport to-ward the more distant tissues in later stages.

The synthesis of auxin by brown algae is an old andcontroversial issue. Despite the fact that several phy-

tohormones have been shown to be present in brownalgae (for review, see Tarakhovskaya et al., 2007),studies on nonaxenic cultures raised the concern thatauxin detected in algal extracts was of bacterial origin(Bradley, 1991). Here, using a combination of liquidchromatography, gas chromatography, and mass spec-trometry on axenic cultures, we showed that IAAwaspresent in low, but significant, amounts in E. siliculosussporophytes. IPA and ICA, likely to be decarboxylateddegradation products of IAA (Ljung et al., 2002), werealso detected. The levels of IAA quantified in E.siliculosus were similar to those found in the brownalga F. vesiculosus (Basu et al., 2002). No auxin-associatedcompound was detected other than these three. Theyare either absent from E. siliculosus cells or onlytransiently accumulated, in which case they willprobably remain elusive until an IAA biosynthesismutant is identified. The identification of homologs ofIAA biosynthesis enzymes suggests that other auxin-associated compounds are transiently present. Ac-cordingly, we identified sequences in the E. siliculosusgenome with similarities to several enzymes of theTAM and IAOx Trp-dependent IAA biosynthesispathway.

Unlike Arabidopsis, which maintains about 99% ofits IAA in conjugated forms (Woodward and Bartel,2005), no IAA conjugate was detected in E. siliculosussporophytes. This is in agreement with previous stud-ies that have shown that brown algae do not store IAAcompounds as amino acid or sugar conjugates (Basuet al., 2002). Likewise, no significant conservation ofthe conjugation enzymes (IAA glucosyltransferases,IAA aminotransferases, etc.) was detected in the ge-nome. However, significant conservation of homologsof IBA-metabolic genes was observed, which may

Figure 11. Model for the role of auxin in the devel-opment of the E. siliculosus sporophyte. Cells posi-tioned at the apices of the filament acquire theE identity. A higher concentration of auxin is presentin these cells, which prevents them from differenti-ating into R cells and/or inducing branching. As thefilament grows, subapical E cells get localized fartherfrom the apex and perceive lower auxin concentra-tions, which progressively induce their differentiationinto R cells as well as branching. Later, auxin main-tains its control on the progression of the life cycle bynegatively controlling the emergence of the uprightfilament and thereby the shift to the reproductivephase. Auxin control would then depend on activetransport, allowing the apices to maintain control ondistant tissues.

Le Bail et al.




account for the conversion of IAA into IBA for storagein peroxisomes. However, these enzymes may not bespecific to IBA transport and b-oxidation (Woodwardand Bartel, 2005), as confirmed by the absence of adetectable level of IBA in E. siliculosus.In summary, the E. siliculosus genome contains ho-

mologs of most genes involved in the Trp-dependentIAA biosynthesis TAM and IAOx pathways, suggest-ing that E. siliculosus synthesizes its own IAA. Ourchemical data and genome analysis do not lend sup-port to the hypothesis that IAA conjugates are syn-thesized and stored. Conversely, the detection of ICAand IPA supports an alternative hypothesis that hasbeen proposed for photosynthetic organisms withsimple architecture (Cooke et al., 2002), whereby IAAhomeostasis is ensured by the regulation of IAAbiosynthesis/degradation processes.Tissue patterning in response to an IAA gradient

raises the puzzling issue of how the gradient isestablished. Our survey of the E. siliculosus genomedoes not support the conservation of land plant IAAinflux (AUX1) and efflux (PIN) proteins, which mayparticipate in polarized transport. However, certainsimilarities with Arabidopsis remain. E. siliculosuspossesses a putative homolog of BIG, a calossin-likefamily protein involved in the auxin control on PINendocytosis (Paciorek et al., 2005). In addition, E.siliculosus has several ABCB efflux IAA transporters,which participate in the polarized transport of IAAand stabilize PIN1 (Friml, 2009; Titapiwatanakun et al.,2009). In E. siliculosus, the auxin transport inhibitorTIBA affected the late developmental stages. Similarly,in Fucus distichus, both TIBA and NPAwere shown toalter the developmental pattern of the embryo byinducing branched rhizoids (Basu et al., 2002). How-ever, the inhibitory effect of NPA and TIBAmay not bestrictly specific to PIN proteins, as these molecules actmore generally on actin cytoskeleton dynamics, towhich vesicle-mediated PIN recycling is particularlysensitive (Dhonukshe et al., 2008). Therefore, the sim-ple architecture of E. siliculosus may be attributable tobasic IAA diffusion from the apical IAA-synthesizingcells. The physicochemical characteristics of IAA arecompatible with this type of diffusion process (Cookeet al., 2002), and in F. distichus, molecules as large as10 kD are able to move through the embryonic cells inboth directions along the polar axis (Bouget et al.,1998), providing evidence for symplastic transport inbrown algae. Interestingly, E. siliculosus cells possess

plasmodesmata (Charrier et al., 2008), which mayallow auxin to freely diffuse from cell to cell. Alterna-tively, another, yet-to-be-identified type of IAA effluxtransporter that has no sequence conservation withPIN proteins may have evolved in brown algae.

Whatever the mode of transport of IAA through thefilament, our data show that E. siliculosus responds toit, both in terms of morphology and gene expression.However, the signaling mechanism does not appear tobe similar to the mechanism known in land plants(Parry and Estelle, 2006; Kepinski, 2007). The ubiqui-tous proteins of the SCF complex are well conserved,but we could not identify any specific component ofthe auxin-responsive machinery in E. siliculosus. Inparticular, we did not find any transcriptional inhib-itor similar to AUX/IAA. Their specific targetingfactor, namely a protein similar to the F-box partnerTIR1 (or AFB), is also lacking. Therefore, the control ofgene expression in response to IAA in E. siliculosusmust differ from what is known in land plants. Themechanism alone may be conserved, relying on dif-ferent transcriptional inhibitors that would be recog-nized by an IAA-protein complex able to address themto degradation. It is possible that the primary sequenceand/or three-dimensional structure of the transcrip-tion and targeting factors differ extensively fromknown proteins, as long as the key features of theauxin-regulating model are conserved. In particular, itwould be expected that both the transcription factorand the targeting factor differ from their counterpartsin land plants and coevolve so as to maintain theirinteraction. Alternatively, the mechanism of gene ac-tivation by auxin may be unique to a given set ofspecies, along with a specific pathway and machinery.This could be the case for the whole Heterokontophytaphylum, as genomic studies performed on unicellularheterokonts, namely two diatoms (Armbrust et al.,2004; Bowler et al., 2008), show that there is no con-servation of IAA signaling genes known in landplants. This suggests that an alternative signalingpathway exists in these microalgae (Lau et al., 2009).However, the two possible auxin-signaling pathwaysproposed for these species involve the proteins ABP1and IBR5, for which there is no close relative in E.siliculosus.

In conclusion, previous studies on E. siliculosusmorphogenesis showed that very local positional in-formation, corresponding to cell-cell recognition,could be a reliable mechanism that would account

Table III. Oligonucleotides used for the quantification of transcripts by real-time reverse transcription-PCR

Oligonucleotides (Eurogentec, purification Selective Precipitation Optimized Process) were designed using the software Primer Express 1.0 (PEApplied Biosystems). Sequence is indicated from 5# to 3#. NA, Not applicable.

GenesGenome

Identifier

GenBank Accession

No. (EST)5# End 3# End

EsGRP1 Esi0109_0088 FP280356 TAGTGCTTTGCTATGGATATGCTCAAC TACAACAGGAGTAGGGATACAGATCEsEF1a Esi0387_0021 FP297312 GCAAGGGCCTCAGCTCTG ACAAGCCGTCTGGGTATATGTTAGCIntron Esi0092_0006 NA TCATTTTTCATGTGGAGGTCTCTG GCCAAACAAACAACAACCCTC





for most of the developmental patterns of the earlyfilament (Billoud et al., 2008). However, this modelrequired an additional mechanism to completely ex-plain morphogenesis. Results presented in this studyprovide support for auxin-mediated, long-range con-trol of the developmental patterning in the brown algaE. siliculosus. This developmental patterning is basedon the same cellular responses as in land plants: cellproliferative competence relative to the highest con-centrations of auxin and negative branching controlpreventing progression in the life cycle. In addition,we showed that the genome of this alga containselements that are similar to the IAA biosyntheticmachinery operating in land plants. The presence ofIAA in brown algae, coupled with the lack of conser-vation of IAA transport and signaling pathways in E.siliculosus, sketches the outline of an evolutionaryscenario of IAA as a signaling molecule over themore than 1 billion years that separate the green plantand the heterokont lineages. The study of a recentlyidentified NAA-hypersensitive mutant in E. siliculosuswill help develop the scenario further.

MATERIALS AND METHODS

Culture of Ectocarpus siliculosus

The experiments were carried out using a unialgal laboratory culture of

haploid E. siliculosus parthenosporophyte isolate Ec 32 (Culture Collection of

Algae and Protozoa accession no. 1310/4; origin, San Juan de Marcona, Peru),

which was produced by germination of unfertilized gametes (Le Bail et al.,

2008a). Thalli were grown in 100-mL petri dishes or 10-L containers in

autoclaved ASW (450 mM NaCl, 10 mM KCl, 9 mM CaCl2, 30 mM MgCl2, and 16

mM MgSO4 at pH 7.8) enriched with Provasoli medium (ASWp; Starr and

Zeikus, 1993) in a controlled-environment cabinet at 13�C with a 14:10-h light:

dark cycle (light intensity of 29 mmol photons m22 s21).

Because some of the studied mutants display abnormal sporangia and no

gametophytic state, controlled production of unfertilized gametes or spores

was not possible. Therefore, young organisms (approximately 10 cells) were

obtained by filtrating a mass culture containing individuals at different

developmental stages.

For the ablation experiments, early filaments were cut with a needle into

pieces containing either E cells only or R cells only. Corresponding fragments

were grown in separate petri dishes in ASW. NAA (5 3 1026M) was added to

half of the petri dishes of each cell type. Filament development was observed

1 week after ablation. The number of branches was counted, and statistical

analyses were performed using Student’s t test. n = 32 for ASWand n = 23 for

ASW + NAA 5 3 1026M.

Application of Auxin Compounds onE. siliculosus Tissues

All the phytohormones were purchased from Duchefa Biochemie. NAA

(N0903), IAA (I0901), IBA (I0902), 2,4-dichlorophenoxyacetic acid (D0910),

and dicamba (D0920) were dissolved in 1 N NaOH at an initial concentration

of 0.5 M and then successively diluted in ASW to 5 mM, 500 mM, and 50 mM.

4-Chlorophenoxyacetic acid (C0909) and PAA (P0913) were dissolved in

ethanol at the same concentrations. TIBA and NPA were dissolved in 0.1%

dimethyl sulfoxide. All the auxin compounds, as well as the auxin transport

inhibitors, were used at final concentrations of 50, 5, and 0.5 mM. Final solvent

concentrations (e.g. 1024, 1025, and 1026N, respectively, for NaOH) were used

as controls. Only concentrations having an effect on E. siliculosus development

are discussed in the text.

For the microarray experiment, RNA was extracted from a sporophyte

culture grown in natural seawater for several weeks. Cultures were then

subdivided into equal amounts and transferred into petri dishes containing

ASWp with shaking. After 48 h of acclimation, the medium was replaced by

either fresh ASWp + NaOH 1024N (control) or ASWp + NAA 50 mM, grown

with gentle shaking, and collected after 30 min or 3 h. For the expression

kinetics, cultures were prepared as for the microarray experiments, but

samples were collected after 30 min or 1, 6, 12, and 24 h.

Generation and Observation of Mutants

Mutants were produced following 20 min of UV-B irradiation of E.

siliculosus EC 32 unfertilized gametes. Individuals displaying morphogenetic

alterations were screened with a binocular microscope. The stability of the

selected phenotype was checked for at least five parthenogenetic generations.

Detailed fine-scale observations were performed on an Olympus IX 51

inverted microscope.

Auxin Detection and Quantification

Axenic algal material (50–200 mg) corresponding to mature organisms was

mixed with 1 mL of 50 mM sodium phosphate buffer, pH 7, containing 1 ng

mL21 [indole-13C6]IAA (internal standard), homogenized in Retsch mixer mill,

and extracted for 1 h at 4�C. Samples were then centrifuged, and the resulting

supernatants were transferred to clean tubes and acidified to pH 2.7 with 1 M

hydrochloric acid. Solid-phase extraction was performed using 50-mg Bond-

Elut C18 columns (Varian). After application of the samples, columns were

washed with 1 mL of 1% (v/v) formic acid and dried. Compounds of interest

were eluted using 1 mL of acetonitrile containing 0.2% (v/v) formic acid.

Following the solid-phase extraction, samples were vacuum dried, dis-

solved in 1mL of methanol:acetonemixture (1:9), and reactedwith 10 mL of 2 M

trimethylsilyl-diazomethane in hexane for 1 h. The excess of derivatization

reagent was quenched with 10 mL of 2 M acetic acid in n-heptane, and samples

were dried in a stream of nitrogen.

For liquid chromatography, samples were reconstituted in 10 mL of 20%

methanol. Chromatography was performed on a 10- 3 1-mm Thermo

BetaMax precolumn (Thermo Electron) connected to a 50- 3 1-mm Waters

Symmetry Shield C-18 analytical column (Waters). A linear gradient of 20% to

90% methanol containing 0.2% (v/v) formic acid over 20 min at 35 mL min21

flow rate was employed to separate analytes of interest, followed by 5 min of

washing with 100% methanol and a 5-min 20% methanol/0.2% formic acid

equilibration period for each injection. The Waters Quattro Ultima mass

spectrometer was operated in Multiple Reaction Monitoring mode with

electrospray ion source block and desolvation temperatures kept at, corre-

spondingly, 100�C and 290�C. Acquired data were processed using Waters

MassLynx software.

For gas chromatography, samples were dissolved in 25 mL of acetonitrile

and derivatized with 5 mL of N,O-bis(trimethylsilyl)trifluoroacetamide/1%

trimethylchlorosilane at 75�C for 30 min. Separation of the compounds of

interest was achieved using an 80�C to 280�C linear temperature gradient on a

30-m 3 0.25-mm Varian CP-Sil8 CB column, effluent of which was analyzed

by the JEOL JMS-700 magnetic sector mass spectrometer operating inMultiple

Reaction Monitoring mode. The electron-impact ion source and the inlet pipe

were kept at 260�C, and an ionization energy of 70 eV was used. Data were

processed using JEOL XMass software.

In order to release IAA from conjugated forms, samples were treated

beforehand with 7 N NaOH for 24 h.

IAA Immunocytochemical Localization

The protocol was adapted from Avsian-Kretchmer et al. (2002) with

different fixation methods. Sporophytes were grown on coverslips from

germination to the required stage. They were prefixed in 2% (w/v) aqueous

solution of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (Sigma-Aldrich)

and postfixed in a fresh fixation buffer (47.5% ethanol, 5% acetic acid, and 10%

formaldehyde) during 30 min at room temperature. The fixation buffer was

changed. Tissues were then placed for 5 min in a phosphate-buffered saline

solution (PBS; 2.7 mM KCl, 6.1 mM Na2HPO4, and 3.5 mM KH2PO4, pH 7),

incubated for 45 min in a blocking solution (0.1% [v/v] Tween 20, 1.5% [w/v]

Gly, and 5% [w/v] bovine serum albumin [BSA]), and rinsed in a regular salt

rinse solution (0.1% [v/v] Tween 20, 0.8% [w/v] BSA, and 0.88% [w/v] NaCl)

for 5 min. They were briefly washed in PBS with 0.8% (w/v) BSA. One

hundred microliters of 1:100 (w/v) monoclonal anti-IAA antibody (1 mg

mL21; A0855; Sigma) or monoclonal anti-a-tubulin antibody (1 mg mL21;

T6199; Sigma) was placed on each coverslip and incubated overnight at 4�C.

Le Bail et al.




Three 10-min vigorous washes with high-salt rinse solution (2.9% [w/v] NaCl,

0.1% [v/v] Tween 20, and 0.1% [w/v] BSA) were followed by a 10-min wash

with a regular salt rinse and a brief rinse with 0.8% (v/v) BSA and a rinse in

PBS. One hundred microliters of a 1:100 (v/v) dilution of the 1 mg mL21 anti-

mouse IgG-alkaline phosphatase conjugate (A4312; Sigma) was added to each

slide and incubated for 4 h at room temperature. Five 10-min washes in a

regular salt rinse solution were followed by a brief wash in PBS. Coverslips

were placed in detection buffer (100 mM Tris, pH 9.5, 100 mM NaCl, and 50 mM

MgCl2) during 5 min and then in detection buffer with 350 mL of nitroblue

tetrazolium and 150 mL of 5-bromo-4-chloro-3-indolyl phosphate for 50 mL of

buffer. The reaction was stopped in 10 mM Tris, pH 7.5, and 5 mM EDTA.

Coverslips were then mounted on a slide in Gel-mount (Biomeda) for

microscopic observations.

Microarray

Microarrays were composed of 1,152 PCR products, corresponding to

sporophytic and gametophytic tissues, and are fully described by Peters et al.

(2008). Targets were prepared from RNA extracted from 200 mg of ground

sporophytic material and treated with NAA (see culture conditions), and

RNAwas extracted with an extraction buffer (100 mM Tris-HCl, pH 7.5, 1.5 M

NaCl, 2% cetyl-trimethyl-ammonium bromide, 50 mM EDTA, and 50 mM

dithiothreitol) for 1 h with shaking and then with 1 volume of chloroform:

isoamyl alcohol (24:1). Polysaccharides were precipitated in the aqueous

phase with one-fourth volume of 100% ethanol and then extracted with

1 volume of chloroform:isoamyl alcohol. RNAs were precipitated for 2 h with

2.4 M lithium chloride and 1% b-mercaptoethanol and then with a phenol-

chloroform extraction and alcohol precipitation. Microarray hybridizations

were performed as described by Peters et al. (2008). The data are available at

the Array Express at EMBL-EBI with accession number E-MEXP-1716.

Transcript-Level Quantification by Real-Time PCR

Biological triplicates were prepared from each type of material. Oligonu-

cleotides and RNAs were prepared as described by Peters et al. (2008). The list

of oligonucleotides used is presented in Table III. In addition to DNase-I

treatment, remnants of genomic DNA contaminant were quantified by am-

plification of an intron and subtracted from the other values. EsEF1a was

chosen as a constitutively expressed gene based on the study by Le Bail et al.

(2008b) and used for transcript-level normalization. The normalized data were

expressed as means 6 SD calculated from the three independent biological

experiments.

Sequence Analyses

Sequences of Arabidopsis (Arabidopsis thaliana) proteins involved in the

different auxin processes were retrieved from the UniProt database release

15.8 (UniProt Consortium, 2009). Their most similar relatives were searched

for within the complete proteome of E. siliculosus (Ectocarpus Genome

Consortium, unpublished data) using BLASTP version 2.2.18 (Altschul

et al., 1997) with a cutoff E value set at 1 3 1025. In order to check for a

BBH, the best hit in E. siliculosus for a given Arabidopsis sequence was used as

a query in a BLASTP search within the whole genome of Arabidopsis. A BBH

was recorded when the best hit for this second search was the starting

Arabidopsis protein. The expression of E. siliculosus proteins was assessed

by the existence of a corresponding EST in the EST databank (Dittami et al.,

2009). Functional domains were identified using the InterProScan software

(Zdobnov and Apweiler, 2001).

Supplemental Data

The following materials are available in the online version of this article.

Supplemental Table S1. Sequence conservation between Arabidopsis and

E. siliculosus.

ACKNOWLEDGMENTS

We are grateful to C. Maisonneuve and L. Dartevelle for maintaining the

E. siliculosus cultures.

Received October 20, 2009; accepted February 17, 2010; published March 3,

2010.

LITERATURE CITED

AbadMJ, Bedoya LM, Bermejo P (2008) Natural marine anti-inflammatory

products. Mini Rev Med Chem 8: 740–754

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W,

Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of

protein database search programs. Nucleic Acids Res 25: 3389–3402

Armbrust EV, Berges JA, Bowler C, Green BR, Martinez D, Putnam NH,

Zhou S, Allen AE, Apt KE, Bechner M, et al (2004) The genome of the

diatom Thalassiosira pseudonana: ecology, evolution, and metabolism.

Science 306: 79–86

Avsian-Kretchmer O, Cheng J, Chen L, Moctezuma E, Sung ZR (2002)

Indole acetic acid distribution coincides with vascular differentiation

pattern during Arabidopsis leaf ontogeny. Plant Physiol 130: 199–209

Baldauf SL (2008) An overview of the phylogeny and diversity of eukary-

otes. J Syst Evol 46: 263–273

Basu S, Sun H, Brian L, Quatrano RL, Muday GK (2002) Early embryo

development in Fucus distichus is auxin sensitive. Plant Physiol 130: 292–302

Berger F, Taylor A, Brownlee C (1994) Cell fate determination by the cell

wall in early Fucus. Dev Sci 263: 1421–1423

Bierfreund NM, Reski R, Decker EL (2003) Use of an inducible reporter

gene system for the analysis of auxin distribution in the moss Phys-

comitrella patens. Plant Cell Rep 21: 1143–1152

Billoud B, Le Bail A, Charrier B (2008) A stochastic 1D nearest-neighbor

automaton models early development of the brown alga Ectocarpus

siliculosus. Funct Plant Biol 35: 1014–1024

Bouget FY, Berger F, Brownlee C (1998) Positional dependent control of cell

fate in the Fucus embryo: role of intercellular communication. Devel-

opment 125: 1999–2008

Bowler C, Allen AE, Badger JH, Grimwood J, Jabbari K, Kuo A,

Maheswari U, Martens C, Maumus F, Otillar RP, et al (2008) The

Phaeodactylum genome reveals the evolutionary history of diatom ge-

nomes. Nature 456: 239–244

Bradley PM (1991) Plant hormones do have a role in controlling growth

and development of algae. J Phycol 27: 317–321

Charrier B, Coelho SM, Le Bail A, Tonon T, Michel G, Potin P, Kloareg B,

Boyen C, Peters AF, Cock JM (2008) Development and physiology of the

brown alga Ectocarpus siliculosus: two centuries of research. New Phytol

177: 319–332

Cooke TJ, Poli D, Sztein AE, Cohen JD (2002) Evolutionary patterns in

auxin action. Plant Mol Biol 49: 319–338

Cove D (2000) The moss Physcomitrella patens. J Plant Growth Regul 19:

275–283

Cove D, Bezanilla M, Harries P, Quatrano R (2006) Mosses as model

systems for the study of metabolism and development. Annu Rev Plant

Biol 57: 497–520

Dhonukshe P, Grigoriev I, Fischer R, Tominaga M, Robinson DG, Hasek

J, Paciorek T, Petrasek J, Seifertova D, Tejos R, et al (2008) Auxin

transport inhibitors impair vesicle motility and actin cytoskeleton dy-

namics in diverse eukaryotes. Proc Natl Acad Sci USA 105: 4489–4494

Dittami SM, Scornet D, Petit J, Segurens B, Da Silva C, Corre E, Dondrup

M, Glatting K, Konig R, Sterck L, et al (2009) Global expression

analysis of the brown alga Ectocarpus siliculosus (Phaeophyceae) reveals

large-scale reprogramming of the transcriptome in response to abiotic

stress. Genome Biol 10: R66

Friml J (2009) Subcellular trafficking of PIN auxin efflux carriers in auxin

transport. Eur J Cell Biol 89: 231–235

Holtkamp AD, Kelly S, Ulber R, Lang S (2009) Fucoidans and fucoidanases:

focus on techniques for molecular structure elucidation and modification

of marine polysaccharides. Appl Microbiol Biotechnol 82: 1–11

Kai T, Nimura K, Yasui H, Mizuta H (2006) Regulation of sorus formation

by auxin in Laminariales sporophyte. J Appl Phycol 18: 95–101

Katsaros C, Karyophyllis D, Galatis B (2006) Cytoskeleton and morpho-

genesis in brown algae. Ann Bot (Lond) 97: 679–693

Kepinski S (2007) The anatomy of auxin perception. Bioessays 29: 953–956

Kieliszewski MJ, Lamport DT (1994) Extensin: repetitive motifs, func-

tional sites, post-translational codes, and phylogeny. Plant J 5: 157–172

Klarzynski O, Plesse B, Joubert JM, Yvin JC, Kopp M, Kloareg B, Fritig B

(2000) Linear beta-1,3 glucans are elicitors of defense responses in

tobacco. Plant Physiol 124: 1027–1037

Kloareg B, Quatrano RS (1988) Structure of the cell-walls of marine algae

and ecophysiological functions of the matrix polysaccharides. Oceanogr

Mar Biol 26: 259–315





Kropf DL (1992) Establishment and expression of cellular polarity in fucoid

zygotes. Microbiol Rev 56: 316–339

Kropf DL (1997) Induction of polarity in fucoid zygotes. Plant Cell 9:

1011–1020

Kropf DL, Coffman HR, Kloareg B, Glenn P, Allen VW (1993) Cell-wall

and rhizoid polarity in Pelvetia embryo. Dev Biol 160: 303–314

Lau S, Jurgens G, De Smet I (2008) The evolving complexity of the auxin

pathway. Plant Cell 20: 1738–1746

Lau S, Shao N, Bock R, Jurgens G, De Smet I (2009) Auxin signaling in

algal lineages: fact or myth? Trends Plant Sci 14: 182–188

Le Bail A, Billoud B, Maisonneuve C, Peters AF, Mark Cock J, Charrier B

(2008a) Early development of the brown alga Ectocarpus siliculosus

(Ectocarpales, Phaeophyceae) sporophyte. J Phycol 44: 1269–1281

Le Bail A, Dittami SM, de Franco P, Rousvoal S, Cock MJ, Tonon T,

Charrier B (2008b) Normalization genes for expression analyses in the

brown alga model Ectocarpus siliculosus. BMC Mol Biol 9: 75

Ljung K, Hull AK, Kowalczyk M, Marchant A, Celenza J, Cohen JD,

Sandberg G (2002) Biosynthesis, conjugation, catabolism and homeo-

stasis of indole-3-acetic acid in Arabidopsis thaliana. Plant Mol Biol 49:

249–272

Muller DG (1967) Generationswechsel, Kernphasenwechsel und Sexualitat

der Braunalge Ectocarpus siliculosus im Kulturversuch. Planta 75:

39–54

Nafisi M, Goregaoker S, Botanga CJ, Glawischnig E, Olsen CE, Halkier

BA, Glazebrook J (2007) Arabidopsis cytochrome P450 monooxygenase

71A13 catalyzes the conversion of indole-3-acetaldoxime in camalexin

synthesis. Plant Cell 19: 2039–2052

Overbeek R, Fonstein M, D’Souza M, Pusch GD, Maltsev N (1999) The

use of gene clusters to infer functional coupling. Proc Natl Acad Sci USA

96: 2896–2901

Paciorek T, Zazımalova E, Ruthardt N, Petrasek J, Stierhof Y, Kleine-

Vehn J, Morris DA, Emans N, Jurgens G, Geldner N, et al (2005) Auxin

inhibits endocytosis and promotes its own efflux from cells. Nature 435:

1251–1256

Parry G, Estelle M (2006) Auxin receptors: a new role for F-box proteins.

Curr Opin Cell Biol 18: 152–156

Peters AF, Marie D, Scornet D, Kloareg B, Cock JM (2004) Proposal of

Ectocarpus siliculosus (Ectocarpales, Phaeophyceae) as a model organism

for brown algal genetics and genomics. J Phycol 40: 1079–1088

Peters AF, Scornet D, Ratin M, Charrier B, Monnier A, Merrien Y, Corre E,

Coelho SM, Cock JM (2008) Life-cycle-generation-specific develop-

mental processes are modified in the immediate upright mutant of the

brown alga Ectocarpus siliculosus. Development 135: 1503–1512

Phillips N, Burrowes R, Rousseau F, de Reviers B, Saunders GW (2008)

Resolving evolutionary relationships among the brown algae using

chloroplast and nuclear genes. J Phycol 44: 394–405

Ringli C, Keller B, Ryser U (2001) Glycine-rich proteins as structural

components of plant cell walls. Cell Mol Life Sci 58: 1430–1441

Ritter A, Goulitquer S, Salaun J, Tonon T, Correa JA, Potin P (2008)

Copper stress induces biosynthesis of octadecanoid and eicosanoid

oxygenated derivatives in the brown algal kelp Laminaria digitata. New

Phytol 180: 809–821

Starr RC, Zeikus JA (1993) Utex: the culture collection of algae at the

University of Texas at Austin. J Phycol 29: 1–106

Stepanova AN, Robertson-Hoyt J, Yun J, Benavente LM, Xie D, Dolezal K,

Schlereth A, Jurgens G, Alonso JM (2008) TAA1-mediated auxin

biosynthesis is essential for hormone crosstalk and plant development.

Cell 133: 177–191

Stern CD (2006) Evolution of the mechanisms that establish the embryonic

axes. Curr Opin Genet Dev 16: 413–418

Sugawara S, Hishiyama S, Jikumaru Y, Hanada A, Nishimura T, Koshiba

T, Zhao Y, Kamiya Y, Kasahara H (2009) Biochemical analyses of indole-

3-acetaldoxime-dependent auxin biosynthesis in Arabidopsis. Proc Natl

Acad Sci USA 106: 5430–5435

Sun H, Basu S, Brady SR, Luciano RL, Muday GK (2004) Interactions

between auxin transport and the actin cytoskeleton in developmental

polarity of Fucus distichus embryos in response to light and gravity. Plant

Physiol 135: 266–278

Tarakhovskaya ER, Maslov YI, Shishova MF (2007) Phytohormones in

algae. Russ J Plant Physiol 54: 163–170

Titapiwatanakun B, Blakeslee JJ, Bandyopadhyay A, Yang H, Mravec J,

Sauer M, Cheng Y, Adamec J, Nagashima A, Geisler M, et al (2009)

ABCB19/PGP19 stabilises PIN1 in membrane microdomains in Arabi-

dopsis. Plant J 57: 27–44

UniProt Consortium (2009) The Universal Protein Resource (UniProt).

Nucleic Acids Res 37: D169–D174

Woodward AW, Bartel B (2005) Auxin: regulation, action, and interaction.

Ann Bot (Lond) 95: 707–735

Yamamoto M, Yamamoto KT (1998) Differential effects of 1-naphthalene-

acetic acid, indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid on

the gravitropic response of roots in an auxin-resistant mutant of

Arabidopsis, aux1. Plant Cell Physiol 39: 660–664

Yoon HS, Hackett JD, Ciniglia C, Pinto G, Bhattacharya D (2004) A

molecular timeline for the origin of photosynthetic eukaryotes. Mol Biol

Evol 21: 809–818

Zdobnov EM, Apweiler R (2001) InterProScan: an integration platform

for the signature-recognition methods in InterPro. Bioinformatics 17:

847–848

Le Bail et al.




Auxin Metabolism and Function in the Multicellular Brown Alga ...

Documents

Transcript of Auxin Metabolism and Function in the Multicellular Brown Alga ...