3

Australian Marine Sciences Association Inc.

AMSA 2017

CONFERENCE “CONNECTIONS THROUGH SHALLOW SEAS”

Doubletree by Hilton and Darwin Entertainment Centre Darwin, Northern Territory, 2–6 July 2017

HANDBOOK

69

Full schedule

14:0018:00

7:30

8.30-8.358.35-8.458.45-8.558.55-9.309.30-9.509.50 -10.30

Session 1: Playhouse theatre Session 2: Ballroom 1 Session 3: Ballroom 2 Session 4: Litchfield room Session 5: GalleryS3: Building resilient urban ports and harbours through globally integrated research and management

S5: Ecological diversity and connectivity in the tropical eastern Indian Ocean

S17: Swimming the talk: management of marine megafauna in Australian waters

S15: Great Australian Bight – seeking whole-of-system understanding

G1:Marine fundamentals

Chair: Peter Steinberg and Beth Strain

Chair: Zoe Richards, Kathryn McMahon and Jim Underwood

Chair: Holly Raudino and Carol Palmer

Chair: Jason Tanner Chair: Claire Streten

10:25- 10:30 Peter Steinberg: Introduction to the symposium

10.30-10.50 Niels Munksgaard: Metal and metalloid concentrations in Darwin Harbour sediment: influence of urban development

Zoe Richards: The Kimberley - Australia's great unsung coral sanctuary

Carol Palmer: A Preliminary Study of the Movement Patterns of False Killer Whales Pseudorca crassidens in Waters of the Northern Territory, Australia.

Ben Baghurst: The Great Australian Bight Research Program - seeking whole of system understanding

Fallen Teoh: Comparative whole membrane proteomics analyses of marine cyanobacteria

10.50-11.10 Elisabeth Strain: The efficacy of eco-engineered interventions for enhancing the native biodiversity of seawalls in harbours across the globe.

Fabio Boschetti: Setting priorities for conservation initiatives at the interface between ecological connectivity, ocean circulation and ecological dynamics

Holly Raudino: Identifying critical habitat for dolphins in North Western Australia

David Griffin: Circulation of the Great Australian Bight: the influence of waves and the Leeuwin Current. Presented by Peter Oke

Rachel Manassa: Photosynthetic acclimation to desiccation stress in Zostera muelleri

Sunday 2nd July 2017Registration opens - Reflections room, DoubleTree by Hilton Darwin Esplanade

WELCOME FUNCTION - Reflections room, DoubleTree by Hilton Darwin Esplanade

Plenary address: Professor Helene Marsh ' Ecological and cultural connections through coastal seas enabled by marine megafauna ' Invited speaker: Mr Tim Moltmann 'Implementing the National Marine Science Plan'

Morning tea

Official Opening: Honourable Lauren Moss MLA

Monday 3rd July 2017Registration opens

Room: Playhouse theatreWelcome to Country

Introduction: Edward Butler

70

Session 1: Playhouse theatre Session 2: Ballroom 1 Session 3: Ballroom 2 Session 4: Litchfield room Session 5: GallerySymposium S3 Symposium S5 Symposium S17 Symposium S15 G1:Marine fundamentalsChair: Peter Steinberg and Beth Strain

Chair: Zoe Richards, Kathryn McMahon and Jim Underwood

Chair: Holly Raudino and Carol Palmer

Chair: Jason Tanner Chair: Claire Streten

11.10-11.30 Katherine Dafforn: The ecological consequences of urban seascapes at the microbial scale

Kathryn McMahon: Patterns in diversity of seagrasses in the tropical Indian Ocean

Rachel Groom: Distribution and abundance of Dugong in the Northern Territory

John Middleton: The ocean circulation and dynamics of the Great Australian Bight: model results and validation

Talia Stelling-Wood: Using functional traits to predict biodiversity in subtidal macroalgae systems.

11.30-11.50 Sarah Kienker: Australasian differences in Stakeholder attitudes towards ecological engineering of Marine artificial structures

Jim Underwood: Expect the unexpected: remarkable genetic divergence among and within the wild coral reefs of the Kimberley

David Curmi: Monitoring and management of sea turtles and other marine megafauna in the Thamarrurr Region - where to from here?

Nicole Patten: Shifts in plankton community composition in the Great Australian Bight: New insights into food web dynamics. Presented by Paul van Ruth

Euan Provost: Climate-driven disparities among ecological interactions threaten kelp forest persistence

11.50-12.10 Keliang Chen: Challenges and Experiences in Xiamen's Blue Bay Remediation Action

Made Pharmawati: Microsatellite DNA analysis of genetic diversity in Enhalus acoroides in Indonesia

Duane March: Assessing states of health and disease in stranded green sea turtles (Chelonia mydas)

Jochen Kaempf: Discovery of Widespread Autumn Phytoplankton Blooms in the Great Australian Bight

Victor Shelamoff: Patch characteristics of Ecklonia radiata influence associated community structure

12.10-12.15 PEP - Jeff Tsang: Assessment of Arsenic Bioavailability in Darwin Harbour Sediment

PEP - James Gilmour: Scales of stock-recruitment and the resilience of isolated coral reefs

PEP - Ricardo Alvarez: Spatial distribution patterns in South American in-shore dolphins.

PEP - Megan Carve Luzardo: Impacts to seagrass from the herbicide Fusilade Forte® in management of Spartina anglica infestations

12.15-12.20 PEP - Shin Ushiama: Designing fish-friendly seawalls

PEP - Oliver Berry: Isolation of oceanic and coastal populations of the harvested mother-of-pearl shell Tectus niloticus in the Kimberley. Presented by Mike Travers

PEP - Francesca Gissi: Using the SeaSim facility for ecotoxicology -testing the effects of Ni and Cu on the adult hard coral Acropora muricata.

12.20-12.25 PEP - Stuart Pearson: Jakarta Bay as an opportunity for collaborative and integrative research and the need for knowledge brokering

PEP - Catherine Kim: Biodiversity of coral reef cryptofauna in relation to coral habitat and reef fish communities in Timor-Leste

PEP - Allyson O'Brien: Going back to basics: population dynamics and ecotoxicology

12.25-12.30 PEP - Jean Chai Yee: Yard in the marinas - the initiation of WHP in Penang

PEP - Katrina West: The application of eDNA metabarcoding for marine biodiversity monitoring at the Cocos-Keeling Islands.

12.30-13.30

Lisa-ann Gershwin: Siphonophores: fearsome predators in oceanic food webs

Lunch

Monday 3rd July 2017

216

‘Barrens of gold’: sea urchin farming as a driver of ecological restoration Pert, Cassandra*1, Tim Dempster1 and Stephen Swearer1 1 School of BioSciences, The University of Melbourne, Parkville, Victoria 3010. cpert@student.unimelb.edu.au

Overgrazing by overabundant sea urchins is causing kelp-dominated reefs to shift to urchin barrens throughout southern Australia. These areas are characterised by low kelp abundance, low biodiversity and high urchin densities. Urchin gonads are a delicacy in many countries and commercial urchin harvest has the potential to allow kelp recovery. However, urchins in barrens are considered inedible due to low food availability. We assessed whether urchins from three barren sites could reach commercial quality through gonad conditioning: providing optimal feed and environmental conditions. We collected urchins from three barren and three kelp sites in Port Phillip Bay. Our initial collections indicated that urchins from some barren sites have gonads of higher quality than urchins from kelp sites. This quality was further improved after gonad conditioning with some urchins experiencing a 200% increase in gonad index compared to the baseline sample. Moreover, these urchins had gonads up to 150% larger than urchins from three kelp sites where commercial harvesting occurs. This indicates that gonad conditioning is an effective means of improving the commercial quality of urchins from barrens, making these overabundant invertebrates an untapped resource that could be harnessed for economic and ecological benefit. This project is the initial step in establishing an urchin farming industry in Victoria. Additionally, this study may revolutionise how we manage barrens and existing global urchin fisheries.

Microsatellite DNA analysis of genetic diversity in Enhalus acoroides in Indonesia Pharmawati, Made*1,2, Syamsuni, Yuliana2, Kurnia, Maliza1, Aryani, Putu1, Putra, Giri2 and Hawis Madduppa4 1 Biology Department, Faculty of Mathematics and Natural Sciences, Udayana University, Kampus Bukit

Jimbaran, Bali, Indonesia. 2 Indonesian Biodiversity Research Center, Udayana University, Jalan Raya Sesetan Gang Markisa no 7B,

Denpasar, Bali 3 Faculty of Fishery and Marine Science, Bogor Agricultural University, Jalan Agatis, Kampus IPB, Darmaga,

Bogor, Indonesia made_pharmawati@unud.ac.id

Enhalus acoroides is large seagrass widely distributed in Indonesia. Using eight microsatellite DNA loci, the diversity of E. acoroides in Indonesia was studied. The study was divided into western and eastern parts of Indonesia. The heterozygosity was highest in eastern Indonesia compared to western Indonesia. In western Indonesia, it was found that the observed and expected heterozygosity ranged from 0.434 to 0.615 and from 0.458 to 0.605, respectively. The analysis revealed high genetic differentiation between sites. In eastern Indonesia, the observed and expected heterozygosity were from 0.671 to 0.801 and from 0.636 to 0.735 respectively, with significant differentiation between sites. High genetic differentiation may indicates low gene flow between populations. In western Indonesia, the E. acoroides can be grouped into three groups, while in eastern Indonesia, E. acoroides were grouped into 2 groups.

Microsatellite DNA Analyses on Genetic Diversity ofEnhalus acoroides in Indonesia

Made Pharmawati, Yuliana Syamsuni, Maliza Kurnia, Putu Aryani,Giri Putra, Hawis Madduppa

Udayana UniversityBali, Indonesia

INTRODUCTIONBackground

Pacific

Indian

Indonesia is home todiversity of variousmarine species

Despite rigorousobservation of geneticdiversity of many motilespecies, research on seagrass, particularlypopulation genetic, havereceived little attentions.

Enhalus acoroides

Widely spread in Indonesia (Kiswara andHutomo 1985)

Easily distinguished from the otherseagrass species (Short and Waycott 2010)

Dispersal ability of seeds and fruits of E.acoroides could reach 3.7 km and 63.5 km,respectively (Lacap et al. 2002)

BackgroundINTRODUCTION

Background

Microsatellite DNAHighly polymorphic marker

Have an ability to distinguish betweenhomozygotes and heterozygotesalleles

PCR based analysis

INTRODUCTION

Previous phylogeographicstudies using microsatellite

1. Fish (Koskinen et al. 2002;Madduppa et al. 2014)

2. Mangroves (Wee et al.2015)

3. Cymodocea nodosa(Alberto et al, 2008),Zostera caespitosa (Tanakaet al., 2012)In seagrass microsatellite primers have

been developed for several species ie.Enhalus acoroides, Cymodoceaserrulata, C. rotundata

INTRODUCTIONResearch objectives

1) To examine genetic diversity of E. acoroides2) To examine genetic differentiation among population3) To infer phylogeographic pattern of E. acoroides

The results of this study could beapplied in seagrass conservation

Sample collection & preservation

a. Sample collection

b. Preservation

Silica gel

Arriesgado, 2013

MATERIALS AND METHODS

The distance between one sampleto others is at least 5 m

Sampling sitesMATERIALS AND METHODS

Population Sample size

Pulau Pramuka, West Java 18

Raja ampat, West Papua 18

Ambon 28

Bali 19

Aceh 30

Derawan, East Kalimantan 20

Manado, North Sulawesi 30

Bontang 32

Molecular work

DNA extraction Visualization Amplification

Method.DNeasy plant mini kit(Qiagen®) followingmanufacturer’s protocol

Method.Electrophoresis using 1%agarose gel, and thenvisualized using UVtransluminator.

MethodPCR (Polymerase ChainReaction). PCR conditionfollowing Nakajima et al.(2012)

MATERIALS AND METHODS

Molecular workLoci Primer sequence (5’-3’) Dye Size range

(bp)Accession

no.Eaco_001 GGCTTGAGTTTGTTTAGAATTCTAG F

GGTTTTCCCAGTCACGACGTTACATGTGGAATGCATACAC R(FAM)Blue

232-246 AB689192

Eaco_009 CAATCGTCCAATCCAAAGGC FGGTTTTCCCAGTCACGACGGGAGAATTGTATTATTTAC R

(FAM)Blue

142-154 AB689194

Eaco_019 AGGTATTCCTTACCACCGTTC FGGTTTTCCCAGTCACGACGCACGGAGGTCTTTCGAAGTTG R

(VIC)Green

195-197 AB689197

Eaco_051 CATACAGATGCATGCATACTC FGGTTTTCCCAGTCACGACGCTAAGCGCTACGTGGTACTAG R

(PET)Red

206-231 AB689200

Eaco_054 GCTTCTAATTAGCATTTTGGACTTCAG FGGTTTTCCCAGTCACGACGATTTGGGACGTCCAAAGAG R

(PET)Red

267-295 AB689202

Eaco_055 CTTTTGCTCCCAAATTGAATG FGGTTTTCCCAGTCACGACGATGCTTAGTGCAGCTTGTTC R

(PET)Red

165-191 AB689203

MATERIALS AND METHODS

Nakajima et al., 2012

Fragment Analysis

PCR products were visualized using 1.5% agarose gel.

PCR products sent to UC Berkeley, Dept. of Molecular andCell Biology Sequencing Facility, USA

Individual genotypes were scored using Geneious 7.0.6(Biomatters Ltd.)

Number of allele, observed heterozygosity (HO), expectedheterozygosity (HE)

Pairwise FST

MATERIALS AND METHODS

Genetic diversityRESULTS AND DISCUSSION

Locus Na Ho HeP. Pramuka (n=18)

mean 5.83 0.667 0.633Raja Ampat (n=18)

mean 8.67 0.806 0.814Ambon (n=28)

Mean 8.17 0.798 0.735Bali (n=29)

mean 8.50 0.736 0.695Aceh (n=30)

mean 8.50 0.833 0.758Derawan (n=20)

mean 7.17 0.750 0.645Bontang (n=32)

mean 9.00 0.823 0.747Manado (n=35)

mean 9.17 0.867 0.797Total Mean 8.13 0.785 0.728

Present study,Ho = 0.785, He = 0.728

Previous studyHo = 0.165 – 0.575 in Japan,China and Philipines (Nakajimaet al. 2014)

Other seagrass speciesC. nodosa,Ho = 0.296 – 0.750 acrossMediterranean-Atlantic(Alberto et al. 2008)

Z. marina,Ho = 0.491 – 0.563 in Mexico(Muniz-Salazar et al. 2006)

This study showed that E. acoroides has highgenetic diversity among all sites

Genetic differentiationRESULTS AND DISCUSSION

P. Pramuka Raja Ampat Ambon Bali Aceh Derawan Bontang Manado

1. P. Pramuka -

2. Raja Ampat 0.15848 -

3. Ambon 0.14754 0.09615 -

4. Bali 0.16272 0.11202 0.13454 -

5. Aceh 0.20152 0.11820 0.14800 0.14829 -

6. Derawan 0.16503 0.14950 0.15205 0.10271 0.16283 -

7. Bontang 0.20668 0.16651 0.21137 0.19760 0.21148 0.18199 -

8. Manado 0.14904 0.10497 0.14397 0.12252 0.13925 0.08957 0.05748 -

Pairwise FST values ranged from 0.057 to 0.211 ( P < 0.001 )

Genetic differentiationRESULTS AND DISCUSSION

AMOVA result from 6 microsatellite loci of Enhallus acoroides from 8 populationsacross Indonesia

Source of variation

AMOVA

VariancePercentage

of variationF statistic P-value

Among populatin 0.39254 14.88 0.1488 0.0000

Between

population 2.24612 85.12

Genetic differentiationRESULTS AND DISCUSSION

Using Structure 2.3.4. (Pritchard et al. 2000), 4 genetic cluster fit the data.Result indicate 4 group corresponding to Aceh (Cluster 1), P. Pramuka, Baliand Derawan (Cluster 2), Bontang and Manado (Cluster 3) and Raja Ampatand Ambon (Cluster 4 ).

1 2 3 4

Aceh population was genetically distinct from the other populations

Phylogeographic patternRESULTS AND DISCUSSION

UPGMA tree based on genetic distance(Da) were constructed using POPTREE2

RESULTS AND DISCUSSION

Divergence in Western Indonesia hasbeen observed widely in motile andsessile invertebrate and fishes (Barberet al. 2002) (Kochzius & Nuryanto2008) (Boer et al. 2008) (Ackiss et al.2013) (Jackson et al. 2014).

Divergence of western Indonesian demes including Medan, Nias, and Aceh haslikely resulted from reduced pelagic marine habitats, exposure of the SundaShelf during Pleistocene low sea stands (Barber, 2002)

Isolation by Distance (IBD) over all population for all six loci revealed nosignificant correlation between geographic distance and geneticdifferentiation (P>0.05).

Ocean currents were once presumed to facilitate long distance dispersal

CONCLUSION

1) E. acoroides showed high level of genetic diversity.2) Four groups were identified represent western, eastern and central

Indonesia

This study is funded by PEER (the Partnerships for Enhanced Engagement inResearch, USAID

We thank Beginner Subhan, Dondy Arafat, Aji Wahyu Anggoro and Biosystematics,Widiastuti, Khalidin, Dita Cahyani, for their helps in sample collection.

We thank Mahardika, Astria Yusmalinda, Rizki Wulandari, Andrianus Sembiring,who had facilitated all the research works

My high gratitude to Australia Indonesia Institute for their support

ACKNOWLEDGEMENTS