Australian Marine Sciences Association Inc. AMSA 2017 · PEP - Katrina West: The application of...
Transcript of Australian Marine Sciences Association Inc. AMSA 2017 · PEP - Katrina West: The application of...
3
Australian Marine Sciences Association Inc.
AMSA 2017
CONFERENCE “CONNECTIONS THROUGH SHALLOW SEAS”
Doubletree by Hilton and Darwin Entertainment Centre Darwin, Northern Territory, 2–6 July 2017
HANDBOOK
69
Full schedule
14:0018:00
7:30
8.30-8.358.35-8.458.45-8.558.55-9.309.30-9.509.50 -10.30
Session 1: Playhouse theatre Session 2: Ballroom 1 Session 3: Ballroom 2 Session 4: Litchfield room Session 5: GalleryS3: Building resilient urban ports and harbours through globally integrated research and management
S5: Ecological diversity and connectivity in the tropical eastern Indian Ocean
S17: Swimming the talk: management of marine megafauna in Australian waters
S15: Great Australian Bight – seeking whole-of-system understanding
G1:Marine fundamentals
Chair: Peter Steinberg and Beth Strain
Chair: Zoe Richards, Kathryn McMahon and Jim Underwood
Chair: Holly Raudino and Carol Palmer
Chair: Jason Tanner Chair: Claire Streten
10:25- 10:30 Peter Steinberg: Introduction to the symposium
10.30-10.50 Niels Munksgaard: Metal and metalloid concentrations in Darwin Harbour sediment: influence of urban development
Zoe Richards: The Kimberley - Australia's great unsung coral sanctuary
Carol Palmer: A Preliminary Study of the Movement Patterns of False Killer Whales Pseudorca crassidens in Waters of the Northern Territory, Australia.
Ben Baghurst: The Great Australian Bight Research Program - seeking whole of system understanding
Fallen Teoh: Comparative whole membrane proteomics analyses of marine cyanobacteria
10.50-11.10 Elisabeth Strain: The efficacy of eco-engineered interventions for enhancing the native biodiversity of seawalls in harbours across the globe.
Fabio Boschetti: Setting priorities for conservation initiatives at the interface between ecological connectivity, ocean circulation and ecological dynamics
Holly Raudino: Identifying critical habitat for dolphins in North Western Australia
David Griffin: Circulation of the Great Australian Bight: the influence of waves and the Leeuwin Current. Presented by Peter Oke
Rachel Manassa: Photosynthetic acclimation to desiccation stress in Zostera muelleri
Sunday 2nd July 2017Registration opens - Reflections room, DoubleTree by Hilton Darwin Esplanade
WELCOME FUNCTION - Reflections room, DoubleTree by Hilton Darwin Esplanade
Plenary address: Professor Helene Marsh ' Ecological and cultural connections through coastal seas enabled by marine megafauna ' Invited speaker: Mr Tim Moltmann 'Implementing the National Marine Science Plan'
Morning tea
Official Opening: Honourable Lauren Moss MLA
Monday 3rd July 2017Registration opens
Room: Playhouse theatreWelcome to Country
Introduction: Edward Butler
70
Session 1: Playhouse theatre Session 2: Ballroom 1 Session 3: Ballroom 2 Session 4: Litchfield room Session 5: GallerySymposium S3 Symposium S5 Symposium S17 Symposium S15 G1:Marine fundamentalsChair: Peter Steinberg and Beth Strain
Chair: Zoe Richards, Kathryn McMahon and Jim Underwood
Chair: Holly Raudino and Carol Palmer
Chair: Jason Tanner Chair: Claire Streten
11.10-11.30 Katherine Dafforn: The ecological consequences of urban seascapes at the microbial scale
Kathryn McMahon: Patterns in diversity of seagrasses in the tropical Indian Ocean
Rachel Groom: Distribution and abundance of Dugong in the Northern Territory
John Middleton: The ocean circulation and dynamics of the Great Australian Bight: model results and validation
Talia Stelling-Wood: Using functional traits to predict biodiversity in subtidal macroalgae systems.
11.30-11.50 Sarah Kienker: Australasian differences in Stakeholder attitudes towards ecological engineering of Marine artificial structures
Jim Underwood: Expect the unexpected: remarkable genetic divergence among and within the wild coral reefs of the Kimberley
David Curmi: Monitoring and management of sea turtles and other marine megafauna in the Thamarrurr Region - where to from here?
Nicole Patten: Shifts in plankton community composition in the Great Australian Bight: New insights into food web dynamics. Presented by Paul van Ruth
Euan Provost: Climate-driven disparities among ecological interactions threaten kelp forest persistence
11.50-12.10 Keliang Chen: Challenges and Experiences in Xiamen's Blue Bay Remediation Action
Made Pharmawati: Microsatellite DNA analysis of genetic diversity in Enhalus acoroides in Indonesia
Duane March: Assessing states of health and disease in stranded green sea turtles (Chelonia mydas)
Jochen Kaempf: Discovery of Widespread Autumn Phytoplankton Blooms in the Great Australian Bight
Victor Shelamoff: Patch characteristics of Ecklonia radiata influence associated community structure
12.10-12.15 PEP - Jeff Tsang: Assessment of Arsenic Bioavailability in Darwin Harbour Sediment
PEP - James Gilmour: Scales of stock-recruitment and the resilience of isolated coral reefs
PEP - Ricardo Alvarez: Spatial distribution patterns in South American in-shore dolphins.
PEP - Megan Carve Luzardo: Impacts to seagrass from the herbicide Fusilade Forte® in management of Spartina anglica infestations
12.15-12.20 PEP - Shin Ushiama: Designing fish-friendly seawalls
PEP - Oliver Berry: Isolation of oceanic and coastal populations of the harvested mother-of-pearl shell Tectus niloticus in the Kimberley. Presented by Mike Travers
PEP - Francesca Gissi: Using the SeaSim facility for ecotoxicology -testing the effects of Ni and Cu on the adult hard coral Acropora muricata.
12.20-12.25 PEP - Stuart Pearson: Jakarta Bay as an opportunity for collaborative and integrative research and the need for knowledge brokering
PEP - Catherine Kim: Biodiversity of coral reef cryptofauna in relation to coral habitat and reef fish communities in Timor-Leste
PEP - Allyson O'Brien: Going back to basics: population dynamics and ecotoxicology
12.25-12.30 PEP - Jean Chai Yee: Yard in the marinas - the initiation of WHP in Penang
PEP - Katrina West: The application of eDNA metabarcoding for marine biodiversity monitoring at the Cocos-Keeling Islands.
12.30-13.30
Lisa-ann Gershwin: Siphonophores: fearsome predators in oceanic food webs
Lunch
Monday 3rd July 2017
216
‘Barrens of gold’: sea urchin farming as a driver of ecological restoration Pert, Cassandra*1, Tim Dempster1 and Stephen Swearer1 1 School of BioSciences, The University of Melbourne, Parkville, Victoria 3010. [email protected]
Overgrazing by overabundant sea urchins is causing kelp-dominated reefs to shift to urchin barrens throughout southern Australia. These areas are characterised by low kelp abundance, low biodiversity and high urchin densities. Urchin gonads are a delicacy in many countries and commercial urchin harvest has the potential to allow kelp recovery. However, urchins in barrens are considered inedible due to low food availability. We assessed whether urchins from three barren sites could reach commercial quality through gonad conditioning: providing optimal feed and environmental conditions. We collected urchins from three barren and three kelp sites in Port Phillip Bay. Our initial collections indicated that urchins from some barren sites have gonads of higher quality than urchins from kelp sites. This quality was further improved after gonad conditioning with some urchins experiencing a 200% increase in gonad index compared to the baseline sample. Moreover, these urchins had gonads up to 150% larger than urchins from three kelp sites where commercial harvesting occurs. This indicates that gonad conditioning is an effective means of improving the commercial quality of urchins from barrens, making these overabundant invertebrates an untapped resource that could be harnessed for economic and ecological benefit. This project is the initial step in establishing an urchin farming industry in Victoria. Additionally, this study may revolutionise how we manage barrens and existing global urchin fisheries.
Microsatellite DNA analysis of genetic diversity in Enhalus acoroides in Indonesia Pharmawati, Made*1,2, Syamsuni, Yuliana2, Kurnia, Maliza1, Aryani, Putu1, Putra, Giri2 and Hawis Madduppa4 1 Biology Department, Faculty of Mathematics and Natural Sciences, Udayana University, Kampus Bukit
Jimbaran, Bali, Indonesia. 2 Indonesian Biodiversity Research Center, Udayana University, Jalan Raya Sesetan Gang Markisa no 7B,
Denpasar, Bali 3 Faculty of Fishery and Marine Science, Bogor Agricultural University, Jalan Agatis, Kampus IPB, Darmaga,
Bogor, Indonesia [email protected]
Enhalus acoroides is large seagrass widely distributed in Indonesia. Using eight microsatellite DNA loci, the diversity of E. acoroides in Indonesia was studied. The study was divided into western and eastern parts of Indonesia. The heterozygosity was highest in eastern Indonesia compared to western Indonesia. In western Indonesia, it was found that the observed and expected heterozygosity ranged from 0.434 to 0.615 and from 0.458 to 0.605, respectively. The analysis revealed high genetic differentiation between sites. In eastern Indonesia, the observed and expected heterozygosity were from 0.671 to 0.801 and from 0.636 to 0.735 respectively, with significant differentiation between sites. High genetic differentiation may indicates low gene flow between populations. In western Indonesia, the E. acoroides can be grouped into three groups, while in eastern Indonesia, E. acoroides were grouped into 2 groups.
Microsatellite DNA Analyses on Genetic Diversity ofEnhalus acoroides in Indonesia
Made Pharmawati, Yuliana Syamsuni, Maliza Kurnia, Putu Aryani,Giri Putra, Hawis Madduppa
Udayana UniversityBali, Indonesia
INTRODUCTIONBackground
Pacific
Indian
Indonesia is home todiversity of variousmarine species
Despite rigorousobservation of geneticdiversity of many motilespecies, research on seagrass, particularlypopulation genetic, havereceived little attentions.
Enhalus acoroides
Widely spread in Indonesia (Kiswara andHutomo 1985)
Easily distinguished from the otherseagrass species (Short and Waycott 2010)
Dispersal ability of seeds and fruits of E.acoroides could reach 3.7 km and 63.5 km,respectively (Lacap et al. 2002)
BackgroundINTRODUCTION
Background
Microsatellite DNAHighly polymorphic marker
Have an ability to distinguish betweenhomozygotes and heterozygotesalleles
PCR based analysis
INTRODUCTION
Previous phylogeographicstudies using microsatellite
1. Fish (Koskinen et al. 2002;Madduppa et al. 2014)
2. Mangroves (Wee et al.2015)
3. Cymodocea nodosa(Alberto et al, 2008),Zostera caespitosa (Tanakaet al., 2012)In seagrass microsatellite primers have
been developed for several species ie.Enhalus acoroides, Cymodoceaserrulata, C. rotundata
INTRODUCTIONResearch objectives
1) To examine genetic diversity of E. acoroides2) To examine genetic differentiation among population3) To infer phylogeographic pattern of E. acoroides
The results of this study could beapplied in seagrass conservation
Sample collection & preservation
a. Sample collection
b. Preservation
Silica gel
Arriesgado, 2013
MATERIALS AND METHODS
The distance between one sampleto others is at least 5 m
Sampling sitesMATERIALS AND METHODS
Population Sample size
Pulau Pramuka, West Java 18
Raja ampat, West Papua 18
Ambon 28
Bali 19
Aceh 30
Derawan, East Kalimantan 20
Manado, North Sulawesi 30
Bontang 32
Molecular work
DNA extraction Visualization Amplification
Method.DNeasy plant mini kit(Qiagen®) followingmanufacturer’s protocol
Method.Electrophoresis using 1%agarose gel, and thenvisualized using UVtransluminator.
MethodPCR (Polymerase ChainReaction). PCR conditionfollowing Nakajima et al.(2012)
MATERIALS AND METHODS
Molecular workLoci Primer sequence (5’-3’) Dye Size range
(bp)Accession
no.Eaco_001 GGCTTGAGTTTGTTTAGAATTCTAG F
GGTTTTCCCAGTCACGACGTTACATGTGGAATGCATACAC R(FAM)Blue
232-246 AB689192
Eaco_009 CAATCGTCCAATCCAAAGGC FGGTTTTCCCAGTCACGACGGGAGAATTGTATTATTTAC R
(FAM)Blue
142-154 AB689194
Eaco_019 AGGTATTCCTTACCACCGTTC FGGTTTTCCCAGTCACGACGCACGGAGGTCTTTCGAAGTTG R
(VIC)Green
195-197 AB689197
Eaco_051 CATACAGATGCATGCATACTC FGGTTTTCCCAGTCACGACGCTAAGCGCTACGTGGTACTAG R
(PET)Red
206-231 AB689200
Eaco_054 GCTTCTAATTAGCATTTTGGACTTCAG FGGTTTTCCCAGTCACGACGATTTGGGACGTCCAAAGAG R
(PET)Red
267-295 AB689202
Eaco_055 CTTTTGCTCCCAAATTGAATG FGGTTTTCCCAGTCACGACGATGCTTAGTGCAGCTTGTTC R
(PET)Red
165-191 AB689203
MATERIALS AND METHODS
Nakajima et al., 2012
Fragment Analysis
PCR products were visualized using 1.5% agarose gel.
PCR products sent to UC Berkeley, Dept. of Molecular andCell Biology Sequencing Facility, USA
Individual genotypes were scored using Geneious 7.0.6(Biomatters Ltd.)
Number of allele, observed heterozygosity (HO), expectedheterozygosity (HE)
Pairwise FST
MATERIALS AND METHODS
Genetic diversityRESULTS AND DISCUSSION
Locus Na Ho HeP. Pramuka (n=18)
mean 5.83 0.667 0.633Raja Ampat (n=18)
mean 8.67 0.806 0.814Ambon (n=28)
Mean 8.17 0.798 0.735Bali (n=29)
mean 8.50 0.736 0.695Aceh (n=30)
mean 8.50 0.833 0.758Derawan (n=20)
mean 7.17 0.750 0.645Bontang (n=32)
mean 9.00 0.823 0.747Manado (n=35)
mean 9.17 0.867 0.797Total Mean 8.13 0.785 0.728
Present study,Ho = 0.785, He = 0.728
Previous studyHo = 0.165 – 0.575 in Japan,China and Philipines (Nakajimaet al. 2014)
Other seagrass speciesC. nodosa,Ho = 0.296 – 0.750 acrossMediterranean-Atlantic(Alberto et al. 2008)
Z. marina,Ho = 0.491 – 0.563 in Mexico(Muniz-Salazar et al. 2006)
This study showed that E. acoroides has highgenetic diversity among all sites
Genetic differentiationRESULTS AND DISCUSSION
P. Pramuka Raja Ampat Ambon Bali Aceh Derawan Bontang Manado
1. P. Pramuka -
2. Raja Ampat 0.15848 -
3. Ambon 0.14754 0.09615 -
4. Bali 0.16272 0.11202 0.13454 -
5. Aceh 0.20152 0.11820 0.14800 0.14829 -
6. Derawan 0.16503 0.14950 0.15205 0.10271 0.16283 -
7. Bontang 0.20668 0.16651 0.21137 0.19760 0.21148 0.18199 -
8. Manado 0.14904 0.10497 0.14397 0.12252 0.13925 0.08957 0.05748 -
Pairwise FST values ranged from 0.057 to 0.211 ( P < 0.001 )
Genetic differentiationRESULTS AND DISCUSSION
AMOVA result from 6 microsatellite loci of Enhallus acoroides from 8 populationsacross Indonesia
Source of variation
AMOVA
VariancePercentage
of variationF statistic P-value
Among populatin 0.39254 14.88 0.1488 0.0000
Between
population 2.24612 85.12
Genetic differentiationRESULTS AND DISCUSSION
Using Structure 2.3.4. (Pritchard et al. 2000), 4 genetic cluster fit the data.Result indicate 4 group corresponding to Aceh (Cluster 1), P. Pramuka, Baliand Derawan (Cluster 2), Bontang and Manado (Cluster 3) and Raja Ampatand Ambon (Cluster 4 ).
1 2 3 4
Aceh population was genetically distinct from the other populations
Phylogeographic patternRESULTS AND DISCUSSION
UPGMA tree based on genetic distance(Da) were constructed using POPTREE2
RESULTS AND DISCUSSION
Divergence in Western Indonesia hasbeen observed widely in motile andsessile invertebrate and fishes (Barberet al. 2002) (Kochzius & Nuryanto2008) (Boer et al. 2008) (Ackiss et al.2013) (Jackson et al. 2014).
Divergence of western Indonesian demes including Medan, Nias, and Aceh haslikely resulted from reduced pelagic marine habitats, exposure of the SundaShelf during Pleistocene low sea stands (Barber, 2002)
Isolation by Distance (IBD) over all population for all six loci revealed nosignificant correlation between geographic distance and geneticdifferentiation (P>0.05).
Ocean currents were once presumed to facilitate long distance dispersal
CONCLUSION
1) E. acoroides showed high level of genetic diversity.2) Four groups were identified represent western, eastern and central
Indonesia
This study is funded by PEER (the Partnerships for Enhanced Engagement inResearch, USAID
We thank Beginner Subhan, Dondy Arafat, Aji Wahyu Anggoro and Biosystematics,Widiastuti, Khalidin, Dita Cahyani, for their helps in sample collection.
We thank Mahardika, Astria Yusmalinda, Rizki Wulandari, Andrianus Sembiring,who had facilitated all the research works
My high gratitude to Australia Indonesia Institute for their support
ACKNOWLEDGEMENTS