Biochemical Systematics and Ecology 37 (2009) 146–153

Contents lists available at ScienceDirect

Biochemical Systematics and Ecology

journal homepage: www.elsevier .com/locate/biochemsyseco

Assessment of genetic diversity and population structure of Chinese wildalmond, Amygdalus nana, using EST- and genomic SSRs

Omirshat Tahan a,b,1, Yupeng Geng a,1, Liyan Zeng a, Shanshan Dong a, Fei Chen a, Jie Chen a,Zhiping Song a, Yang Zhong a,c,*

a Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, School of Life Sciences, Fudan University, Shanghai 200433, Chinab College of Forestry Sciences, Xinjiang Agricultural University, Shanghai, Chinac Shanghai Center for Bioinformation Technology, Shanghai, China

a r t i c l e i n f o

Article history:Received 15 July 2008Accepted 28 February 2009

Keywords:AlmondAmygdalus nanaESTSSRGenetic diversityPopulation structure

* Corresponding author at: School of Life ScienceE-mail address: yangzhong@fudan.edu.cn (Y. Zh

1 These authors contributed equally to this work

0305-1978/$ – see front matter � 2009 Elsevier Ltddoi:10.1016/j.bse.2009.02.006

a b s t r a c t

Amygdalus nana L., commonly known as wild almond, is an endangered wild relative ofcultivated almond, which has great potential in almond crop breeding. In this study, weused microsatellite (SSR) loci derived from both expressed sequence tag (EST) and anon-ymous genomic sequence to explore the genetic diversity and population structure of A.nana in Xinjiang of China. Seven natural populations were collected across the wholedistribution of A. nana in China, including populations from both inside (four populations)and outside (three populations) the established protected areas. A total of 22 and 19 alleleswere detected from the seven pairs of EST and genomic SSR loci, respectively. Generally,the genomic SSRs showed lower levels of variation than EST-SSRs, which may partially dueto the higher cross-species transferability in EST-SSRs than in genomic SSRs. The pop-ulation-level genetic diversity (A ¼ 1.84, P ¼ 50.00%, Ho ¼ 0.3491, HE ¼ 0.2271) was lowerthan cultivated almond and several wild fruit species with similar breeding system. Mostof the genetic variation (82.16%) was partitioned within populations. In particular, thepopulation collected from Tacheng County (outside the protected areas) had the highestlevels of genetic diversity and had significantly different genetic constitution from otherpopulations.

� 2009 Elsevier Ltd. All rights reserved.

1. Introduction

Almond (Amygdalus communis L. syn Prunus dulcis (Miller) D.A. Webb) is one of the most important nut crops worldwide,whose fruits are widely used in food production (Kester et al., 1991). Recent studies suggest that almonds are ideal antioxidantsource and can significantly reduce the oxidative DNA damage and lipid peroxidation caused by cigarette smoking (Li et al.,2007), indicating their great potentials in pharmaceutical industry. In 2006, the world production of almonds reached 1.74million tonnes (FAOSTAT Data). Almond is thought to have been domesticated in central and southwest Asia at least 3200years ago, although the direct progenitor of cultivated almond is still in debate (Ladizinsky, 1999). Amygdalus species, similarto the situation in Malus Miller and Pryus L., are characterized with gametophytic self-incompatibility and lack of repro-duction isolation among congeners (Ladizinsky, 1999; Gradziel et al., 2001). Accordingly, Amygdalus wild species are cross-fertile with almond cultivars, which can be used as important germplasm resources in almond breeding programs (Lopezet al., 2006).

s, Fudan University, Shanghai 200433, China. Tel.: þ86 21 55664436; fax: þ86 21 65642468.ong)..

. All rights reserved.

O. Tahan et al. / Biochemical Systematics and Ecology 37 (2009) 146–153 147

The wild almond, Amygdalus nana L. syn Prunus tenella Rehd. and A., is the north-most Amygdalus species, which hasa wide distribution from north Balkan to Kazakhstan (Ladizinsky, 1999). In China, A. nana is restricted to the northwestXinjiang Province, consisting of several isolated populations scattered in cold and xerophytic areas adjacent to Kazakhstan.These populations are traditionally regarded as the east-most distributions of A. nana (e.g. Flora of China, Lu and Bruce, 2003).However, they have also been identified as an independent species, i.e. Amygdalus ledebouriana Schlecht., because of theirdifferent morphology (i.e. relative larger leaves and fruits) and isolated distribution from other populations of A. nana(Ladizinsky, 1999). Regardless of the debatable taxonomic status, these Amygdalus populations are unique in their location inthe geographic center of Asia-Europe continent where the climate is cold and drought, and are especially useful for breedingstress-tolerant almond varieties. Unfortunately, these natural populations are increasingly declining because of habitatdegradation due to frequently drought, fire regime change, and over-grazing (Li et al., 2006). In 1980, a nature reserve wasestablished at Yumin County to protect A. nana near Mt. Baerkelu. Another small population of A. nana was later founded inGongliu Nature Reserve whose primary aim is to protect the wild walnut (i.e. Juglans regia L.) Presently, the populationslocated in Tacheng County, Tuoli County, and Habahe County are still not covered by any protected area.

Population genetics analyses can provide important data on the overall levels of genetic diversity, genetic structure,inbreeding coefficient, and effective population size, which are usually crucial for developing effective management strategiesin conservation and exploration of genetic resources (Monhammadi and Prasanna, 2003; Pertoldi et al., 2007). In previousstudies, various molecular markers have been used to examine the phylogenetic relationships between different almondcultivars and between cultivated almond and its wild congeners (Xu et al., 2004; Xie et al., 2006; Shiran et al., 2007; Sorkhehet al., 2007). However, genetic analyses of natural populations in wild Amygdalus species including A. nana have received littleattention.

Among various molecular markers, microsatellite markers (also known as simple-sequence repeats, SSRs) have increas-ingly been used in population genetics analyses because of their codominant and highly polymorphic nature (Selkoe andToonen, 2006). Recently, SSR derived from expressed sequence tag (hereafter referred to as EST-SSR) is increasingly used. TheEST-SSRs are superior to anonymous genomic SSR (hereafter referred to as genomic SSR) in functional diversity assessmentand interspecific transferability (Varshney et al., 2005), but have the risk of estimation bias for population genetic parametersdue to possible natural selection on marker loci (Ellis and Burke, 2007). In addition, genomic SSRs usually are more poly-morphic than EST-SSRs (Ellis and Burke, 2007; Varshney et al., 2005). Thus, it is preferable to use the two kinds of SSR markerscomplementarily in population genetic analyses. In this study, we used both EST-SSRs and genomic SSRs to examine thegenetic diversity and population structure of the natural population of A. nana in Xinjiang of China.

2. Materials and methods

2.1. Species and sampling procedure

A. nana is a deciduous shrub to 1.2–1.5 (2) m, growing on shady slopes and river valleys at 900–1200 m in altitude (Li et al.,2006). The plants have a compact habit, narrow leaves and pink flowers (Ladizinsky, 1999; Lu and Bruce, 2003). As well asreproducing sexually, A. nana also propagates vegetatively by suckering. It usually flowers from April to May, and producesfruits from June to July (Lu and Bruce, 2003). Five isolated distribution locations of A. nana have been founded in Xinjiang (Fig.1).The largest one occurs near Mt. Baerkelu inside the Yumin Nature Reserve. There is also a small population in the Gongliu NatureReserve. The other three occurs in a few valleys in Tacheng County, Tuoli County, and Habahe County near Altai Mountain,respectively (Li et al., 2006). In 2000, a huge forest fire happened to the Yumin Nature Reserve and destroyed nearly all ofstanding vegetations including A. nana. Fortunately, the underground roots helped many individuals of A. nana survive thedisaster although the aboveground biomass was damaged heavily. Field survey in 2005 confirmed that A. nana shrub hadrecovered its vegetation closeness to the similar levels as before the fire. In addition, most standing stems of A. nana were lessthan five years old, suggesting that they have sprouted from old roots or seed pool after the fire (Li et al., 2006).

In this study, seven populations of A. nana were sampled across all its geographic distributions in Xinjiang, China (Fig. 1,Table 1). For all populations, 29–30 individuals were collected, expect for the TC population where only ten samples wereavailable because of serious leaf infection by fungus in many individuals. Among these populations, three (YM, YN, and YE)were sampled from a few isolated valleys in the Yumin Nature Reserve and one population (GL) from the Gongliu NatureReserve. The other three populations (TL, TC, and AT) were sampled from Tuoli County, Tacheng County, and Habahe County,respectively. In addition, 39 individuals of two cultivars of A. communis, i.e. ZB (Zhipi) and ZW (Zaoshuboke), were alsoincluded in this study to provide primary information on genetic differentiation, and possible genetic introgression, betweencultivars and wild populations (Fig. 1, Table 1). A total of 227 individuals from the wild and cultivated almond were collected.Fresh leaves from each individual were used for DNA isolation. Total DNA was extracted from ground leaf powder according tothe cetyltrimethly ammonium bromide (CTAB) protocol (Doyle and Doyle, 1987).

2.2. Molecular and statistical analyses

According to published primers, eight EST-SSRs (Xu et al., 2004; Xie et al., 2006) and sixteen genomic SSRs (Testolin et al.,2004; Mnejja et al., 2005) developed for almonds were used to amplify microsatellite loci in A. nana. Seven of EST-SSRs andseven genomic SSRs that produced clear and reproducible products were selected for further analyses (Table 2). Polymerase

Fig. 1. Distributions of Amygdalus nana in China and locations of the seven populations sampled in this study. Four populations (GL, YM, YN, and YE) are collectedfrom the established nature reserves, while the other three (TC, TL, and AT) are still not covered by any protected area. For abbreviations of population names, seeTable 1.

O. Tahan et al. / Biochemical Systematics and Ecology 37 (2009) 146–153148

chain reaction amplification was conducted in a 20-ml reaction mixture containing 50 ng of template DNA, 1� PCR buffer,1.5 mM of Mg2þ, 0.2 mM of dNTPs, 0.4 mm of each primer and 1 Unit of Taq DNA polymerase (Takara). The PCR conditions wereset at 95 �C for 4 min, followed by 30 cycles of 94 �C for 45 s, 50–65 �C for 45 s, 72 �C for 45 s, and 10 min at 72 �C for the finalextension. PCR products were separated on a 6% denatured polyacrylamide gel. DNA fragments were revealed using the silverstaining procedure. Alleles were sized using a 25-bp ladders (Invitrogen).

Statistical analyses using various methods were performed to explore the genetic diversity and population differentiationwithin and among populations of A. nana and A. communis. For each method, analyses based on EST-SSRs, genomic SSRs, andcombined SSRs data were performed separately. In the case that different dataset produced consistent results, only thosebased on combined SSRs data were reported.

The genetic diversity of A. nana and A. communis were assessed using PopGene (Yeh et al., 2000). Various parameters werecalculated, including mean number of alleles per locus (A), proportion of polymorphic loci (P), observed heterozygosity (HO),expected heterozygosity (HE), and Shannon’s index of diversity (I). Wright’s F-statistics parameters, i.e. FST (subdivision amongpopulations) and FIS (inbreeding coefficient within populations) according to Weir and Cockerham’s (1984) estimates, werecalculated for each SSR locus using FSTAT 2.9.3.2 program (Goudet, 1995). Analysis of Molecular Variance (AMOVA) wasperformed to explore the genetic differentiation between A. nana and A. communis, and among different geographical groups(i.e. counties) of A. nana, using the program Arlequin2 (Schneider et al., 2000). Principal Coordinator (PCO) analysis wasperformed to visually examine the genetic relationship between A. nana and A. communis through two-dimensional diagram,

Table 1Details on sample locations of populations of Amygdalus nana and A. communis used in this study.

Species Region (county) Population ID Sample size (n) Location Altitude (m) Note

A. nana Yumin YM 30 45�550N, 82�320E 1150–1200 Yumin Nature ReserveYumin YN 29 45�560N, 82�350E 1185–1200Yumin YE 29 45�510N, 82�330E 1100–1110Gongliu GL 30 43�220N, 82�160E ca. 960 Gongliu Nature Reserve

Tacheng TC 10 46�570N, 83�120E 1090–1016 Not in any protected areaTuoli TL 30 46�080N, 83�310E 860–1006Habahe AT 30 48�170N, 86�340E 1110–1060

A. communis Shache ZB 19 38�250N, 77�160E ca. 1220 Cultivated accessionsShache ZW 20 38�250N, 77�160E ca. 1220

Table 2Characteristics of seven pairs of genomic and EST-SSR loci, including repeat motif, number of alleles, observed heterozygosity (HO), expected heterozygosity(HE), Wright’s F-statistics (FIS, FST) estimates from seven populations of A. nana collected from Xinjiang.

Locus Repeat motif No. alleles HO HE FIS FST Primer sequence

ESTASSR17 (GA)15 3 0.2366 0.2092 �0.3753 0.1878 F: GGACTGGACTGTGGATTGTT TTTG; R: AGTCATCCACCGTG CCAGTTTTAASSR46 (TA)12 5 0.9309 0.5972 �0.6737 0.0507 F: AATGGTCTATGAACACCTCTC; R: GAATACAAACGGGATTCAGASSR54 (TA)12 2 0.8722 0.4918 �0.8125 0.0128 F: CTTGGCTGGCTTCACTGC; R: CTATGCATTTATAAACTT GCAGAGASSR63 (GAT)5 2 0.0378 0.0371 �0.1373 0.1053 F:CACCAATTTATGTTGCAA GATTATATG; R:GTTTTAGATTTCACAGTA CTATGASSR70 (CT)24 2 0.1148 0.1082 �0.7076 0.3497 F: ACTGTTACTGAGCCATGAAGAAGA; R: GAGAAACAAAGAGACCCCAAGAAGASSR71 (GA)15 7 0.2717 0.5367 0.1045 0.5338 F: AACTTTGTCTGCCTCTCA TCTTA; R: AGCA GCCCATTTCTTCTCTTGASSR72 (TC)19 1 0.0000 0.0000 **** 0.0000 F: AAGTGGGATTGGTAGGGAGG AAG; R: CTACGGAGCCAGTTGA GAAAAGMean 3.14 0.3520 0.2829 �0.5510 0.2041

GenomicUDA-005 (AC)14 (TC)21 2 0.1459 0.1353 �0.3972 0.2045 F: CATCACACACAAACACAAAT GC; R: GCATTGTGCTCTTCATGG ACUDA-006 (CA)11 6 0.9626 0.6357 �0.6082 0.0789 F: ATTCTCCAAGGCGATAAGCA; R: TTAGGCACCTGTCCCCTA CAUDA-015 (CA)22 1 0.0000 0.0000 **** 0.0000 F: ACTCCATCGCTTGCATTTTC; R: GCTCCGTGTGTGTTTGTG TGUDA-023 (CT)11 (CA)21 6 0.9624 0.6892 �0.5617 0.1429 F: TTGCCGTGATACACTAACA ACT; R: ACCTGCCAAGTA AGTGCCTACPDCT005 (CT)14 1 0.0000 0.0000 **** 0.0000 F: TTCAAGGAGAAGGCCTGAAA; R: ATTGTGGGTTCCAACCAATGCPDCT016 (GA)19 1 0.0000 0.0000 **** 0.0000 F: GGAAACCTGATTAGGGCACTT; R: GGTCTGCTATACTGA CCTAGGATTCPDCT022 (CT)17 2 0.1957 0.1765 �0.4139 0.1950 F: TGATCGGCGTCTCCTTTATC; R: AAAGCAAGCAGGCAAATG AAMean 2.71 0.3238 0.2338 �0.5528 0.1288

O. Tahan et al. / Biochemical Systematics and Ecology 37 (2009) 146–153 149

using the program NTSYS-pc (Rohlf, 1998). Finally, a Bayesian clustering analysis was performed to detect possible geneticexchanges between A. nana and A. communis, using the program STRUCTURE (Pritchard et al., 2000). Specifically, the total 227individuals were assigned into two groups (K ¼ 2) to test whether the two groups were congruent with the two species. Theadmixture model was used, which allowed for analyzing admixture and correlated allele frequencies. Five independentsimulations were run, each with a burn-in of 100,000 generations and a subsequent Markov chain of 1,000,000 generations.In addition, STRUCTURE was further used to explore the population structure in A. nana. Specifically, the 188 individuals of A.nana were assigned into K subgroups, with K varied from 2 to 15. For each given K value, STRUCTURE estimates a modellikelihood function that measures the goodness of fit.

3. Results

3.1. Allelic variation of EST- and genomic SSRs

In A. nana, 22 and 19 alleles were detected from the seven EST and seven genomic loci, respectively. Generally, the genomicSSRs showed lower levels of variation than EST-SSRs (Table 2). Allelic variation (A) at the genomic SSRs ranged from 1 to 6(mean A¼ 2.71) and the EST-SSR loci from 1 to 7 (mean A¼ 3.14); for the combined SSR data, the global mean is 2.93 (Table 2).The mean expected heterozygosity (HE) per locus for genomic SSRs ranged from 0 to 0.6892 (mean¼ 0.2338). For EST-SSRs, HE

ranged from 0 to 0.5972 (mean ¼ 0.2829, Table 2). The EST-SSRs also showed higher genetic differentiation than the genomicSSRs (i.e. FST ranged from 0 to 0.5338 versus from 0 to 0.2045). For nine of 10 polymorphic SSR loci, the inbreeding coefficientprovided negative values (FIS < 0).

3.2. Genetic diversity of almonds

For each marker system, population level descriptive statistics are presented in Table 3. In A. nana, genomic SSRs hada higher number of alleles per locus but lower heterozygosity than EST-SSRs. For all marker systems, the four populations (GL,YM, YN, and YE) sampled from the protected areas showed comparable or even slightly lower levels of genetic diversity thanthe other three populations that are not under conservation (Table 3). Especially, the TC population showed highest diversityvalues among the seven populations of A. nana, although its sample size (n ¼ 10) was much smaller than other populations(n ¼ 29–30). In A. communis, EST-SSRs showed higher diversity than the genomic SSRs in all genetic diversity parameters. Forall marker systems, A. communis showed higher levels of genetic diversity than A. nana. In both species, the observedheterozygosity is higher than expected heterozygosity, suggesting that all populations showed significant deviations fromHardy–Weinberg expectations (Table 3).

3.3. Genetic relationship between wild and cultivated almonds

AMOVA suggested that nearly 50% of the total variation was partitioned among the two species (Table 4). Indeed, clusterresults of STRUCTURE suggested that the total 227 individuals were assigned into two distinct groups, which were congruentwith the two species A. nana and A. communis (Fig. 2). Similarly, PCO analysis also indicated no genetic introgression betweenthe two cultivars of A. communis and A. nana (Fig. 3).

Table 3Genetic variability parameters of seven populations of A. nana and two cultivars of A. communis based on 14 SSRs loci.

Population Genomic SSRs EST-SSRs Combined SSRs

A P HO HE A P HO HE A P HO HE

A. nanaGL 1.57 28.57 0.2857 0.1694 1.57 57.14 0.4213 0.2672 1.57 42.86 0.3535 0.2183YM 1.57 28.57 0.2857 0.1779 1.86 57.14 0.3545 0.2285 1.71 42.86 0.3201 0.2067YN 2.00 42.86 0.2808 0.1824 1.71 42.86 0.2727 0.1638 1.86 42.86 0.2767 0.1762YE 2.14 42.86 0.3744 0.2519 2.00 57.14 0.3103 0.2389 2.07 50.0 0.3424 0.2497TC 2.14 57.14 0.4810 0.3182 1.43 42.86 0.4286 0.2143 1.79 50.0 0.4548 0.2662TL 1.71 42.86 0.3378 0.2126 2.00 57.14 0.2995 0.2247 1.86 50.0 0.3186 0.2166AT 1.86 57.14 0.3302 0.2229 2.29 85.71 0.4847 0.3252 2.00 71.43 0.3779 0.2562Mean 1.86 42.86 0.3394 0.2193 1.84 57.144 0.3674 0.2375 1.84 50.00 0.3491 0.2271

A. communisZB 3.14 100 0.7285 0.4648 3.57 100 0.8722 0.5550 3.36 100 0.8003 0.5099ZW 3.43 100 0.8214 0.5613 3.71 100 0.9929 0.6353 3.57 100 0.9214 0.5944Mean 3.29 100 0.7750 0.5131 3.64 100 0.9326 0.5952 3.47 100 0.8609 0.5522

O. Tahan et al. / Biochemical Systematics and Ecology 37 (2009) 146–153150

3.4. Genetic differentiation among wild almond populations

For the seven populations of A. nana, more than 80% of the genetic variation was partitioned within populations (Table 4).Cluster analysis of A. nana using STRUCTURE indicated that the overall genetic profile of the seven populations can bedescribed with nine different hypothetical populations (i.e. K ¼ 9). It is notable that the individuals collected from Tacheng(TC) and Tuoli (TL) constituted two well-defined hypothetical populations, which showed little gene exchange with indi-viduals from other areas (Fig. 2). Similarly, individuals of TC and TL populations occupied different positions from those ofother populations in PCO space (Fig. 3).

4. Discussion

Recently, EST-SSRs have been increasingly used to assess the genetic diversity and population structure in both cultivatedand wild species (Ellis and Burke, 2007; Varshney et al., 2005). Previous studies have suggested that EST-SSRs are lesspolymorphic than their genomic counterparts in both crop species (Cho et al., 2000; Gupta et al., 2003; Chabane et al., 2005)and wild species (Woodhead et al., 2005). In this study, however, we detected more alleles and higher heterozygosity in EST-SSRs than in genomic SSRs (Table 2, Table 3). Such a result is unexpected as the expressed sequences are usually thought to bemore conserved and thus should lead to less polymorphism compared with anonymous sequences (Metzgar et al., 2000). Thereason underlying this unusual result remains not known. One possible explanation is that EST-SSRs have greater cross-species transferability than the genomic SSRs (Varshney et al., 2005; Ellis and Burke, 2007). As the SSR primers used in thisstudy are originally developed in cultivated almond, EST-SSRs may have higher potential in detecting genetic variation in thewild almond than the genomic SSRs. Specifically, in this study, six of the seven EST-SSRs produced more than one allele, whileonly four of the seven genomic SSRs were polymorphic (Table 2). Thus, a reasonable hypothesis is that the EST-SSRs are lessinsensitive to the confounding effects of possible null alleles (Ellis and Burke, 2007) and thus indicate higher levels of allelicvariation in A. nana.

Many fruit trees are characterized by self-incompatibility (i.e. outcrossing species) and thus may be expected to lead tohigher levels of genetic variation at population level, compared to other groups of plants (Hamrick et al., 1992; Nybom, 2004).In this study, however, we detected relatively low levels of genetic variation both at population and species levels for A. nanasampled from Xinjiang. For example, the expected heterozygosity (HE ¼ 0.271) in A. nana is lower than the reported averagevalue of long-lived perennial species (HE ¼ 0.68), outcrossing species (HE ¼ 0.65), and endemic species (HE ¼ 0.42) (Nybom,

Table 4Results of analysis of molecular variance (AMOVA) of seven populations of A. nana and two cultivars of A. communis based on 14 SSRs loci.

Source of variation d.f. Sum of squares Variance components Percentage of variation F-statistics P

A. nana and A. communisAmong species 1 315.103 2.28937 Va 47.23 FCT ¼ 0.47229 0.0264Among populationswithin species

7 160.745 0.40728 Vb 8.40 FSC ¼ 0.15922 <0.0001

Within populations 445 957.059 2.15069 Vc 44.37 FST ¼ 0.55631 <0.0001

A. nanaAmong groups (counties) 4 101.835 0.27960 Va 12.99 FCT ¼ 0.12994 0.0567Among populationswithin groups

2 15.765 0.10424Vb 4.84 FSC ¼ 0.05568 <0.0001

Within populations 369 652.371 1.76794Vc 82.16 FST ¼ 0.17838 <0.0001

Fig. 2. STRUCTURE bar plots of Amygdalus nana and A. communis from Xinjiang based on 14 SSR loci. The assignment results (K ¼ 2, above) indicate little geneexchange between A. nana and A. communis. The seven populations of A. nana can be described with nine different hypothetical genetic populations (K ¼ 9,below). Little gene exchange was detected between the populations collected from inside versus outside the protected areas.

O. Tahan et al. / Biochemical Systematics and Ecology 37 (2009) 146–153 151

2004), and also lower than other wild fruit trees such as Malus sylvestris (HE¼ 0.721), Malus sieversii (HE¼ 0.2619), and Prunusarmeniaca (HE¼ 0.287) (Coart et al., 2003; He et al., 2007; Zhang et al., 2007). The relatively low levels of genetic diversity maypartially result from the population declining in A. nana in Xinjiang. Notably, the genetic variation has been found to besignificantly correlated with population fitness (Booy et al., 2000), especially in self-incompatibility species (Leimu et al.,2006). Thus, the low levels of genetic diversity may further accelerate the population declining in A. nana. Further studies onthe genetic variation of functional loci (e.g. the S-locus that are responsible for the gametophytic self-incompatibility in A.nana) within populations may provide more insights.

Fig. 3. PCO results showing 188 individuals of Amygdalus nana from seven populations and 39 individuals of A. communis based on 14 SSR loci.

O. Tahan et al. / Biochemical Systematics and Ecology 37 (2009) 146–153152

A. nana in Xinjiang may not have contributed to the gene pools of modern cultivated almond. Currently available evidencesindicated that the domestication of A. communis could have been domesticated in Central Asia and various hybridizations mayhave involved in the long history of almond cultivation (Socias-i-Company, 1998). In this study, we detected little geneexchange between A. nana and A. communis (Fig. 2). Although only two cultivars were examined in this study, such argumentseems valid for other almond cultivars. For example, in a recent study, Xu et al. (2004) examined the phylogenetic rela-tionships among 36 almond cultivars and several wild relative species, and found that cultivated almond was more closedrelated to peach (Prunus persica (L.) Batsch.) than to wild related species including A. nana (syn. Prunus ledebourianaSchleche.). However, the absence of historical genetic introgression between A. nana and A. communis does not mean that A.nana is not important in future almond improvement programs. On the contrary, as Amygdalus species are cross-fertile, A.nana may represent novel and unexplored gene pools for almond breeding.

The designation of protected areas is of great value in the biodiversity conservation. The conservation of genetic diversity isespecially important for wild species that are potential genetic germplasm resources for crop breeding such as A. nana. Atpresent, there are two protected areas in Xinjiang that are related to natural populations of A. nana, i.e. the nature reserveslocated in Gongliu County and Yumin County. In this study, genetic analysis was performed for natural populations of A. nanacollected from both inside and outside the protected areas. Our results suggest that the population collected from TachengCounty (outside the protected areas) had the highest levels of genetic diversity and had significantly different geneticconstitution from other populations (Table 3, Figs. 2 and 3), which may deserve additional conservation efforts.

Acknowledgements

This study was supported by Shanghai Leading Academic Discipline Project (B111), Doctoral Fund of Ministry of Educationof China (200802461047), China Postdoctoral Science Foundation (200801171 and 20070410163), the National Infrastructureof Natural Resources for Science and Technology (2005DKA21403), and the National Talent Training Fund in Basic Research ofChina (J0630643).

References

Booy, G., Hendriks, R., Smulders, M., Groenendael, J., Vosman, B., 2000. Genetic diversity and the survival of populations. Plant Biol. 2, 379–395.Chabane, K., Ablett, G., Cordeiro, G., Valkoun, J., Henry, R., 2005. EST versus genomic derived microsatellite markers for genotyping wild and cultivated

barley. Genet. Resour. Crop Evol. 52, 903–909.Cho, Y., Ishii, T., Temnykh, S., Chen, X., Lipovich, L., McCouch, S., Park, W., Ayres, N., Cartinhour, S., 2000. Diversity of microsatellites derived from genomic

libraries and GenBank sequences in rice (Oryza sativa L.). Theor. Appl. Genet. 100, 713–722.Coart, E., Vekemans, X., Smulders, M., Wagner, I., Huylenbroeck, J., Bockstaele, E., Roldan-Ruiz, I., 2003. Genetic variation in the endangered wild apple

(Malus sylvestris (L.) Mill.) in Belgium as revealed by amplified fragment length polymorphism and microsatellite markers. Mol. Ecol. 12, 845–857.Doyle, J., Doyle, J., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 19, 11–15.Ellis, J., Burke, J., 2007. EST-SSRs as a resource for population genetic analyses. Heredity 99, 125–132.Goudet, J., 1995. FSTAT (Version 1.2): a computer program to calculate F-statistics. J. Hered. 86, 485–486.Gradziel, T., Martinez-Gomez, P., Dicenta, F., Kester, D., 2001. The utilization of related Prunus species for almond variety improvement. J. Am. Pomolog. Soc.

55, 100–108.Gupta, P., Rustgi, S., Sharma, S., Singh, R., Kumar, N., Balyan, H., 2003. Transferable EST-SSR markers for the study of polymorphism and genetic diversity in

bread wheat. Mol. Genet. Genomics 270, 315–323.Hamrick, J., Godt, M., Sherman-Broyles, S., 1992. Factors influencing levels of genetic diversity in woody plant species. New. For. 6, 95–124.He, T., Chen, X., Xu, Z., Gao, J., Lin, P., Liu, W., Liang, Q., Wu, Y., 2007. Using SSR markers to determine the population genetic structure of wild apricot (Prunus

armeniaca L.) in the Ily Valley of west China. Genet. Resour. Crop Evol. 54, 563–572.Kester, D., Gradziel, T., Graselly, C., 1991. Almonds (Prunus. In: Moore, J., Ballington, J. (Eds.), Genetic Resources of Temperate Fruit and Nut Crops. Intern. Soc.

Horticult. Sci., Wageningen, The Netherlands, pp. 701–758.Ladizinsky, G., 1999. On the origin of almond. Genet. Resour. Crop Evol. 46, 143–147.Leimu, R., Mutikainen, P., Koricheva, J., Fischer, M., 2006. How general are positive relationships between plant population size, fitness and genetic vari-

ation? J. Ecol. 94, 942–952.Li, J., Zeng, B., Luo, S., Li, H., Madaniyati, W., 2006. Protection and propagation of Amygdalus ledebouriana Schleche in China. Xinjiang Agri. Sci. 43, 61–62.Li, N., Xia, X., Chen, C., Blumberg, J., Song, Y., Zhang, W., Zhang, X., Ma, G., Chen, J., 2007. Almond consumption reduces oxidative DNA damage and lipid

peroxidation in male smokers. J. Nutr. 137, 2717–2722.Lopez, M., Vargas, F., Batlle, I., 2006. Self-(in)compatibility almond genotypes: a review. Euphytica 150, 1–16.Lu, L., Bruce, B., 2003. Amygdalus Linnaeus. Flora of China, vol. 9, pp. 391–395.Metzgar, D., Bytof, W., Wills, C., 2000. Selection against frameshift mutations limits microsatellite expansion in coding DNA. Genome Res. 10, 72–80.Mnejja, M., Garcia-Mas, J., Howad, W., Arus, P., 2005. Development and transportability across Prunus species of 42 polymorphic almond microsatellites.

Mol. Ecol. Notes 5, 531–535.Monhammadi, S., Prasanna, B., 2003. Analysis of genetic diversity in crop plants – salient statistical tools and considerations. Crop Sci. 43, 1235–1248.Nybom, H., 2004. Comparison of different nuclear DNA markers for estimating intraspecific genetic diversity in plants. Mol. Ecol. 13, 1143–1155.Pertoldi, C., Bijlsma, R., Loeschcke, V., 2007. Conservation genetics in a globally changing environment: present problems, paradoxes and future challenges.

Biodivers. Conserv. 16, 4147–4163.Pritchard, J., Stephens, M., Donnelly, P., 2000. Inference of population structure using multilocus genotypes data. Genetics 155, 945–959.Rohlf, F., 1998. NTSYSpc: Numerical Taxonomy and Multivariate Analysis System, Version 2.02. Exeter Software, Setauket, New York, USA.Schneider, S., Roessli, D., Excoffier, L., 2000. ARLEQUIN Version 2000. A Software for Population Genetics Data Analysis. Genetics and Biometry Laboratory,

University of Geneva, Switzerland.Selkoe, K., Toonen, R., 2006. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol. Lett. 9, 615–629.Shiran, B., Amirbakhtiar, N., Kiani, S., Mohammadi, S., Sayed-Tabatabaei, B., Moradi, H., 2007. Molecular characterization and genetic relationship among

almond cultivars assessed by RAPD and SSR markers. Sci. Hortic. – Amst. 111, 280–292.Socias-i-Company, R., 1998. Fruit tree genetics at a turning point: the almond example. Theor. Appl. Genet. 96, 588–601.

O. Tahan et al. / Biochemical Systematics and Ecology 37 (2009) 146–153 153

Sorkheh, K., Shiran, B., Gradziel, T., Epperson, B., Martinez-Gomez, P., Asadi, E., 2007. Amplified fragment length polymorphism as a tool for molecularcharacterization of almond germplasm: genetic diversity among cultivated genotypes and related wild species of almond, and its relationships withagronomic traits. Euphytica 156, 327–344.

Testolin, R., Messina, R., Lain, O., Marrazzo, M., Huang, W.G., Cipriani, G., 2004. Microsatellites isolated in almond from an AC-repeat enriched library. Mol.Ecol. Notes 4, 459–461.

Varshney, R., Graner, A., Sorrells, M., 2005. Genic microsatellite markers in plants: features and applications. Trends Biotechnol. 23, 48–55.Weir, B.S., Cockerham, C.C., 1984. Estimating F-Statistics for the analysis of population structure. Evolution. 38, 1358–1370.Woodhead, M., Russell, J., Squirrell, J., Hollingsworth, P., Mackenzie, K., Gibby, M., Powell, W., 2005. Comparative analysis of population genetic structure in

Athyrium distentifolium (Pteridophyta) using AFLPs and SSRs from anonymous and transcribed gene regions. Mol. Ecol. 14, 1681–1695.Xie, H., Sui, Y., Chang, F., Xu, Y., Ma, R., 2006. SSR allelic variation in almond (Prunus dulcis Mill.). Theor. Appl. Genet. 112, 366–372.Xu, Y., Ma, R., Xie, H., Liu, J., Cao, M., 2004. Development of SSR markers for the phylogenetic analysis of almond trees from China and the Mediterranean

region. Genome 47, 1091–1104.Yeh, F.C., Yang, R., Boyle, T.J., Ye, Z., Xiyan, J.M., 2000. PopGene32, Microsoft Windows-based Freeware for Population Genetic Analysis, Version 1.32.

Molecular Biology and Biotechnology Centre, University of Alberta, Edmonton, Alberta, Canada.Zhang, C., Chen, X., He, T., Liu, X., Feng, T., Yuan, Z., 2007. Genetic structure of Malus sieversii population from Xinjiang, China, revealed by SSR markers. J.

Genet. Genomics 34, 947–955.