ORIGINAL PAPER

K. Luenser J. Fickel A. Lehnen S. SpeckA. Ludwig

Low level of genetic variability in European bisons (Bison bonasus)from the Bialowieza National Park in Poland

Received: 20 December 2004 / Accepted: 25 January 2005 / Published online: 15 March 2005 Springer-Verlag 2005

Abstract Nuclear DNA markers (microsatellites) wereused to screen the genetic variability in the Europeanbison population of the Bialowieza National Park, Po-land. The species is listed as endangered and the Bial-owieza population is the largest one worldwide. Manyother herds were founded by individuals from Bial-owieza. Out of 18 microsatellites, nine were polymor-phic, five were found to be homozygous, and four locidid not amplify. No significant deviation from HardyWeinberg-equilibrium (HWE) was observed, and theaverage number of alleles was 2.3 per locus. Thus, theEuropean bison is characterized by a very low level ofgenetic diversity, most likely resulting from the popula-tion decline in the nineteenth century. Nevertheless,allelic variability derived from the nine polymorphic lociestablished in this study allowed to identify each indi-vidual by its genotypic profile. This data is valuable forconservation plans of this impressive species, especiallyfor the control of breeding success in these animals.

Keywords Inbreeding Microsatellites Pedigreeanalysis STR genotyping

Introduction

The European bison (Bison bonasus Linnaeus,1758)the largest herbivore in Europeis an earlyPostglacial immigrant. The oldest European evidencecomes from sites in North Central Europe and SouthScandinavia dating back to the Preboreal. During theMid- and Late Holocene, European bison was widelydistributed on the European continent. Its range ex-tended from France in the West to the Ukraine andRussia in the East. Except for an area comprising EastPoland, Belarus, Lithuania and Latvia, European bisonwas a rare species in most regions of its range. In theMiddle Ages, there is a shrinkage of the range of wisentin its western parts resulting from habitat fragmentationand overhunting. The archaeozoological records of thistime show that European bison obviously became a veryrare species in the western part of its former CentralEuropean range after the tenth century and finally gotextinct there, while in East Europe its distribution re-mained more or less unchanged. High frequencies ofEuropean bison among the bone finds have been re-ported from Late Holocene sites in East Poland, Bela-rus, Lithuania, and Latvia. At many sites of this region,its bones constitute more than 20% of the remains ofwild ungulates. In contrast, European bison is onlyrepresented by single records in most of the assem-blages from Central and Southeast Europe (reviewed inBenecke 2005).

Owing to its status as preferred game species, mostEast European bison populations collapsed during lastcentury. In succession of World War I and the RussianCivil War in 1917 only two relict populations survived,one in the Bialowieza forest (Poland) and one in theCaucasian Mountains. However, even these populationscollapsed during the 1920s; the last wild Europeanbison was shot in Poland in 1919 followed by the lastCaucasian animal in 1925.

After the World War I, survival of the species wassecured only in few European zoological gardens

K. Luenser J. Fickel A. Ludwig (&)Department of Evolutionary Genetics,Leibniz-Institute for Zoo- and Wildlife Research,10252 Berlin, GermanyE-mail: Ludwig@izw-berlin.deTel.: +49-30-5168206Fax: +49-30-5126104

A. Lehnen S. SpeckDepartment of Wildlife Medicine,Leibniz-Institute for Zoo- and Wildlife Research,10252 Berlin, Germany

A. LudwigLeibniz-Institut fur Zoo- und Wildtierforschung,FG Evolutionsgenetik, Alfred-Kowalke-Str. 17,10315 Berlin, Germany

Eur J Wildl Res (2005) 51: 8487DOI 10.1007/s10344-005-0081-4

(Sztolcman 1924). In total, only 54 individuals withproved pedigrees remained (29 males and 25 females),originating from 12 founder animals (Slatis 1960; Rac-zynski 1978; Pucek 1991). After a period of intensivebreeding in zoological gardens, the first animals werereleased in 1952 into the Bialowieza National Park,which is the core of the Bialowieza Primeval Forest,stretching across eastern Poland and western Belarus.With approximately 540 animals, the Bialowieza bisonpopulation is the largest globally (Kita et al. 2003;European Bison Pedigree Book - EBPB 2001). In 2000,2864 individuals were registered worldwide (EBPB 2001;Hilton-Taylor 2000). Currently, the European bison islisted as endangered (EN A2ce, C2a) in the IUCN RedList of Threatened Species (http://www.redlist.org,2004).

Seven hundred individuals of uncertain pedigree,which are suspected to have been crossbreds or intro-gressed by domestic cattle or American bison, Bisonbison (Ward et al. 1999), are not listed in the EBPB.Although representing a large bison gene pool, theseanimals are unfortunately of no value for the conser-vation of European bison. Despite a raised stock, theEuropean bison is still on the brink of extinction due toincreased inbreeding as a consequence of the very recentbottleneck.

Inbreeding occurs by reproduction of related indi-viduals sharing one or more common ancestors (Oo-sterhout et al. 2000). Such mating concentrates similaralleles in the offspring, and if continued, also in thewhole population. In cases of deleterious recessive al-leles, inbreeding will coincide with a reduction of themean phenotypic value shown by characters connectedwith reproductive capacity or physiological efficiency(Falconer and Mackay 1996). Consequently, the loss ofgenetic and phenotypic plasticity becomes more influ-ential in highly endangered species which are as perdefinition already below a critical population sizethreshold and thus very susceptible to environmental

changes. The impact of inbreeding depends mainly onthe effective population size (number of breeders pergeneration time). Recognizing these causalities, it be-comes common practice to include pedigree analyses inmanagement programs to conserve as much geneticvariability as possible and to control the reproductivesuccess of the different breeders.

Therefore, our study focused on the adaptation ofdomestic cattle microsatellite loci to develop amethod to facilitate the individual identification of eachspecimen using genetic markers.

Methods

Samples

Thirty-eight animals (20 males, 18 females), randomly ofage, were sampled during hunting seasons from 2001 to2004. Depending on ambient temperature, culling nor-mally started in November and ended in March or April.Only samples from the Polish part of the National parkwere available depending on political conditions.

Microsatellites

All 18 investigated microsatellite loci were originallydeveloped for pedigree analyses in domestic cattle. Pri-mer sequences and annealing-temperatures of the ninepolymorphic successfully amplified loci are listed inTable 1. Detailed locus information can be retrievedfrom the BOVMAP database. The PCR reaction wascarried out in a total volume of 25 ll. Amplificationconsisted of 35 cycles of each composed of 45 s at 95C(denaturation), 45 s at specific annealing temperature(Table 1), and 30 s at 72C (extension) in the presence of2.0 mM MgCl2 and 1.25 U of Taq polymerase (Roche).Loci from which polymorphic PCR products were

Table 1 Microsatellite loci,respective primer sequences(forw forward primer; revreverse primer), and annealingtemperatures (Ta) ofpolymorphic loci

Locus Primers Annealingtemperature (C)

BTJAB1 forw: CATTAAGGGCTGGGATTCCT 60forw: AGATTTCTGGAGGAGGCTCACAGCA

BOVIRBP forw: TGTATGATCACCTTCTATGCTTC 60forw: GCTTTAGGTAATCATCAGATAGC

BM6438 forw: TTGAGCACAGACACAGACTGG 60forw:ACTGAATGCCTCCTTTGTGC

BM2830 forw: AATGGGCGTATAAACACAGATG 50rev: TGAGTCCTGTCACCATCAGC

BM1225 forw: TTTCTCAACAGAGGTGTCCAC 50rev: ACCCCTATCACCATGCTCTG

BM1818 forw: AGCTGGGAATATAACCAAAGG 50rev: AAGTGCTTTCAAGGTCCATGC

TGLA122 forw: CCCTCCTCCAGGTAAATCAGC 50rev: AATCACATGGCAAATAAGTACATAC

TGLA126 forw: TTGGTCTCTATTCTCTGAATATTCC 50rev: TTGGTCTCTATTCTCTGAATATTCC

ETH10 forw: GTTCAGGACTGGCCCTGCTAACA 50rev: CCTCCAGCCCACTTTCTCTTCTC

85

obtained were identified by capillary electrophoresis onan ABI 3100 Genetic Analyzer (Applied Biosystems).PCR products of polymorphic loci were sequencedbidirectionally using the same primers as for amplifica-tion (BigDye cycle sequencing kit, Applied Biosystems,Weiterstadt, Germany), and also analysed on an ABI3100 Genetic Analyzer (Applied Biosystems).

Statistical analysis

We tested for genotypic disequilibria and calculatednumbers of alleles per locus (N a), observed (H o) andcalculated expected heterozygocity (H e) using GENE-POP3.1c (Raymond and Rousset 1995). We also testedfor HardyWeinberg equilibria genotypic proportions(HWE) using a Markov chain approach (5,000 de-memorization steps, 1,000 batches, 5,000 iterations perbatch) implemented in GENEPOP. We also applied amultisample score test (Raymond and Rousset 1995) totest for either heterozygote deficit or excess and to assessthe significance of deviations from HWE.

Results and discussion

Despite the large number of loci investigated, only nineproved to be polymorphic (Table 1). The following fiveloci were found to be monomorphic: BL42, BTJAB3,BM2113, BM203, BM4107. Four loci (VH110, BM1824,TGLA227, BOVILS65) did not amplify in Europeanbison.

Alleles per polymorphic locus and individual are lis-ted in Table 2. Comparison of observed (Ho) and ex-pected heterozygosity (He) showed no significantdeviation from HardyWeinberg-equilibrium (HWE)(Table 2). BTJAB, with four alleles, was the mostpolymorphic locus, but the average of only 2.3 allelesacross all loci indicated a very low degree of allelicvariability. However, such low level of genetic diversity,as seen in the European bison, is extreme, especially incomparison to its sister species, the American bison(Bison bison). Similar to its European relative, the

American bison also decreased drastically from millionsof animals to approximately 300 individuals in the late1800s (Coder 1975; Dary 1989). Nevertheless, the num-ber of alleles per locus, measured at 15 microsatellites,ranged from 5 to 16 (Schnabel et al. 2000). For theEuropean bison population, the bottleneck was evenmore severe. Only 54 individuals stemming from 12founder animals were available for restoration (Slatis1960; Raczynski 1978; Pucek 1991), thus the observedlow level of genetic variability is not surprising.

In small populations, even though individuals maymate randomly, loss of genetic diversity is unavoidabledue to genetic drift and the increased probability ofmating between related individuals (inbreeding). A ma-jor consequence of inbreeding is depression caused byfixation of deleterious alleles (Frankham et al. 2002).Because selection acts against them, such deleteriousalleles exist only in small frequencies in each population.Decline of effective population size, however, increasestheir chance to become influential. The loss of geneticvariability also results in an overall increase in homo-zygosity. This homogenization can reduce fitnessparameters such as reproduction. However, reproduc-tion success of the Bialowieza population during the last21 years was impressive. The population grew from 13to 540 animals (Pucek et al. 2004). Obviously, there is noevidence for fecundity or fertility losses. A similarobservation was already made in the 1950s by examiningpopulation dynamics and relatedness in the Bialowiezapopulation (Slatis 1960). Nevertheless, inbreeding mayhave favoured manifestation of balanoposthitis, an ill-ness affecting the reproduction capacity of bulls. In1980, first indications of a new imminence to the bisonpopulation appeared: two bulls were diagnosed withbalanoposthitis, a disease characterized by inflammationof external genital organs including the penis prepuce.The clinical signs and lesions were described severaltimes by Polish investigators (Kita et al. 1990; Piusinskiet al. 1997). Between 1980 and 1997, 133 diseased maleswere identified in the Bialowieza population (Jakob et al.2000). With progressing stage of the illness, there is thechance for the infected bulls to reproduce plummets. Inaddition, lot of males with urogenital disorder were

Table 2 Characteristics of nine polymorphic microsatellite locimeasured in a sample of 38 European bisons from BialowiezaNational Park (Poland): number of alleles per locus (N a), ob-served (Ho) and expected heterozygosity (He), detected allele

sizes in base pairs (bp), and estimated frequency in %. None ofthe loci investigated showed significant deviations from HardyWeinberg-equilibrium (P > 0.05)

Locus Na Ho He Allelic size in bp (frequency in %)

ETH10 3 0.632 0.638 208 (0.329), 210 (0.171), 212 (0.500)BM1818 2 0.500 0.478 260 (0.605), 264 (0.395)TGLA126 3 0.500 0.518 111 (0.237), 115 (0.671), 122 (0.092)TGLA122 2 0.289 0.251 140 (0.855), 164 (0.145)BM1225 3 0.568 0.663 254 (0.446), 258 (0.257), 260 (0.297)BM2830 3 0.737 0.638 143 (0.224), 153 (0.487), 163 (0.289)BTJAB1 4 0.421 0.351 206 (0.013), 218 (0.171), 224 (0.790),

228 (0.026)BOVIREP 2 0.474 0.505 126 (0.526), 142 (0.474)BM6438 2 0.432 0.520 264 (0.513), 274 (0.487)

86

culled. Therefore, most of the diseased individuals donot participate in reproduction.

There are strong theoretical reasons to suspect thatinbreeding and concomitant loss of genetic diversityreduces the ability of populations to cope with disease(O Brien and Evermann 1988; Sorci et al. 1997;Frankham et al. 2002). Inbreeding and low heterozy-gosity have been associated with decrease in resistance toinfectious pathogens in plants and animals (Fergusonand Drahushchak 1990; Clay and Kover 1996; Coltmanet al. 1999). On the basis of the increased frequency ofbalanoposthitis affecting the Bialowieza population andthe bottleneck responsible for the detected low geneticdiversity, we propose that this disease has a geneticpredisposition most likely resulting from the fixation ofa deleterious recessive allele. Further investigationsof loci involved in immune defence are necessary in or-der to investigate genetic factors contributing tobalanoposthitis.

For management plans and the future conservationof this impressive species, a control of breeding successof each individual is proposed. Genetic markers used inthis study render such genetic management of theBialowieza population possible for the first time. Byusing the combination of loci shown in Table 1, indi-vidual genotyping as well as parentage determination ispracticable now.

Acknowledgments We thank our cooperative partners in Poland forproviding samples: M. Krasinska and Z. Krasinski as well as manyhunters, veterinarians, and scientists for their support. We aregrateful to G. Wibbelt and K. Frolich for their helpful discussions,to A. Schmidt for technical assistance, to C. Kuhn for geneticmarker information as well as to two anonymous referees, and W.Lutz for his helpful comments on an earlier draft. We also thank N.Benecke for providing us with his submitted manuscript. The au-thors declare that the experiments comply with the current laws inGermany.

References

Benecke N (2005) The Holocene distribution of European bi-sonthe archaeozoological record. Munibe (in press)

Clay K, Kover PX (1996) The red queen hypothesis and plant/pathogen interactions. Annu Rev Phytopathol 34:2950

Coder GD (1975) The national movement to preserve the Ameri-can buffalo in the United States and Canada between 1880 and1920. Ph.D. dissertation, The Ohio State University, OH

Coltman DW, Pilkington JG, Smith JM, Pemberton JM (1999)Parasite-mediated selection against inbred Soay sheep in a free-living island population. Evolution 53:12591267

Dary DA (1989) The buffalo book. The Swallow Press Inc., Chi-cago

EBPB (2001) European bison pedigree book 2000. BialowiezaNational Park, Bialowieza Poland

Falconer DS, Mackay TFC (1996) Introduction to quantitativegenetics. Longman, Harlow

Ferguson MM, Drahushchak LR (1990) Disease resistance andenzyme heterozygosity in rainbow trout. Heredity 64:413417

Frankham R, Briscoe DA, Ballou JD (2002) Introduction to con-servation genetics. Cambridge University Press, Cambridge

Hilton-Taylor C (2000) IUCN red list of threatened species. IUCN,Gland Switzerland

Jakob W, Schroder HD, Rudolph M, Krasinski ZA, Krasinska M,Wolf O, Lange A, Cooper JE, Frolich K (2000) Necrobacillosisin free-living male European bison in Poland. J Wildl Dis36:248256

Kita J, Dziaba K, Piusinski W, Anusz K, Lenartowicz Z, KowalskiB, Krasinski ZA, Krupa J, Lesniewski S (1990) A disease ofgenital organs of free-roaming male European bison in the Bi-alowieza Primaval Forest (In Polish with English summary).Medycyna Weterynaryjna 46:474476

Kita J, Anusz K, Zaleska M, Malicka E, Bielecki W, Osinska B,Kowalski B, Krasinski Z, Demiaszkiewicz A, Rhyan J, Koli-pinski M (2003) Relationships among ecology, demographyand diseases of European bison (Bison bonasus). Pol J Vet Sci6:261266

OBrien SJ, Evermann JF (1988) Interactive influence of infectiousdisease and genetic diversity in natural populations. TrendsEcol Evol 3:254259

Oosterhout van C, Zijlstra WG, van Heuven MK, Brakefield PM(2000) Inbreeding depression and genetic load in laboratorymetapopulations of the butterfly Bicyclus anynana. Evol IntJ Org Evol 54:218225

Piusinski W, Bielecki W, Malecka E, Kita J, Dziaba K, Osinska B,Anusz k, Kowalski B, Lenartowicz-Kubrat Z (1997) Patomor-phology and pathogenesis of diseased genital organs (prepuceand penis) of bison in the Bialowieza Forest. Medycyna Wet-erynaryjna 53:596600

Pucek Z (1991) History of the European bison and problems of itsprotection and management. In: Bobeck B, Perzanowski K,Regelin W (ed) Global trends in wildlife management. Trans18th IUGB Congress. Swiat Press, Krakow-Warsaw, pp 1939

Pucek Z, Belousova P, Krasinska M, Krasinski ZA, Olech W(2004) Status survey and conservation action plan: europeanbison. IUCN, Gland Switzerland

Raczynski J (1978) Zubr [ European Bison]. Panstwowe Wydaw-nictwo Rolnicze i Lesne, Warsaw Poland, pp 1246

Raymond M, Rousset F (1995) GENEPOP (v.1.2): populationgenetics software for exact test and ecumenicism. J Hered86:248249

Schnabel RD, Ward TJ, Derr JN (2000) Validation of 15 micro-satellites for parentage testing in North American bison, Bisonbison and domestic cattle. Anim Genet 31:360366

Slatis HM (1960) An analysis of inbreeding in the European bison.Genetics 45:275287

Sorci G, Moller AP, Boulinier T (1997) Genetics of hostparasiteinteraction. Trends Ecol Evol 12:196199

Sztolcman J (1924) Materiaux pour lhistoire naturelle et pourlhistorique du Bison dEurope (Bison bonasus Linn.). AnnalesZoologoco Musei Polonici Historiae Naturalis 2:49136

Ward TJ, Bielawski JP, Davis SK, Templeton JW, Derr JN (1999)Identification of domestic cattle hybrids in wild cattle and bisonspecies: a general approach using mtDNA markers and theparametric bootstrap. Anim Conserv 2:5157

87

Sec1Sec2Sec3Sec4Tab1Sec5Sec6Tab2AckBibCR1CR2CR3CR4CR5CR6CR7CR8CR9CR10CR11CR12CR13CR14CR15CR16CR17CR18CR19CR20CR21CR22CR23CR24CR25