Art science practices and collaborations in bangalore, india

35
Open Source ArtScience practices and collaborations in Bangalore, India Yashas Shetty (Art)ScienceBLR

Transcript of Art science practices and collaborations in bangalore, india

Page 1: Art science practices and collaborations in bangalore, india

Open Source ArtScience practices and collaborations in Bangalore,

IndiaYashas Shetty

(Art)ScienceBLR

Page 2: Art science practices and collaborations in bangalore, india

Bangalore,India

Page 3: Art science practices and collaborations in bangalore, india
Page 4: Art science practices and collaborations in bangalore, india
Page 5: Art science practices and collaborations in bangalore, india

Indian Institute of Science

Page 6: Art science practices and collaborations in bangalore, india

Infosys campus

Page 7: Art science practices and collaborations in bangalore, india

Srishti School of Art, Design and Technology

Page 8: Art science practices and collaborations in bangalore, india

Srishti School of Art, Design and Technology

Page 9: Art science practices and collaborations in bangalore, india

(Art)ScienceBLR

Page 10: Art science practices and collaborations in bangalore, india

National Center for Biological Sciences

Page 11: Art science practices and collaborations in bangalore, india
Page 12: Art science practices and collaborations in bangalore, india

International Genetically Engineered Machines competion

Page 13: Art science practices and collaborations in bangalore, india
Page 14: Art science practices and collaborations in bangalore, india
Page 15: Art science practices and collaborations in bangalore, india
Page 16: Art science practices and collaborations in bangalore, india
Page 17: Art science practices and collaborations in bangalore, india

Teenage Gene Poems(2009)

Page 18: Art science practices and collaborations in bangalore, india

BBa_K221000 Teenage gene Poems(2009)

• atgacgcaacagcccttccaactcccgcacttctacctgccgcaccccgcacggctcaacccgcatctcgacgaggcccgcgcccactcgacgacgtggg cgcgcgagatgggcatgctggagggctccggggtctgggagcagtccgacctcgaagcccacgactacggcctgctctgcgcctacacccaccccgactg cgacgggccggcgctctccctcatcaccgactggtacgtgtgggtcttcttcttcgacgaccacttcctggagaagtacaaacgcagccaggaccgcctc gccggcaaggcccacctggaccggctcccgctgttcatgccgctcgacgacgccgccgggatgcccgagccgcggaacccggtggaggccggactcgccg acctgtggacccgcacggtgcccgcgatgtcggccgactggcgccgccgcttcgccgtcgccaccgagcacctcctcaacgagtccatgtgggagctgtc caacatcaacgaggggcgggtcgccaacccggtcgagtacatcgagatgcgccgcaaggtcggcggcgccccgtggtcggccgggctcgtggagtacgcg accgccgaggtgcccgccgccgtcgccgggaccaggccgctcagggtgctgatggagacgttctccgacgccgtgcacctgcgcaacgacctcttctcct accagcgcgaggtcgaggacgagggcgagctgagcaacggggtgctggtgttggagaccttcttcggctgcaccacccaggaggccgccgacctggtcaa cgacgtcctcacctcgcggctgcaccagttcgagcacaccgcgttcaccgaggtgcccgccgtcgccctggagaagggcctgaccccgttggaggtcgcc gccgtcggcgcgtacacgaagggcctccaggactggcagtccggcggccacgagtggcacatgcgttccagccgctacatgaacaagggggagcggcccc tggccggctggcaggcgctgaccgggcccggcacctccgcggcggacgtgggagcactgctcgccgacgcggtcgcccaacgggcccgctcctacacg

Page 19: Art science practices and collaborations in bangalore, india

Synthetic/Post Natural Ecologies(2010)

Page 20: Art science practices and collaborations in bangalore, india

DIY LAB equipment

Page 21: Art science practices and collaborations in bangalore, india

DIY Lab Equipment

Page 22: Art science practices and collaborations in bangalore, india

Autonomous Public Lab

Page 23: Art science practices and collaborations in bangalore, india

Searching for Genetically Engineered Machines(2011)

Page 24: Art science practices and collaborations in bangalore, india

Searching for Genetically Engineered Machines(2011)

Page 25: Art science practices and collaborations in bangalore, india

Searching for Genetically Engineered Machines(2011)

Page 26: Art science practices and collaborations in bangalore, india
Page 27: Art science practices and collaborations in bangalore, india

Searching for Genetically Engineered Machines(2011)

Page 28: Art science practices and collaborations in bangalore, india

Biodesign for the Real World

LifePatch(Indonesia) + ArtScienceBLR(India) + EPFL(Swiss)

Page 29: Art science practices and collaborations in bangalore, india

Metamap.in

Page 30: Art science practices and collaborations in bangalore, india

SeasonWatch.in

National Center for Biological Sciences, Bangalore

Page 31: Art science practices and collaborations in bangalore, india

Migrantwatch.in

National Center for Biological Sciences, Bangalore

Page 32: Art science practices and collaborations in bangalore, india

GubbiLabs.in

Page 33: Art science practices and collaborations in bangalore, india

India’s most famous DIY hacker

Page 34: Art science practices and collaborations in bangalore, india
Page 35: Art science practices and collaborations in bangalore, india

Thank you

• Dr. Mukund Thattai, NCBS• Dr. Geetha Narayanan, Srishti• Dr. Marc Dusseiller, Dusjagr Labs, Hackteria• Dr. Sachiko Hirosue, EPFL• LifePatch