Arabidiopsis Thaliana CBF 1 Encodes an AP2

7/24/2019 Arabidiopsis Thaliana CBF 1 Encodes an AP2

1/6

Proc. Natl. Acad. Sci. USAVol. 94, pp. 10351040, February 1997Plant Biology

Arabidopsis thaliana CBF1 encodes an AP2 domain-containingtranscriptional activator that binds to the C-repeatDRE, acis-acting DNA regulatory element that stimulates transcriptionin response to low temperature and water deficit

(cold acclimationCOR genesdrought stresssignal transductionyeast)

ERICJ. STOCKINGER*, SARAHJ. GILMOUR*, ANDMICHAELF. THOMASHOW*

Departments of *Crop and Soil Sciences and Microbiology, Michigan State Un iversity, East Lansing, MI 48824

Communicated by Clarence A. Ryan, Washington State University, Pullman, WA, November 27, 1996 (received for review August 12, 1996)

ABSTR ACT Recent efforts have defined a cis-acting DNAregulatory element in plants, the C-repeatdehydration re-sponsive element (DRE), that stimulates transcription inresponse to low temperature and water deficit. Here we reportthe isolation of an Arabidopsis thaliana cDNA that encodes aC-repeatDRE binding factor, CBF1 (C-repeatDRE BindingFactor1). Analysis of the deduced CBF1 amino acid sequence

indicates that the protein has a molecular mass of 24 kDa, apotential nuclear localization sequence, and a possible acidicactivation domain. CBF1 also has an AP2 domain, which is aDNA-binding motif of about 60 aa present in the Arabidopsisproteins APETALA2, AINTEGUMENTA, and TINY; the to-bacco ethylene response element binding proteins; and nu-merous other plant proteins of unknown function. The tran-script levels forCBF1, which appears to be a single or low copynumber gene, did not change appreciably in plants exposed tolow temperature or in detached leaves subjected to waterdeficit. Binding of CBF1 to the C-repeatDRE was demon-strated in gel shift assays using recombinant CBF1 proteinexpressed inEscherichia coli. Moreover, expression of CBF1 inyeast was found to activate transcription of reporter genescontaining the C-repeatDRE as an upstream activator se-

quence but not mutant versions of the DNA element. Weconclude that CBF1 can function as a transcriptional activa-tor that binds to the C-repeatDRE DNA regulatory elementand, thus, is likely to have a role in cold- and dehydration-regulated gene expression in Arabidopsis.

Freezing temperatures and drought are two adverse environ-mental conditions that limit the geographical distribution ofplants and account for significant reductions in the yields ofagriculturally important crops. Consequently, considerableeffort has been directed at determining the nature of freezingand drought injury and the protection mechanisms plants haveevolved that increase tolerance for these environmentalstresses. Significantly, these studies have revealed that freez-ing injury is largely a consequence of freeze-induced dehydra-

tion (1). Thus, freezing and drought tolerance might havecertain protective mechanisms in common. Indeed, it has beenobserved that some plants increase in freezing tolerance inresponse to dehydration stress (2, 3). The molecular basis ofthis cross-protection is not fully understood but appears toinclude the expression of common genes. For instance, certainCOR (cold-regulated) genes of Arabidopsis thaliana that en-code novel hydrophilic polypeptides, such as COR15a and

COR78, are induced during cold acclimation, the processwhereby plants increase in freezing tolerance in response tolow nonfreezing temperatures, and are up-regulated in re-sponse to water deficit (4). It has been hypothesized that theseand other COR genes might help plant cells tolerate thepotentially damaging effects of dehydration associated withfreezing and drought (4). Indeed, recent studies indicate that

constitutive expression of COR15a, which encodes a chloro-plast-targeted polypeptide, enhances the freezing tolerance ofchloroplasts and has multiple effects on the freezing toleranceof plasma membranes (5).

A major goal now is to determine how plants sense lowtemperature and water deficit and process this information toalter gene expression. An important advance in this regard wasthe recent identification of the C-repeatdehydration respon-sive element (DRE) cis-acting DNA regulatory element (6 8).The element, which has a 5-bp core sequence of CCGAC,designated theC-repeat (7), is present in oneto multiplecopiesin the promoters of many cold-regulated plant genes, includingtheArabidopsisgenesCOR15a(7) andCOR78RD29A(ref. 6;COR78and RD29Aare alternative designations for the samegene) and the Brassica napus gene BN115 (8). Deletion

analysis of the Arabidopsis COR15a promoter indicated thatthe C-repeat mightbe part of a cis-acting cold-regulatory DNAelement (7). This was first demonstrated by Yamaguchi-Shinozaki and Shinozaki (6), who showed that two 9-bp DNAelements containing the C-repeat, present in the promoter ofCOR78RD29A, induce cold-regulated gene expression whenfused to a reporter gene. Moreover, they found that the twoDNA elements also stimulated transcription in response todehydration stress. These C-repeat-containing elements were,therefore, given the designation DRE.

Many of the changes in gene expression that occur inresponse to low temperature and drought require the action ofabscisic acid (ABA; refs. 9 and 10). However, studies employ-ing the ABA-insensitive (abi) mutants ofArabidopsisindicatethat there are also ABA-independent signal transduction

pathways for cold- and dehydration-regulated gene expression(11, 12). Indeed, the results of Yamaguchi-Shinozaki andShinozaki (6) indicate that the C-repeatDRE is not respon-sive to ABA levels and, thus, appears to impart cold- anddehydration-regulated gene expression through an ABA-independent pathway.

How does the C-repeatDRE impart cold- and dehydration-regulated gene expression? A critical step toward answeringthis key question is determining the nature of the protein

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked advertisem ent inaccordance with 18 U.S.C. 1734 solely to indicate this fact.

Copyright 1997 by THENATIONALACADEMY OFSCIENCES OF THEUSA0027-842497941035-6$2.000PNAS is available online athttp:www.pnas.org.

Abbreviations: DR E, dehydration responsive element; A BA, abscisicacid; EREBP, ethylene response element binding protein; X-Gal,5-bromo-4-chloro-3-indolyl -D-galactoside.Data deposition: The sequence reported in this paper has beendeposited in the GenBank database (accession no. U77378).To whom reprint requests should be addressed.

1035


2/6

factors that interact with the DNA regulatory element. Herewe describe the isolation and characterization of anArabidop-siscDNA encoding the first identified C-repeatDRE bindingfactor, CBF1 (C-repeatDRE BindingFactor 1), and demon-strate that the protein functions as a transcriptional activatorin yeast.

MATERIALS AND METHODS

Plant Material.A. thaliana(L.) Heyn. ecotype RLD plantswere grown in pots in controlled environment chambers at22C under constant illumination with cool-white fluorescentlamps (100 molm2s1) as described (13). The effect oflow temperature on CBF1 expression was determined byplacing pots of plants in a cold room at 2.5C under constantillumination with cool-white fluorescent lamps (25molm2s1) for various times.CBF1expression in responseto water deficit was determined by placing detached leaves ondry filter paper in an uncovered Petri dish for 1.5 h at roomtemperature on a laboratory bench, at which time the tissueshad lost approximately 20% of their fresh weight. The Petridish was covered, placed in a sealed plastic bag, and incu-bated on a laboratory bench for an additional 5.5 h. For thecontrol, leaves were placed on water-saturated filter paper in

a covered Petri dish that was then sealed in a plastic bag andincubated on a laboratory bench for 7 h.Yeast Reporter Strains. Oligonucleotides encoding either

wild-type or mutant versions of the C-repeatDRE (Table 1),synthesized at the Michigan State University MacromolecularStructure Facility, were ligated into the BglII site of the lacZreporter vector pBgl-lacZ (kindly provided by J. Li; ref. 15).The resulting reporter constructs were integrated into the theura3 locus of Saccharomyces cerevisiae strain GGY1 (MATgal4 gal80 ura3 leu2 his3 ade2 tyr; provided by J. Li; ref. 15)by transformation and selection for uracil prototrophy.

Screen ofArabidopsiscDNA Library.TheArabidopsispACTcDNA expression library donated by John Walker (depositedin the Arabidopsis Biological Resource Center as stock #CD4-10; funded by National Science FoundationDepartment of

EnergyU.S. Department of Agriculture Collaborative Re-search in Plant Biology Program Grant USDA 9237105-7675)was screened for clones encoding C-repeatDRE bindingdomains. The cDNA library harbored in Escherichia coliBNN132 was amplified, and plasmid DNA was isolated andtransformed into the yeast GGY1 reporter strains selecting forleucine prototrophy. Yeast transformants that had been grownfor2or3daysat30C were overlaid with either a nitrocellulosemembrane filter (Schleicher & Schuell) or Whatman #50 filterpaper and incubated overnight at 30C. The yeast-impregnatedfilters were lifted from the plates and treated with X-Gal(5-bromo-4-chloro-3-indolyl -D-galactoside) to assay coloniesfor -galactosidase activity (15). Plasmid DNA from transfor-mants that formed blue colonies on X-Gal-treated filters was

recovered (16), propagated inE. coliDH5, and transformedback into the yeast reporter strains to confirm activity.

Yeast Transformation and Quantitative -GalactosidaseAssays.Yeast were transformed by either electroporation (17)or the lithium acetatecarrier DNA method (18). Quantitativein vitro-galactosidase assays were performed as described byRose and Botstein (19).

Expression of CBF1 Protein inE. coli and Yeast.CBF1 wasexpressed in E. coliusing the pET-28a() vector (Novagen).

The BglIIBclI restriction fragment of pACT-11 (pACT-11 isdescribed in Results) encoding CBF1 was ligated into the

BamHI site of the vector bringing CBF1 under control of theT7 phage promoter. The construct resulted in a histidine tag,a thrombin recognition sequence, and a T7 epitope tag beingfused to the N terminus of CBF1. The construct was trans-formed into E. coliBL21 (DE3), and the recombinant CBF1protein was expressed as recommended by the supplier (No-vagen). Expression of CBF1 in yeast was accomplished byligating restriction fragments encoding CBF1 (the BclIBglIIandBglIIBglII fragments from pACT-11) into theBglII site ofpDB20.1 (kindly provided by S. Triezenberg; ref. 20), bringingCBF1 under control of the yeast ADC1promoter.

Gel Shift Assays.Total soluble E. coliprotein (40 ng) wasincubated at room temperature in 10 l of 1 binding buffer

(15 mM Hepes, pH 7.91 mM EDTA30 mM KCl5% glyc-erol1 mM DTT) plus 50 ng of poly(dI-dC) poly (dI-dC)(Pharmacia) with or without 100 ng of competitor DNA. After10 min, a double-stranded DNA probe (1 ng) that was 32P-labeled by end-filling (21) was added, and the mixture wasincubated for an additional 10 min. Samples were loaded ontopolyacrylamide gels (4% wtvol) and fractionated by electro-phoresis at 150 V for 2 h (21). Probes and competitor DNAswere prepared from oligonucleotide inserts ligated into theBamHI site of pUC118 (21). Orientation and concatenationnumber of the inserts were determined by dideoxy DNAsequence analysis (21). Inserts were recovered after restrictiondigestion w ithEcoRI and HindIII and fractionation on poly-acrylamide gels (12% wtvol; ref. 21).

DNA and RNA Hybridization.Total RNA was isolated from

Arabidopsisplants (13) and Northern transfers prepared andhybridized as described (22), except that high-stringency washconditions were at 50C in 0.1 SSPE (1 SSPE is 3.6 MNaCl20 mM EDTA0.2 M Na2HPO4, pH 7.7)0.5% SDS.Total ArabidopsisDNA was isolated (23) and transferred tonylon membranes (Micron Separations, Westboro, MA) asdescribed (21). High-stringency hybridization and wash con-ditions were done according to Walling et al. (24). Low-stringency hybridization was in 6 SSPE0.5% SDS0.25%low-fat dried milk at 60C. Low-stringency washes were in 1SSPE0.5% SDS at 50C. Hybridization probes used for theentire CBF1 coding sequence and the 3 end of CBF1 were the

BclIBglII and EcoRVBglII restriction fragments frompACT-11, respectively, that had been gel-purified (21). DNA

Table 1. Oligonucleotides encoding wild-type and mutant versions of the C-repeat

DREOligonucleotide C-repeatDRE* Sequence

MT50 COR15a gatcATTTCATGGCCGACCTGCTTTTTMT52 M1COR15a CACAATTTCAaGaattcaCTGCTTTTTTMT80 M2COR15a gatcATTTCATGGtatgtCTGCTTTTTMT125 M3COR15a gatcATTTCATGGaatcaCTGCTTTTTMT68 COR15b gatcACTTGATGGCCGACCTCTTTTTTMT66 COR78-1 gatcAATATACTACCGACATGAGTTCTMT86 COR78-2 ACTACCGACATGAGTTCCAAAAAGC

*The C-repeatDRE sequences tested are either wild-type versions found in the promoters ofCOR15a(7),COR15b(ref. 14;K. Wilhelm & M.F.T., unpublished data), or COR78RD29A (6) or are mutant versions of the COR15aC-repeatDRE(M1COR15a, M2COR15a, and M3COR15a) in which the entire C-repeat, CCGAC, had been altered.

Uppercase letters designate bases in wild-type C-repeatDRE sequences. The core C-repeats are indicated in bold type.Lowercase letters at the beginning of a sequence indicate bases added to facilitate cloning. The lowercase letters that areunderlined indicate the mutations in the C-repeatDRE sequence ofCOR15a.

1036 Plant Biology: Stockinger et al. Proc. Natl. Acad. Sci. USA 94 (1997)


3/6

probes were radiolabeled with 32P-nucleotides by either ran-dom priming or by directed priming with internal oligonucle-otides (21). Autoradiography was performed using Hyper-film-MP (Amersham).

RESULTS

Screen for Arabidopsis cDNAs Encoding a C-RepeatDREBinding Domain.The one-hybrid strategy (15) was used toscreen for Arabidopsis cDNAs encoding a C-repeatDREbinding domain. In particular, yeast strains were constructedthat contained a lacZreporter gene with either wild-type ormutant verions of C-repeatDRE sequences from the pro-moters ofCOR15aorCOR78(Table 1) in place of the normalupstream activator sequence of the GAL1promoter (Fig. 1A).Yeast strains carrying these reporter constructs produced lowlevels of-galactosidase and formed white colonies on filterscontaining X-Gal. The reporter strains carrying the wild-typeC-repeatDRE sequences were transformed with a cDNAexpression library that contained random ArabidopsiscDNAinserts fused to the acidic activator domain of the yeast GAL4transcription factor GAL4-ACT (Fig. 1A).Thenotionwasthatsome recombinant plasmids in the expression library might

contain a cDNA insert encoding a C-repeatDRE bindingdomain fused to GAL4-ACT and that such a hybrid proteinmight bind upstream of the lacZreporter genes carrying theC-repeatDRE sequence, activate transcription of the lacZ

gene, and result in yeast forming blue colonies on X-Gal-treated filters.

Upon screening about 2 106 yeast transformants, threepositive plasmids were isolated that caused yeast strains car-ryinglacZreporters fused to wild-type C-repeatDRE insertsto form blue colonies on X-Gal-treated filters (Fig. 1B). Thethree plasmids did not cause a yeast strain carrying a mutantC-repeatDRE fused to lacZ to turn blue (Fig. 1B). Thus,activation of the reporter genes by the plasmids appeared to

depend on the C-repeatDRE sequence. Restriction enzymeanalysis and DNA sequencing indicated thatthe three plasmidshad an identical 1.8-kb cDNA insert (Fig. 2A). One of theplasmids, designated pACT-11, was chosen for further study.

pACT-11 Encodes a 24-kDa Polypeptide with an AP2 Do-main.Our expectation was that the cDNA insert in pACT-11would have a C-repeatDRE binding domain fused to theyeast GAL4-ACT sequence. However, DNA sequence analysisindicated that an ORF of only 9 aa had been added to the Cterminus of GAL4-ACT. It seemed highly unlikely that thisshort amino acid sequence encoded a DNA binding domain.Also surprising was the fact that about half of the cDNA insertin pACT-11 corresponded to 25S rRNA sequences (Fig. 2A).Further analysis, however, indicated that the insert had anORF, in opposite orientation to the GAL4-ACT sequence,

deduced to encode a 24-kDa polypeptide (Fig. 2 AC; pre-sumably,the sequences for the 24-kDa polypeptide and the 25SRNA were ligated together during the cloning process). Thepolypeptide had a basic region that could potentially serve asa nuclear localization signal (28) and an acidic C-terminal half(pI of 3.6) that might act as an acidic transcription activatordomain (29). Searches of the GenBank nonredundant nucle-otide, peptide, and EST databases (Aug. 25, 1995, and Mar. 24,1996) indicated that there was no previously described ho-molog of the 24-kDa polypeptide. However, the polypeptidedid have an AP2 domain (ref. 30; Fig. 2 B and D), a DNAbinding motif of about 60 aa present in numerous plantproteins, including the APETALA2 (31) protein ofArabidop-

sis and the EREBPs (ethylene response element bindingproteins) of tobacco (25).

The 24-kDa Polypeptide Binds to the C-RepeatDRE andActivates Transcription in Yeast. We hypothesized that the24-kDa polypeptide was responsible for activating the lacZreporter genes in yeast. To test this, we inserted the BclIBglIIfragment of pACT-11 containing the 24-kDa polypeptide (Fig.2), and the BglIIBglII fragment containing the 24-kDapolypeptide plus a small portion of the 25S rRNA sequence(Fig. 2), into the yeast expression vector pDB20.1. Plasmidscontaining either insert in the same 5-to-3 orientation as the

ADC1promoter stimulated synthesis of-galactosidase whentransformed into yeast strains carrying the lacZreporter genefused to a wild-type COR15a C-repeatDRE (Fig. 3). Incontrast, the plasmids did not stimulate synthesis of-galac-tosidase when transformed into yeast strains carrying thelacZreporter gene fused to a mutated COR15a C-repeatDRE(Fig. 3). These data indicated that the 24-kDa polypeptide

could bind to the wild-type C-repeatDRE and activate ex-pression of the lacZreporter gene in yeast. Additional exper-iments indicated that the 24-kDa polypeptide could alsoactivate expression of thelacZreporter gene when it was fusedto a wild-type COR78C-repeatDRE (dimer of MT66) or awild-type COR15bC-repeatDRE (dimer of MT68; data notshown); COR15b is a homolog of COR15a (14). A plasmidcontaining the BclIBglII fragment (which encodes only the24-kDa polypeptide) cloned in opposite orientation to the

ADC1promoter did not stimulate synthesis of-galactosidasein reporter strains carrying either the wild-type or mutantC-repeatDRE sequence fused to lacZ(Fig. 3). However, aplasmid carrying the BglIIBglII fragment (containing the24-kDa polypeptide plus some 25S rRNA sequences) cloned inopposite orientation to the ADC1 promoter did produce

FIG. 1. Approach used to isolate cDNA inserts encoding a C-re-peatDRE binding domain. (A) Screening strategy (see text fordetails). (B) Activity of the positive plasmids in yeast reporterstrains carrying the indicated upstream activator sequences. Theoligonucleotides (oligo) used to make the upstream activator sequenceelements (Table 1), the number of inserts, and their direction ofinsertion are indicated.

Plant Biology: Stockinger et al. Proc. Natl. Acad. Sci. USA 94 (1997) 1037


4/6

significant levels of-galactosidase in reporter strains carryingthe wild-type COR15a C-repeatDRE (Fig. 3). Thus, se-quences located upstream of the 24-kDa polypeptide were ableto serve as a cryptic promoter in yeast, a result that offered anexplanationfortheexpressionofthe24-kDapolypeptideintheoriginal pACT-11 plasmid.

Gel Shift Analysis Indicates that the 24-kDa PolypeptideBinds to the C-RepeatDRE. Gel shift experiments wereconducted to demonstrate further that the 24-kDa polypeptidebound to the C-repeatDRE. Specifically, the ORF for the24-kDa polypeptide was inserted into the pET-28a() bacte-rial expression vector (see Materials and Methods), and theresulting fusion protein was expressed at high levels in E. coli(data not shown). Protein extracts prepared from E. coliexpressing the recombinant protein produced a gel shift whenawild-type COR15a C-repeatDREwasusedasprobe(Fig.4).No shift was detected with BSA or E. coliextracts preparedfrom strains harboring the vector alone or the vector with anantisense insert for the 24-kDa polypeptide. Oligonucleotidesencoding wild-type C-repeatDRE sequences from COR15aor COR78 competed effectively for binding to the COR15aC-repeatDRE probe, but mutated versions of the COR15aC-repeatDRE did not (Fig. 4). These in vitroresults corrob-orated thein vivoyeast expression studies, indicating that the24-kDa polypeptide binds to the C-repeatDRE sequence.The 24-kDa polypeptide was thus designated CBF1, and thegene encoding it was named CBF1.

CBF1 Is a Unique or Low Copy Number Gene. Southerntransfers of Arabidopsis DNA that had been digested withvarious restriction endonucleases were prepared and hybrid-ized at either high (Fig. 5) or low (data not shown) stringencyusing the entire CBF1 coding sequence as probe. A small

FIG. 2. Analysis of the pACT-11 cDNA clone. (A) Schematicdrawing of the pACT-11 cDNA insert. (B) DNA and amino acidsequence of the 24-kDa polypeptide. The A P2 domain is indicatedby double underlines. The basic amino acids that potentially act asa nuclear localization signal are indicated with asterisks. The BclIsite immediately upstream of the 24-kDa polypeptide used insubcloning the 24-kDa polypeptide and the EcoRV site used insubcloning the 3 end ofCBF1are indicated by single underlines. (C)Schematic drawing showing locations of the potential nuclearlocalization signal (NLS), the AP2 domain, and the acidic region ofthe 24-kDa polypeptide. Numbers indicate amino acid residues. (D)Comparison of the AP2 domains from the 24-kDa polypeptide andthe tobacco DNA binding protein EREBP2 (25). Identical aminoacids are indicated with single vertical lines; similar amino acids areindicated by colons; amino acids that are invariant in AP2 domains(26) are indicated with asterisks; and the histidine residue presentin CBF1 and TINY (27) that is a tyrosine residue in all other

FIG. 3. Activation of reporter genes in yeast by the 24-kDapolypeptide. Expression constructs were transformed into yeaststrains carrying the lacZreporter gene fused to direct repeat dimersof either the wild-type COR15a C-repeatDRE (oligonucleotideMT50) or the mutant M3COR15a C-repeatDRE (oligonucleotideMT125). -Galactosidase activity (nanomoles of o-nitrophenol pro-duced per minutemilligrams of protein) SD was determined fromcultures grown in triplicate.

described AP2 domains is indicated with a caret. A single amino acidgap in the CBF1 sequence is indicated by a dot.



5/6

number of bands were observed for each DNA digest, indi-cating thatCBF1is either a unique or low copy number gene(bothEcoRV and HincII cut once within the CBF1 cDNA).The same patterns were obtained when the 3 end of theCBF1coding sequence (corresponding to the acidic region of CBF1)was used as the hybridization probe (data not shown).

CBF1 Transcript Levels Do Not Change Appreciably in

Response to Low Temperature or Water Deficit.The transcriptlevels ofCBF1were about the same in control and cold-treated

plants and in control and dehydrated leaves (Fig. 6). Incontrast, the transcript levels for COR15aincreased dramat-ically in response to both low temperature and water deficit(Fig. 6). Under each environmental condition tested, a singlehybridizing band was observed for CBF1at either high or lowstringency with probes for either the entire CBF1 codingsequence or the 3 acidic region of the protein (data notshown). The size of the CBF1transcripts was about 1.0 kb.

DISCUSSION

The results presented indicate that CBF1 binds to the C-repeatDRE DNA regulatory element bothin vitro(gel shift

assays) and in vivo(yeast expression assays) and can functionas a transcriptional activator. Thus, it is probable that CBF1binds to C-repeatDRE elements inArabidopsisplants and hasa role in regulating transcription in response to low temper-ature and water deficit. Having available a cDNA clone forCBF1 makes possible a number of strategies to directly test thishypothesis, such as using antisense technology to decreasethe levels of CBF1 in transgenic plants and determining whateffects this has on cold- and dehydration-regulated geneexpression. It will also be extremely interesting to determinewhether altering the level of CBF1 affects the freezing anddrought tolerance ofArabidopsisplants.

CBF1is a unique or low copy number gene in Arabidopsis.However, the CBF1 protein contains a 60-aa motif, the AP2domain, that is evolutionarily conserved in plants (30). It is

present, for instance, in the APETALA2 (31), AINTEGU-MENTA (26, 33), and TINY (27) proteins ofArabidopsis; theEREBPs of tobacco (25); and numerous proteins of unknownfunction inB. napus,Ricinus communis, and rice (indicated bycDNA sequences deposited in the GenBank expressed se-quence tagged cDNA database). The results of Ohme-Takagiand Shinshi (25) indicate that the function of the AP2 domainis DNA binding; this region of the putative tobacco transcrip-tion factor EREBP2 is responsible for its binding to thecis-acting ethylene response DNA element referred to as theGCC-repeat. As discussed by Ohme-Takagi and Shinshi (25),the DNA-binding domain of EREBP2 (the AP2 domain)contains no significant amino acid sequence similarities orobvious structural similarities with other known transcriptionfactors or DNA binding motifs. Thus, the domain appears to

FIG. 4. Gel shift assays demonstrating that CBF1 binds to theC-repeatDRE. The C-repeatDRE probe (1 ng) used in all reactionswas a 32P-labeled dimer of the oligonucleotide MT50, a wild-typeC-repeatDRE fromCOR15a(Table 1). Shown in the first four lanesare gel shift assays using either BSA or protein extracts prepared fromE. coli harboring either the pET-28a() expression vector alone(vector) or the vector plus an insert encoding the 24-kDa polypeptidein sense (sense insert) or antisense (antisense insert) orientation.Shown in the next eight lanes are theE. coliprotein extract preparedfrom the sense insert strain plus the indicated competitor C-repeatDRE sequences (100 ng). The 1, 2, and 3refer to whether theoligonucleotides were monomers, dimers, or trimers, respectively, ofthe indicated C-repeatDRE sequences.

FIG. 5. CBF1 is a unique or low copy number gene.ArabidopsisDNA (1 g) was digested w ith the indicated restriction endonucle-ases, and Southern transfers were prepared and hybridized with a32P-labeled probe encoding the entire CBF1 polypeptide.

FIG. 6. Effects of low temperature and water deficit onCBF1andCOR15atranscript levels. Northern transfers were prepared from totalRNA (20 g) isolated from Arabidopsisplants treated at low temper-ature for the indicated time or detached leaves that either were () orwere not () subjected to a water deficit (WD) treatment. Thetransfers were hybridized with 32P-labeled probes for either the entireCBF1coding sequence or the COR15agene. After autoradiography,the transfers were hybridized a second time with the constitutivelyexpressed eIF-4A (eukaryotic Initiation Factor 4A) gene (32) toconfirm that RNA loading and transfer were uniform between thesamples (data not shown). The autoradiograms for the COR15aandCBF1probes were exposed for 1 h and 5 days, respectively. Longerexposures for the COR15a probe indicated that COR15a transcript

levels begin to increase by 2 h.

Plant Biology: Stockinger et al. Proc. Natl. Acad. Sci. USA 94 (1997) 1039


6/6

be a novel DNA-binding motif that, to date, has only beenfound in plant proteins.

Presumably, the binding of CBF1 to the C-repeatDREinvolves the AP2 domain. In this regard, it is germane to notethat the tobacco ethylene response element, AGCCGCC,closely resembles the C-repeatDRE sequences present in thepromoters of theArabidopsisgenesCOR15a, GGCCGAC, andCOR78RD29A, TACCGAC. An intriguing possibility thusraised is that CBF1, the EREBPs, and perhaps other AP2

domain proteins are members of a superfamily of DNAbinding proteins that recognize a family of cis-acting regula-tory elements having, potentially, CCG as a common coresequence. Differences in the sequence surrounding the CCGcore element might result in recruitment of distinct AP2domain proteins that are integrated into signal transductionpathways activated by different environmental, hormonal, anddevelopmental cues.

The yeast transformation experiments indicate that CBF1has a domain that can serve as a transcriptional activator. Themost likely candidate for this domain is the acidic C-terminalhalf of the polypeptide. Indeed, random acidic amino acidpeptides from E. coli have been shown to substitute for theGAL4 acidic activator domain of GAL4 in yeast (34). More-over, acidic activator domains have been found to function

across phylogenic kingdoms (29). The yeast GAL4 acidicactivator, for instance, can activate transcription in tobacco(35). It has also been shown that certain plant transcriptionfactors, such as VP1 (36), have acidic domains that function astranscriptional activators in plants. Significantly, the acidicactivation domains of the VP16 and GCN4 transcriptionfactors require the adaptor proteins ADA2, ADA3, andGCN5 for full activity in yeast (37). Intriguingly, geneticstudies indicate that CBF1 also requires ADA2, ADA3, andGCN5 to function optimally in yeast (E.J.S., Steven J. Triezen-berg, and M.F.T., unpublished data). The fundamental ques-tion thus raised is whether plants have homologs of ADA2,ADA3, and GCN5 and whether these adaptors are required forCBF1 function (and function of other transcription factorswith acidic activator regions) in Arabidopsis.

A final point regards the possible regulation of CBF1activity. In contrast to what occurs in yeast, transcription ofCBF1inArabidopsisunder normal growth conditions does notcause appreciable activation of promoters containing C-repeatDRE sequences (i.e.,CORgenes are expressed at verylow levels in nonstressed plants). Thus, assuming that CBF1can bind to C-repeatDRE sequences inArabidopsisplants, asit does both in vitro and in yeast, this finding would seem toindicate that CBF1 is activated by low temperature andwater deficit in Arabidopsis. A number of potential mecha-nisms could account for CBF1 activation, such as its becomingmodified, perhaps by phosphorylation, in response to lowtemperature or water deficit. Such modification could result ineither stabilization of the protein, translocation of the proteinfrom the cytoplasm to the nucleus, or activation of either theDNA binding domain or the activation domain of the protein.

Again, having available the CBF1 cDNA makes possible anumber of strategies to test these and alternative hypotheses.

We thank Joachim Li, Stan Fields, and Steve Triezenberg forproviding the yeast strains and yeast cloning vectors used in this study;Pam Green for theeIF-4Agene probe; and Steve Triezenberg, KevinOConnell, and an anonymous reviewer for suggestions on how toimprove the manuscript. This research was supported by grants toM.F.T. from the U.S. Department of Agriculture National ResearchInitiative Competitive Grants Program (9237100-7351), the Consor-

tium for Plant Biotechnology Research (U.S. Department of Agricul-ture Grant 9234190-6941, Subgrant 593013011), and the MichiganAgricultural Experiment Station.

1. Steponkus, P. L. Uemura, M. & Webb, M. S. (1993) inAdvancesin Low Temperature Biology, ed. Steponkus, P. L. (JAI, London),Vol. 2, pp. 211312.

2. Guy, C., Haskell, D., Neven, L., Klein, P. & Smelser, C. (1992)Planta 188,265270.

3. Siminovitch, D. & Cloutier, Y. (1983)Cryobiology 20, 487503.

4. Thomashow, M. F. (1993) inPlant Responses to Cellular Dehy-dration During Environmental Stress, eds. Close, T. L. & Bray,E. A. (Am. Soc. Plant Physiol., Rockville, MD), pp. 137143.

5. Artus, N. N., Uemura, M., Steponkus, P. L., Gilmour, S. J., Lin,C. & Thomashow, M. F. (1996) Proc. Natl. Acad. Sci. USA 93,1340413409.

6. Yamaguchi-Shinozaki, K. & Shinozaki, K. (1994)Plant Cell 6,251264.

7. Baker, S. S., Wilhelm, K. S. & Thomashow, M. F. (1994) PlantMol. Biol. 24, 701713.

8. Jiang, C., Iu, B. & Singh, J. (1996)Plant Mol. Biol.30,679684.9. Welin, B. V., Olson, ., Nylander, M. & Palva, E. T. (1994)Plant

Mol. Biol. 26, 131144.10. Bray, E. A. (1993) Plant Physiol. 103,10351040.11. Nordin, K., Heino, P. & Palva, E. T. (1991)Plant Mol. Biol. 16,

10611071.12. Gilmour, S. J. & Thomashow, M. F. (1991) Plant Mol. Biol. 17,

12331240.13. Gilmour, S. J., Hajela, R. K. & Thomashow, M. F. (1988) PlantPhysiol. 87, 745750.

14. Wilhelm, K. S. & Thomashow, M. F. (1993)Plant Mol. Biol. 23,10731077.

15. Li, J. J. & Herskowitz, I. (1993) Science 262, 18701874.16. Strathern, J. N. & Higgens, D. R. (1991)Methods Enzymol.194,

319329.17. Becker, D. M. & Guarente, L. (1991) Methods Enzymol. 194,

182187.18. Schiestl, R. H. & Gietz, R. D. (1989)Curr. Genet.16, 339346.19. Rose, M. & Botstein, D. (1983)Methods Enzymol.101,167180.20. Berger, S. L., Pina, B., Silverman, N., Marcus, G. A., Agapite, J.,

Regier, J. L., Triezenberg, S. J. & Guarente, L. (1992) Cell 70,251265.

21. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) MolecularCloning: A Laboratory Manual (Cold Spring Harbor Lab. Press,

Plainview, NY), 2nd Ed.22. Hajela, R. K., Horvath, D. P., Gilmour, S. J. & Thomashow,M. F. (1990) Plant Physiol. 93, 12461252.

23. Stockinger, E. J., Mulinix, C. A., Long, C. M., Brettin, T. S. &Iezzoni, A. F. (1996) J. Hered.87, 214218.

24. Walling, L. L., Chang, Y. C., Demmin, D. S. & Holzer, F. M.(1988) Nucleic Acids Res. 16, 1047710492.

25. Ohme-Takagi, M. & Shinshi, H. (1995) Plant Cell 7, 173182.26. Klucher, K. M., Chow, H., Reiser, L., Fischer, R. L. (1996)Plant

Cell 8, 137153.27. Wilson, K., Long, D., Swinburne, J. & Coupland, G. (1996)Plant

Cell 8, 659671.28. Raikhel, N. (1992)Plant Physiol. 100,16271632.29. Hahn, S. (1993)Cell 72, 481483.30. Weigel, D. (1995)Plant Cell 7, 388389.31. Jofuku, K. D., den Boer, B. G. W., Van Montagu, M. & Oka-

muro, J. K. (1994) Plant Cell 6, 12111225.

32. Metz, A. M., Timmer, R. T. & Browning, K. S. (1992)Gene120,313314.33. Elliot, R. C., Betzner, A. S., Huttner, E., Oakes, M. P., Tucker,

W. Q. J., Gerentes, D., Perez, P. & Smyth, D. R. (1996)Plant Cell8,155168.

34. Ma, J. & Ptashne, M. (1987)Cell 51, 113119.35. Ma, J., Przibilla, E., Hu, J., Bogorad, L. & Ptashne, M. (1988)

Nature (London) 334,631633.36. McCarty, D. R., Hattori, T., Carson, C. B., Vasil, V., Lazar, M.

& Vasil, I. K. (1991) Cell 66, 895905.37. Guarente, L. (1995)Trends Biochem. Sci.20, 517521.


Arabidiopsis Thaliana CBF 1 Encodes an AP2

Documents

Transcript of Arabidiopsis Thaliana CBF 1 Encodes an AP2