Application of Plant Biotechnology-plant Transformation (2010)

CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS451

Agrobacterium-mediated transformation

Guo-qing Song

f G D li S t mf Gene Delivery Systemy Agrobacteriumy Viral vectorsy Biolisticy Microinjectiony PEG - Polyethylene Glycol y PEG Polyethylene Glycol y Electroporation

2

Biolistic TransformationBiolistic Transformation------- Advantage and Disadvantage

f Advantage:

y This method can be use to transform all plant species.y No binary vector is required.

T f ti t l i l ti l i ly Transformation protocol is relatively simple.

f Disadvantage:g

y Difficulty in obtaining single copy transgenic events.y High cost of the equipment and microcarriersy High cost of the equipment and microcarriers.y Intracellular target is random (cytoplasm, nucleus, vacuole,

plastid, etc.).

3

y Transfer DNA is not protected.

Learning Objectives

Understand what key changes had to be made to the Agro tumor-inducing (Ti) or root-inducing (Ri) plasmid for the transfer of novel genes into plantsfor the transfer of novel genes into plants

Understand the binary plasmid transformation system

Understand some mechanisms of gene transfer

4

OUTLINECSS451

Agrobacterium Tumefaciens & Crown Gall Disease

MechanismMechanism ofof Gene Transfer using Gene Transfer using A. tumefaciensA. tumefaciensf Ti pl smidf Ti-plasmidf Chromosomal and Vir Genesf T-DNA Transferf T-DNA IntegrationEngineering binary vectors for plant transformation Engineering binary vectors for plant transformation

f T-DNA Integration

Transformation protocols using Transformation protocols using AgrobacteriumAgrobacterium

Factors influencing transformation efficiencyFactors influencing transformation efficiency

5

CSS451

Why Agrobacterium?

fAgrobacteria are naturally occurring, ubiquitous soil bornepathogens.

y A. tumefaciens causes crown gall disease (tumors)y A. rhizogenes causes root hair disease (hairy root)f Other bacterial groups also contain species capable of

f A b i f i A b i

g p p pinterkingdom genetic exchange (Gelvin 2005).

f Agrobacterium tumefaciens- or Agrobacterium rhizogenes-mediated transformation is to date the most commonly used method for obtaining

ltransgenic plants.

f The tumorigenic host plant species for range A. t f i i l d L b f di t d

6

tumefaciens include: Large number of dicots and some monocots and Gymnosperms.

CSS451

7

A.Tumefaciens & Crown Gall DiseaseA.Tumefaciens & Crown Gall DiseaseCSS451

8Stanton B. Gelvin. Nature 433: 583-584 (2005).

http://arabidopsis.info/students/agrobacterium/

Gene Transfer using AgrobacteriumGene Transfer using AgrobacteriumTiTi l idl id

GGCAGGATATTCAATTGTAAAT

TiTi--plasmidplasmid



Left T-DNA border

Right T-DNA border

9

Right and left border (RB, LB) sequences are the only parts ofT-DNA needed to enable transfer into plants-Removal of other T-DNA genes creates a disarmed Ti plasmid

Gene Transfer using AgrobacteriumGene Transfer using Agrobacterium

Agro typesAgro typesHellens et al (2000; Trends in Plant Science 5:446-451)

AgropineAgropine--typetype (strain EHA105::pEHA105): (strain EHA105::pEHA105): Carry genes for agropine synthesis and catabolism. Tumors do not differentiate and die out.

OctopineOctopine--typetype (strain LBA4404::pAL4404):(strain LBA4404::pAL4404):Carry genes(3 required) to synthesize octopine in the plant and catabolism in the bacteria plant and catabolism in the bacteria. Tumors do not differentiate, but remain as callus tissue.

NopalineNopaline--typetype (strain GV3101::pMP90 (pTiC58)):(strain GV3101::pMP90 (pTiC58)):NopalineNopaline typetype (strain GV3101::pMP90 (pTiC58)):(strain GV3101::pMP90 (pTiC58)):Carry gene for synthesizing nopaline in the plant and for utilization (catabolism) in the bacteria. Tumors can differentiate into shooty masses (teratomas).

10

Gene Transfer using AgrobacteriumGene Transfer using Agrobacterium

Agro typesAgro types

LBA4404: rifampicin (chromosomal) and streptomycin (on the Ti plasmid)

EHA105rifampicin (chromosomal) and streptomycin (on the Ti plasmid)

GV3101: streptomycin 500 mg/l

11Hellens et al (2000; Trends in Plant Science 5:446-451)

Gene Transfer using Gene Transfer using AgrobacteriumAgrobacteriumCSS451

h l d d GGChromosomal and vir genes of

bacterial cells are both

Chromosomal and Virand Vir GenesGenes

Virulence genes

bacterial cells are both involved in T-DNA transfer

gvir Avir Bvir C

Chemoreceptor, activator of vir G Transmembrane complexHost range specificityvir C

vir Dvir E

Host-range specificitySite-specific endonucleaseT-DNA processing and protection

vir Fvir G

Host range specificityPositive regulator of vir B, C, D, E, F

12

Chromosomal genes

Attachment to plant cell, vir gene regulation

Disarmed TiDisarmed Ti--plasmidplasmid

T-DNA

LB RBauxin cytokin opine

Oncogenic genes

vir genes ori opine catabolism

13

Disarmed TiDisarmed Ti--plasmidplasmid

LB RB

i i i t b livir genes ori opine catabolism

Disarmed Ti -plasmid

14

A Binary Vector MapA Binary Vector Map

15

A Binary Vector MapA Binary Vector Map

Plant selectable marker

KmR

Bacterial selectable marker

16From Dr. S. Gelvin, Purgue UniversityFrom Dr. S. Gelvin, Purgue University

Introduction of Binary Vector into AgroIntroduction of Binary Vector into Agro

ElectroporationElectroporationFreeze/ThawFreeze/ThawTriparental MatingTriparental MatingTriparental MatingTriparental Mating

Agrobacterium

17Competent Agrobacterial Cells


ElectroporationElectroporation

Freeze/ThawFreeze/ThawFreeze/ThawFreeze/Thaw

Liquid nitrogen (196C) 3 minLiquid nitrogen (196C) 3 min--------37C 30 min37C 30 min

18

Binary Vector SystemBinary Vector System

Agro only Agro/E Coli

Binary VectorBinary VectorTi Helper PlasmidTi Helper Plasmid

Agro only Agro/E. Coli

19Binary Vector SystemBinary Vector System

Plant selectable marker

KmR

Bacterial selectable marker

20


Agro cultureAgro colonies

Agro stock(-80C with Glycerol)

21

MechanismMechanism of Gene Transfer using of Gene Transfer using AgrobacteriumAgrobacteriumCSS451

External Signals such as

Acetosyringone

22Stanton B. Gelvin. Nature 433: 583-584 (2005)

Passage of T-DNA from Agrobacterium cells into plant genomic DNA

MechanismMechanism of of Gene Transfer using Gene Transfer using AgrobacteriumAgrobacterium------------ The Plant Cell StepThe Plant Cell Step

CSS451

Chromosomal and vir genes of bacterial cells are both involved in T-DNA transfer

The plant cell step of T-DNA transfer is poorly understood

Entry into plant cell?

Nuclear uptake?

Integration into chromosome?

23

CSS451

24

Expression of the TransgeneExpression of the TransgeneCSS451

External Signal

Cell Receptor

Regulatory Elements Promoter Gene Terminator

p

Where When How much

Go STOP

TranscriptionWhere When How much

Translation

mRNAConstitutive promoters: CaMV35S Actin Ubi

a stop codon (or termination Translation

Protein

CaMV35S, Actin, Ubi

Inducible prompters: rbcS

Tissue specific promoters: Cab

termination codon): UAG (in RNA) / TAG (in DNA) ("amber"), UAA / TAA ("ochre"), and UGA / TGA ("opal" or

25

ProteinTissue specific promoters: Cab UGA / TGA ( opal or "umber"

Summary: TSummary: T--DNA transferDNA transferSummary: TSummary: T--DNA transferDNA transferCSS451

1. Agrobacteria attach to plant cell surfaces at wound sites. g p2. The plant releases wound signal compounds, such as acetosyringone. 3. Vir C and/or Vir F recognize the host plant cells. 4. The signal binds to vir A on the Agrobacterium membrane. 5 Vir A with signal bound activates vir G 5. Vir A with signal bound activates vir G. 6. Activated vir G turns on other vir genes, including vir D and E. 7. Vir D cuts at a specific site in the Ti plasmid (tumor-inducing), the left

border. 8. Single stranded T-DNA is bound by vir E product as the DNA unwinds

from the vir D cut site. Binding and unwinding stop at the right border. 9. Vir B + T-DNA complex is transferred to the plant cell, where it

integrates in nuclear DNA integrates in nuclear DNA.

T-DNA codes for proteins that produce hormones and opines. Hormonesencourage growth of the transformed plant tissue Opines feed bacteria ----a

26Zhu et al. Journal of Bacteriology (2000)

encourage growth of the transformed plant tissue. Opines feed bacteria a carbon and nitrogen source.

Agrobacterium PreparationAgrobacterium Preparation

Agro-transformation Streak the plateTemperature: 30CTemperature: 30C Medium: LB Antibiotic: Km vector. Time: 2-3 days.

Temperature: 30C Medium: LB, YEB, or YEPAntibiotic: Km or based on the

i h

27

SMG in the vector. Time: 24-48 hr.Concentration: O.D.600=0.5-1.0

CSS451

Agrobacterium Protocols---TransformationAgrobacterium Protocols---Transformation

T b Ri Tobacco RiceRe-growth 4

Tobacco Rice Tobacco Rice

Inoculation1Molecular verification of gene 5

2

Molecular verification of gene presence & expression

Co-cultivation

5

PCR2

SouthernBlot

Selection and regeneration3 Flowering and setting seeds 6

28

The Floral Dip MethodCSS451

A good stage for floral dipping

Co-cultivation

A good stage for floral dipping

Infection

Seed setting Harvest seeds SelectionSeed setting Harvest seeds Selection

A b t i di t d t f ti f

29

Zhang et al. Nature Protocols 1(2) (2006)

Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method

Experiment 2: Tobacco Transformation

Objectives: To get familiar with A tumefaciens mediated transformation To get familiar with A. tumefaciens-mediated transformation,

such as explants, T-DNA, infection, co-cultivation, selection, binary vector, right border and left border, selectable marker gene (SMG), markers for screening, regeneration, antibiotics, and etcand etc.

To understand the differences between the wild-type T-DNA and the disarmed T-DNA.

30

Experiment 2: Tobacco Transformation CSS451

Agro strains: LBA4404:pBI121 & ACH5

1. LBA4404 has the Ach5 chromosomal background1. LBA4404 has the Ach5 chromosomal background

2. ACH5 (pTiAch5---a wild-type octopine plasmid)

3. LBA4404 (pAL4404---a disarmed octopine plasmid)

NOS-pro NPT II (KanR) NOS-ter 35S-pro GUS NOS-ter

pBI121

31LBA 4404 with the Ach5 chromosomal background exhibits clumping

CSS451

Experiment 2

Plant materials: Tobacco cv. Samsun

Seeds Seed germination Seedling Plant

Mature seeds harvested from wild type tobacco plant cv. Samsun

Sterile seedling was maintained in Magenta box GA7 containing 50 mlplant cv. Samsun

1. Surface sterilization (50% clorox + 0.02% Tween 20, 15 min; 4 washes in sterile water).

Magenta box GA7 containing 50 ml MS medium. Subcuture cy cutting the internodes. Culture conditions: 25C, 16 h-

32

2. Seed germination on MS medium. ,

photoperiod, 35-50 E m-2s-1.

Explant preparation 1 Explant size: 0 5-0 8 cm X 0 5-0 8 cm

Experiment 2Explant preparation 1. Explant size: 0.5-0.8 cm X 0.5-0.8 cm.

2. To prepare the explants using sterile techniques. 3. Do not let the explants too dry.

1Inoculation 1. Agro concentration: O.D.600 = 0.5-0.8.

2. Infection time: 10-15 min.

2

3. Infection medium: Regeneration medium (RM)4. Acetosyringone (Ac): 100 M

Co cultivation 1 Co cultivation medium: RM2 Co-cultivation2-3 d A. tumefaciens5 d S. meliloti5 d M. loti5-11Rhizobium sp. NGR234

1. Co-cultivation medium: RM2. Co-cultivation time: 2-4 d 3. Environmental conditions: in the dark4 Ac: 100 M

3

5 11Rhizobium sp. NGR234 4. Ac: 100 M

Selection and regeneration

1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn

33

2. Subculture: every 3 wk

CSS451

Explant preparation 1. Segments from hypocotyl, cotyledons, epicotyl, leaf, internodes and petiole (Dicot)

2 E b i ll (M t)2. Embryogenic calluses (Monocot)3. Well developed regeneration system via either

organogenesis or somatic embryogenesis Inoculation 1 Agro concentration: O D 0 5 0 8Inoculation 1. Agro concentration: O.D.600 = 0.5-0.8.

2. Infection time: 10-15 min.3. Infection medium: Regeneration medium (RM)4 A t i (A ) 100 M4. Acetosyringone (Ac): 100 M

Co-cultivation2-3 d A. tumefaciens5 d S. meliloti

1. Co-cultivation medium: RM2. Co-cultivation time: 2-4 d 3 i l di i i h d k5 d M. loti

5-11Rhizobium sp. NGR2343. Environmental conditions: in the dark4. Ac: 100 M

Selection and ti

1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn

34

regeneration 2. Subculture: every 3 wk

CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS451

Biolistic-mediated transformation

GuoGuo--qingqing Song Song GuoGuo--qingqing Song Song

f G D li S t mf Gene Delivery Systemy Agrobacteriumy Viral vectorsy Biolisticy Microinjectiony PEG - Polyethylene Glycol y PEG Polyethylene Glycol y Electroporation

Biolistic TransformationBiolistic Transformation------- Advantage and Disadvantage

f Advantage:

y This method can be use to transform all plant species.y No binary vector is required.

T f ti t l i l ti l i ly Transformation protocol is relatively simple.

f Disadvantage:g

y Difficulty in obtaining single copy transgenic events.y High cost of the equipment and microcarriersy High cost of the equipment and microcarriers.y Intracellular target is random (cytoplasm, nucleus, vacuole,

plastid, etc.).y Transfer DNA is not protected.

Gene Delivery System------Biolistic-mediated transformation

Known as:

Particle BombardmentParticle BombardmentBiolisticsMicroprojectile bombardmentParticle accelerationParticle inflow gunGene gun

Using a gene gun directly shoots a piece of DNA into the recipient plant tissue.

T t ld b d t d i th f i t tTungsten or gold beads are coated in the gene of interestand fired through a stopping screen, accelerated by Helium, into the plant tissue. The particles pass through the plant cells leaving the DNA insidecells, leaving the DNA inside.

BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Mechanism

BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Equipment

The Helios Gene GunPDS 1000/He The Helios Gene Gun

http://www.oardc.ohio-state.edu/plantranslab/PIG.htm

www.bio-rad.com/genetransfer/

PDS-1000/He

Particle Inflow Guns (PIG)

BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Equipment- PDS-1000/He

PDS-1000/He

DNA-coated microcarriers are loaded on microcarrier.Micro-carriers are shot towards Micro-carriers are shot towards target tissues during helium gas decompression. A stopping screen placed allowing


A stopping screen placed allowing the coated microprojectiles to pass through and reach the target cells.

BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- PDS-1000/He References

Arnold D et al., Proc Natl Acad Sci USA 91, 99709974 (1994)Castillo AM et al Biotechnology 12 13661371 (1994)Castillo AM et al., Biotechnology 12, 1366 1371 (1994)Duchesne LC et al., Can J For Res 23, 312316 (1993)Fitzpatrick-McElligott S, Biotechnology 10, 10361040 (1992)p g , gy , ( )Hartman CL et al., Biotechnology 12, 919923 (1994)Heiser WC, Anal Biochem 217, 185196 (1994)Lo DC et al., Neuron 13, 12631268 (1994)Sanford JC et al., Technique 3, 316 (1991)Sh k KB t l 480 485 (1991)Shark KB et al., 480485 (1991)Smith FD et al., J Gen Microbiol 138, 239248 (1992)Svab Z and Maliga P Proc Natl Acad Sci USA 90 913917 (1993)Svab Z and Maliga P, Proc Natl Acad Sci USA 90, 913 917 (1993)Toffaletti DL et al., J Bacteriol 175, 14051411 (1993)


BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Equipment- Particle Inflow Gun

Finer JJ, P Vain, MW Jones, MD McMullen (1992) Development of the particle inflow gun for DNA delivery to plant cells. Plant Cell Reports 11:232-238.V i P N K J M ill C R h C N JJ Fi (1993) Vain P, N Keen, J Murillo, C Rathus, C Nemes, JJ Finer (1993) Development of the Particle Inflow Gun. Plant Cell Tiss Org Cult 33:237-246.

BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Equipment- Helios Gene Gun


f The helium pulse sweeps the DNA- or RNA-coated gold f The helium pulse sweeps the DNA or RNA coated gold microcarriers from the inside wall of the sample cartridge.

f The microcarriers accelerate for maximum penetration as they f The microcarriers accelerate for maximum penetration as they move through the barrel, while the helium pulse diffuses outward.

f The spacer maintains the optimal target distance for in vivo f The spacer maintains the optimal target distance for in vivo applications and vents the helium gas away from the target to minimize cell surface impact.

BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Helios Gene Gun System References

Fynan EF et al., DNA vaccines: Protective immunizations by parenteral, mucosal, and gene-gun inoculations, Proc Natl Acad Sci USA 90, 1147811482 (1993)9 , ( 99 )

Qiu P et al., Gene gun delivery of mRNA in situ results in efficient transgene expression and genetic immunization, Gene Ther 3, 262268 (1996)

Sun WH et al., In vivo cytokine gene transfer by gene gun reduces t th i i P N tl A d S i USA 92 2889 2893 (1995)tumor growth in mice, Proc Natl Acad Sci USA 92, 28892893 (1995)

Sundaram P et al., Particle-mediated delivery of recombinant expression vectors to rabbit skin induces high titered polyclonal expression vectors to rabbit skin induces high-titered polyclonal antisera (and circumvents purification of a protein immunogen), Nucleic Acids Res 24, 13751377 (1996)


Tang DC et al., Genetic immunization is a simple method for eliciting an immune response, Nature 356, 152154 (1992)

Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation------- Parameters

A number of parameters has been d f d d d b d d identified and need to be considered carefully in experiments involving particle bombardmentparticle bombardment

Parameter categories:Parameter categories:

- Physical parametersBiological parameters- Biological parameters

- Environmental parameters

Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation

Ph i l t------- Parameters

- Physical parametersf Nature, chemical and physical properties of the metal particles used as

a macrocarrier for the foreign DNA

Particles should be high enough mass in order to possess adequate momentum to penetrate into appropriate tissue.

Suitable metal particles include gold, tungsten, palladium, rhodium,platinum and iridium.

Metals should be chemically inert to prevent adverse reaction with

Additional desirable properties for the metal include size and shape, ll l ti d di i ti di t 0 36 6

Metals should be chemically inert to prevent adverse reaction withDNA and cell components.

as well as agglomeration and dispersion propertiesdiameter 0.36-6m.f Nature, preparation and binding of DNA onto the particlesfTarget tissue

- Biological parameters- Environmental parameters

fTarget tissue




a macrocarrier for the foreign DNA

Th t f DNA ( i l d bl t d d i l li i d

f Nature, preparation and binding of DNA onto the particles

The nature of DNA (single vs double stranded, circular vs linerizedDNA). Optimal: double stranded circular DNA molecules (e.g. plasmid)

In the process of coating the metal particls with DNA certain additivesh d d d C Cl b f l such as spermididne and CaCl2 appear to be useful.

fTarget tissue





a macrocarrier for the foreign DNAf Nature, preparation and binding of DNA onto the particlesfTarget tissue It is important to target the appropriate cells that are competent for

both transformation and regeneration.

Depth of penetration is one of the most important variables in order to Depth of penetration is one of the most important variables in order toachieve particle delivery to particular cells.




- Physical parameters- Biological parametersfTemperature, photoperiod and humidity

These parameters have a direct effect on the physiology of tissues.

Such factors will influence receptiveness of target tissue to foreign DNA delivery and also affect its susceptibility to damage and injury DNA delivery and also affect its susceptibility to damage and injury that may adversely affect the outcome of transformation process.

Some explants may require a healing period after bombardment underspecial regiments of light temperature and humidityspecial regiments of light, temperature, and humidity.

- Environmental parameters



- Physical parameters- Biological parameters

E i l- Environmental parameters

Nature of explants as well as pre- and post-bombardment culture conditions.

Explants derived from plants that are under stress will provide inferior materials for bombardment experiments.

Metal particles need to be directed to the nucleus. Transformation frequencies may also be influenced by cell cycle stage.

O f h l b h b f Osmotic pretreatment of target tissues has also been shown to be of importance.

Physical trauma and tungsten toxicity were found to reduce efficiencyf tr nsf rm ti n in experiments perf rmed ith t b cc cell of transformation in experiments performed with tobacco cell

suspension culture.

Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation------- Summary

For biolistic transformation, tungsten or gold particles are coated with DNA and accelerated ptowards target plant tissues. Most devices use compressed helium as the force to accelerate the particles.particles.

The particles punch holes in the plant cell and ususally petetrate only 1-2 cell layerswall . Particle y p y ybombardment is a physical method for DNA introduction.

h d l d h The DNA-coated particles can end up either near or in the nucleus,where the DNA comes off the particles and integrated into plant chromosomal DNA.

Application of Plant Biotechnology-plant Transformation (2010)

Documents

Transcript of Application of Plant Biotechnology-plant Transformation (2010)