Application Note A08-005A Detecting low copy numbers ...
Transcript of Application Note A08-005A Detecting low copy numbers ...
[email protected] | www.bibby-scientific.com +44(01785) 810433 1
Application Note A08-005A
Detecting low copy numbers
Introduction Sensitivity of a qPCR assay is highly dependent on primer efficiency. Not all assays will
be capable of detecting a single copy of template in a reaction due to non-specific
events which may limit the sensitivity of the assay. However all qPCR instruments
should theoretically be able to detect a single copy of target amplified at 100%
efficiency within 40 cycles. This is the point at which the copy is amplified to such an
extent that the fluorescent signal produced by the product exceeds the detection
threshold of the instrument and can be determined above the background of the no
template control samples.
Methods In order to determine as accurately as possible the copy number of the sample, a template of known size was
quantified using a sensitive fluorimetric assay. The template used was Lambda phage DNA (Promega, part code
D150A) which has a genome size of 48502 bp. The number of copies of template can be calculated using the
following formula:
DNA (copies) = 6.022 x 1023
(copies mol-1
) x DNA amount (g)
DNA length (bp) x 660 (g mol-1
bp-1
)
Therefore, each µg of Lambda DNA contains 1.88 x 1010
copies of the genome.
Fluorimetric assay
Lambda template DNA
Calf thymus DNA standard 1mg/ml in TE, pH 8.0
10,000 x SYBR® Green I solution
TE buffer, pH 8.0
The standard DNA was diluted in TE buffer to give a solution of 0.1ng/µl. The 10,000x SYBR® Green solution was
also diluted in TE buffer to give a 2x solution. Various volumes of standard or sample were pipetted into wells of a
96-well PCR plate together with the indicated amounts of TE buffer and SYBR® Green solution to give a range of
standards ranging from 0 to 10ng DNA. The plate was sealed and the fluorescence measured in PrimeQ at 50°C.
Each standard and sample was prepared in triplicate and the fluorescence read 10 times.
DNA (ng) Vol. 0.1ng/µl standard (µl) Vol. TE (µl) Vol. 2x SYBR® Green (µl)
10 100 0 100
8 80 20 100
6 60 40 100
4 40 60 100
2 20 80 100
0 0 100 100
UNK1 50 50 100
UNK2 40 40 100
Table 1: Preparation of standards and samples for quantification.
A standard curve was constructed from the fluorescence values of the standards and used to calculate the
concentration of the unknown Lambda DNA samples.
[email protected] |www.bibby-scientific.com +44(01785) 810433 2
A08-005A: Detecting low copy numbers
PCR
Lambda template DNA
10x primer mix
GoTaq® QPCR Master Mix (2x) (Promega, part code A6001)
Nuclease-free water
The primers were designed using Primer-BLAST (1) to amplify a 155bp target of the Lambda DNA. Details of the
primers are given in Table 2.
Primer name Sequence (5’-3’) Product length (bp) Final conc. in assay Tm used
Lambda 15 For TGCTGCCCTGCTGACGCTTC 155
0.3µM 65°C
Lambda 15 Rev GTGCAGACAGCTGGCGACGT 0.3µM
Table 2: Lambda primers.
The template concentration was adjusted to 0.2x107 copies/µl (5µl = 1x10
7 copies) based on the results of the
fluorimetric assay and using the formula above to calculate the copy number. This was then serially diluted in 1 in
10 in nuclease-free water until reaching 0.2 copies/µl (5µl = 1 copy). Four separate master mixes were prepared,
each sufficient for 12 replicates at each of 100 copies, 10 copies and 1 copy per well of the template DNA and 12
replicates of NTCs. 20µl reactions were used. The samples were amplified according to the thermal cycling program
shown in Table 3.
Stage Number of Cycles Step Temp Time Read/Filter
Enzyme Activation 1 95°C 2 min
Amplification 50
Denaturation 94°C 15 sec
Anneal 65°C 20 sec
Extend 72°C 20 sec FC02, FC04,
Ramp 31 (0.5°C intervals) Ramp 80-95°C 10 sec FC02
Table 3: Thermal cycling program for the Lambda qPCR assay.
Following real-time PCR collection of data, the samples were run on 2% agarose gels to confirm the presence or
absence of PCR products.
Results The concentration of the Lambda phage DNA was determined using a quantitative fluorescence assay using the
intercalating dye SYBR® Green I. Standards and samples were read in a PCR plate using PrimeQ as a plate reader to
obtain the fluorescence values. The standard curve is shown in Figure 1. Using this curve the concentration of
Lambda DNA was determined and the number of copies calculated using the formula described above.
y = 3868.5x + 11070R² = 0.9982
0
10000
20000
30000
40000
50000
60000
0 2 4 6 8 10
RF
U
ng DNA
DNA standard curve
Figure 1: Fluorescence assay DNA standard curve.
The fluorescence was measured by addition of
SYBR® Green I solution to the standard DNA and
detected in PrimeQ. Values are the average of
triplicates, each read 10 times.
[email protected] |www.bibby-scientific.com +44(01785) 810433 3
A08-005A: Detecting low copy numbers
Twelve replicates of 100 copies, 10 copies and 1 copy per well of the template DNA were subjected to 50 cycles of
PCR. The real-time amplification curves and dissociation are shown in Figure 2. The amplification curves show that
all the 100 and 10 copies per well samples amplified, with the 100 copies per well replicates all at very similar Cq
values. Six of the 1 copy per well replicates amplified and the other six were negative, which is to be expected on
the chance that a single copy will be present or absent in the well. Melting analysis of all the single copy replicates
which did amplify indicated that these all had the same Tm as the positives in higher copy number wells.
Some of the no template control (NTC) samples also showed some amplification. On studying the dissociation
curves, the Tm of the peaks shown by the NTC products were either around 81.5°C or 89.4°C compared to 86.8°C
of the positive samples. Therefore the amplification in the NTC samples was not contamination but rather some
unidentified non-specific product(s) which were not amplified in any of the other samples.
Figure 2: Amplification and dissociation curves for each of the Lambda DNA PCRs. The amplification curves are shown from
cycle 20. Red = 100 copies/well; Green = 10 copies/well; Yellow = 1 copy/well; Blue = no template controls (NTC). The
dissociation curves show product melting at 86.8°C together with non-specific products in the NTCs at 81.5°C or 89.4°C.
To clarify the real-time fluorescence results, the samples were run on agarose gels to visualise the PCR products
and these are shown in Figure 3.
Figure 3: Gel analysis of the PCR products. Each gel shows the 12 replicates for each of the four master mixes containing none
(NTC), 1 copy/well, 10 copies/well or 100 copies/well.
[email protected] |www.bibby-scientific.com +44(01785) 810433 4
A08-005A: Detecting low copy numbers
The banding pattern corresponded exactly with the fluorescence amplification curves. The two NTC samples which
gave a product with a high Tm, A1 and A4, gave a band which appeared on the gel to be slightly larger in size than
the bands from the positive samples. Without further analysis it is uncertain what this product is. The very low
molecular weight bands in the other NTCs corresponded to the samples which gave the product with the low Tm
value. These are most likely to be non-specific primer-dimer products.
To determine the certainty with which it was possible to distinguish replicates containing a single copy of the
Lambda DNA from replicates containing higher numbers of copies, the average and SDs of the Cq values for each
replicate group were determined and are shown in Figure 4.
A Student’s t-test was performed to determine the significance between the results. The t-test compares the actual
difference between the means of two sets of data in relation to the variation in the data expressed as the standard
deviation of the difference between the means (2). Calculated results are shown in Table 4.
Copies per well Average Cq SD t (9), p t (16), p t (22), p
0 42.16 3.03 6.31, <0.001
1 34.07 0.85 7.18, <0.001
10 31.47 0.66 17.8, <0.001
100 27.87 0.25
Table 4: Average Cq and SD for each of the replicate groups. A Student’s t-test (2, 3) performed on neighbouring replicate
groups indicates that the differences between the paired sets of samples are "very highly significant" with probability, p (of the
difference being due to chance) <0.001 for each pair tested.
The results indicate that the average Cq values from each replicate group are significantly different from each
other.
Conclusions
The determination of initial copy number was based on a sensitive fluorimetric DNA assay using a purchased
standard DNA and the copy number calculated using the molecular weight of the Lambda DNA template. The
results reflect what would be expected by diluting this DNA down to a theoretical single copy per reaction.
Amplification of low copy numbers generally involves increasing the number of cycling steps and this, together
with the lack of competition from target template in the reaction can increase the chance that products will be
amplified in the NTC samples. Tm analysis can help to identify whether any NTC products are due to
contamination, primer dimer amplification or non-specific amplification.
25
30
35
40
45
50
0 1 10 100
Cq
va
lue
Template copies per well
Average Cq
Figure 4: Average Cq data for each replicate
group plotted on a bar graph showing 1 SD
error bars.
[email protected] |www.bibby-scientific.com +44(01785) 810433 5
A08-005A: Detecting low copy numbers
The limit of detection (LOD) of qPCR assays is often determined by stochastic effects such as reaction efficiency and
whether or not non-specific products are formed. The LOD is defined as the lowest concentration at which 95% of
the positive samples are detected (4). In the tests performed here, the LOD would be below 10 copies per reaction
since 100% of the 10 copies per well samples amplified. The lowest theoretical LOD per PCR is 3 copies; this
assumes a Poisson distribution of positive and negative results, a 95% chance of including at least 1 copy in the PCR
and single-copy detection (4). The Poisson distribution predicts that in a large number of replicates containing an
average of one copy of starting template, about 37% should actually have no copies, about 37% should contain one
copy and about 18% should contain two copies (5). In the assay described in this application note, 50% of the single
copy per well reactions amplified which may indicate slightly more than 1 copy per well on average.
References (1) http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome
(2) http://archive.bio.ed.ac.uk/jdeacon/statistics/tress4a.html
(3) http://www.physics.csbsju.edu/stats/t-test.html
(4) Bustin SA, Benes V, et al. (2009) The MIQE Guidelines: minimum information for publication of quantitative
real-time PCR experiments. Clin Chem, 55(4): 611−622.
(5) http://www.invitrogen.com/etc/medialib/en/filelibrary/Nucleic-Acid-Amplification-Expression-
Profiling/PDFs.Par.70657.File.dat/Understanding%20Ct%20Application%20Note.pdf.
Trademarks
SYBR® is a registered trademark of Molecular Probes, Inc.