Appendix I

DNA EXTRACTION

Fresh tissue samples of caudal fin, pectoral fin, dorsal fin or muscle were

dissected and preserved in 95% ethanol (EtOH). Total genomic DNA was

extracted following a minor modified version of the salting out protocol

described by Miller et al. (1988).

EXTRACTION PROTOCOL

Reagents Required:-

Stock Solutions:-

1. 0.5M Tris Cl (pH-8.0) 2. 0.5M EDTA (pH-8.0)

Tris base - 3.028 g EDTA – 9.31 g

Distilled water - 40 ml Distilled water – 40 ml

Adjust pH to 8.0 using HCl. Adjust pH to 8.0 using NaOH.

Make up the volume to 50 ml, Make up the volume to 50 ml,

autoclaved and stored at 4°C. autoclaved and stored at 4°C

3. 10mM Tris Cl (pH-7.5) 4. RNAase buffer

Tris base – 0.030 g 10mM Tris Cl (pH 7.5) – 10 ml

Tris base – 0.030 g 15mM NaCl – 30 ml

Distilled water – 20 ml Distilled water – 960 ml

Adjust pH to 7.5 using HCl.

Autoclaved and stored at 4°C.

Make up the volume to 25 ml,

autoclaved and stored at 4°C.

Working Solutions:-

1. Solution 1 2. Solution 2

Tris-HCl (pH8.0) – 50 mM NaCl solution (saturated) - 6 M

EDTA (pH8.0) – 20 mM Prepared in double distilled water.

SDS – 2 % Autoclaved and stored at 4°C

Appendix

202

Prepared in double distilled water.

Autoclaved and stored at 4°C

3. Proteinase K 4. TE buffer

Proteinase K – 20 mg/ml Tris Cl (pH-8.0) - 10 mM

Prepared in autoclaved double EDTA (pH-8.0) - 1 mM

distilled water and stored at -20°C. Prepared in double distilled water.

Autoclaved and stored at 4°C.

5. RNAase

RNAase - 10 mg/ml of RNAase

buffer (autoclaved)

Steps Involved:-

Tissue stored in ethanol was washed with TRIS buffer (pH 8.0) by spinning

Tissue sample was placed directly into 500 μl of Solution 1; in a 1.5 ml

eppendorf tube

After the addition 5 μl of Proteinase K (20mg/ml) samples were incubated

at 55°C in water bath for 2 hours for digestion (with occasional mixing).

Sample was chilled on ice for 10 minutes to deactivate enzyme activity.

250ml of solution 2 was added and tubes were inverted several times to

mix.

Sample was then chilled on ice for a further 5 minutes.

The sample was then spun at 8000 rpm for 15 minutes at 4ºC to pellet

cellular debris and Nacl.

About 500 ml of the clear supernatant was carefully collected into a new-

labeled 1.5 ml eppendorf tube with wide-bore filter tip.

If the supernatant was not clear

Appendix

203

To precipitate the DNA from this solution twice the volume of 100% AR

grade ethanol was added and left overnight at -20°C.

The next day spinning was done at 11,000 rpm for 15 minutes at room

temperature to pellet the DNA.

The supernatant was completely removed before DNA pellet was rinsed

with 250ml of cold 70% ethanol.

Spinning was done at 11,000 rpm for 5 minutes at room temperature

and the supernatant was again carefully discarded and DNA was left to

dry with lid off at room temperature.

Partially dried DNA was then resuspended in 50-200ml (depending on

the size of the pellet) of TE Buffer (pH-8) by gently pipetting sample with

wide-bore filter tip until dissolved before storage at –20°C for further

use.

Appendix

204

Appendix II

Determination of Quality of DNA Isolated

Agarose electrophoresis and visualization of bands

Reagents required:-

1. TBE buffer 10X (pH-8.0) 2. Gel loading buffer

Tris base – 10.8 g Bromophenol blue – 0.5%

Boric acid – 5.5 g Glycerol (mol. grade) – 30%

EDTA – 0.75 g Prepared in 1X TBE

Make up the solution to 100 ml Stored at 4°C.

with double distilled water.

Autoclaved and stored at 4°C

3. Agarose solution (0.8%) 4. 1X TBE buffer

Agarose – 0.24 g 10X TBE – 10 ml

10X TBE – 3 ml Distilled Water – 90 ml

Distilled Water – 27 ml

5. Ethidium bromide solution

Ethidium bromide – 10 mg

Distilled water – 2 ml

Steps involved in casting of 0.8% Agarose Gel

Manufacturer’s instructions were followed for setting up of the agarose

gel casting unit System.

Agarose solution was heated to dissolve agarose.

2.5 ml of Ethidium bromide (EtBr) was added before cooling down to

50°C (Approx.) and poured into the gel casting plate (Capacity 30 ml)

with already adjusted gel comb.

Appendix

205

The solution was let to solidify at room temperature for half an hour for

the gel to set.

The gel was placed in the electrophoresis unit.

Cold 1 x TBE was used as gel running buffer (electrolyte) in the

electrophoresis unit.

2-5 ml of DNA solution mixed with 2 ml of gel loading buffer was loaded

in each wells

The gel was run at constant voltage 90 V for 20 to 30 minutes.

After electrophoresis the gel was visualized under UV transilluminator

and the image was captured and documented using ImageMaster VDS

(Pharmacia Biotech, USA).

Appendix

206

Appendix III

PCR Sequencing and Clean-up Protocol

Test RUN AND PCR CLEAN-UP

Verification of successful amplification was assessed by agarose gel

electrophoresis. 5 ml PCR product (1-2 ng ml-1

) (Sambrook et al., 1989; White

& Wu, 2001) mixed with 2 ml of gel loading buffer was then run on 1.8% agarose

gel (10 x 4 cm) stained with 2.5 μl EtBr (0.5μg/ml) in 1X TBE buffer (pH 8.0) at

constant voltage of 90V for one hour to check the amplification of the specified

gene. A molecular weight standard ladder was also included in one of the wells

on each agarose gel. The gel was visualized under UV transilluminator and the

image was captured and documented using ImageMaster VDS (Pharmacia

Biotech, USA).

Successfully amplified product was cleaned using GeNeiTM Quick PCR

purification kit (Genei, Bangalore, India) following the manufacturer’s

instructions. After clean-up product was again run on 1.8% agarose gel to check

recovery rate of clean-up procedure.

SEQUENCING PCR PROTOCOL

The recipe for sequencing reactions of clean PCR product with PTC 200

gradient thermal cycler (M.J. research, Inc., Watertown, Massachusetts, USA)

was as follows:

Reaction mixture:-

Components Volume Per Reaction

Template DNA (10 –20 ng/μl) 1.0 μl

Double distilled sterile water 5.8 μl

BigDye Sequencing Buffer (1X dilution) 1.5 μl

Primer (forward or reverse; 10 pmol/ml) 0.7 μl

BigDye Terminator Mix Version 3.1TM

1.0 μl

Total Volume 10.0 μl

Appendix

207

Sequencing PCR conditions:-

Steps Temperature Time Cycles

Denaturation 95°C 30 seconds

Annealing 50°C 5 seconds 24

Extension 60°C 4 minutes

Soak 4°C 3

Sequencing Clean-up:-

The resulting cycle sequencing fragments were cleaned up by Ethanol

precipitation protocol as follows:-

2.5 ml of 0.5M EDTA was taken and volume was made upto 10 ml by

adding Double distilled water to make 125 mM EDTA.

2μl of 125 mM EDTA (freshly prepared) was added to each tube containing

the sequencing PCR product

Total volume was adjused to 100μl by adding double distilled (autoclaved)

water and mixed well.

The entire content of the sequencing reaction was transferred into a 1.5

ml eppendorf tube and 10μl of 3M sodium acetate (pH 4.6) was added to

each tube.

250μl of 100% chilled ethanol was added and mixed gently.

The mixture was incubated at room temperature for 15 minutes.

The tubes were spun for 20 minutes at 12,000 rpm at room temperature

with hinge of the tubes facing out (DNA pellet will be on this side).

Appendix

208

All the supernatant was immediately aspirated off avoiding the pellet.

Opposite the hinged side was aimed, which was opposite the pellet.

Pipetting was started from the top of the solution, aspirating slowly

downwards.

250 μl of 70% chilled ethanol was added.

Spinning was done for 5 minutes at 12,000 rpm with tubes in the same

orientation as previous spin.

All the supernatant was carefully and completely aspirated off.

The above steps of 70% ethanol wash was repeated twice.

The supernatant was decanted and the pellet was air dried for 30-45

minutes on heating block at 45°C

The tubes with DNA were wrapped in aluminium foil and stored at 4°C

until they were transported to the sequencing facility in light-proof

conditions.

Bidirectional sequencing using ABI 3730 Sequencer (Applied Biosystems)

Appendix

209

Appendix IV

Partial sequences (Haplotypes only) of mitochondrial large subunit

16SrRNA submitted to NCBI

Sl. Accession Details

No. Numbers

1 KC774719 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Anabas oligolepis haplotype (AnolH1) 16SrRNA; partial

sequence; 560 bp linear DNA; 02-MAR-2013.

2 KC774720 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Anabas oligolepis haplotype (AnolH2) 16SrRNA; partial

sequence; 529 bp linear DNA; 02-MAR-2013.

3 KC774721 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Anabas oligolepis haplotype (AnolH3) 16SrRNA; partial

sequence; 529 bp linear DNA; 02-MAR-2013.

4 KC774722 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Anabas testudineus haplotype (AnteH1) 16SrRNA; partial

sequence; 552 bp linear DNA; 02-MAR-2013.

5 KC774723 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

assamensis haplotype (BaasH1) 16SrRNA; partial sequence; 557

bp linear DNA; 02-MAR-2013.

6 KC774724 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

assamensis haplotype (BaasH2) 16SrRNA; partial sequence; 557

bp linear DNA; 02-MAR-2013.

7 KC774725 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

badis haplotype (BabaH1) 16SrRNA; partial sequence; 545 bp

linear DNA; 02-MAR-2013.

8 KC774726 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

badis haplotype (BabaH2) 16SrRNA; partial sequence; 545 bp

linear DNA; 02-MAR-2013.

9 KC774727 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

badis haplotype (BabaH3) 16SrRNA; partial sequence; 545 bp

linear DNA; 02-MAR-2013.

10 KC774728 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Dario

dario haplotype (DadaH1) 16SrRNA; partial sequence; 537 bp

linear DNA; 02-MAR-2013.

Appendix

210

11 KC774729 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Dario

dario haplotype (DadaH2) 16SrRNA; partial sequence; 537 bp

linear DNA; 02-MAR-2013.

12 KC774730 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Gerres

abbreviatus haplotype (GeabH1) 16SrRNA; partial sequence; 558

bp linear DNA; 02-MAR-2013.

13 KC774731 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Gerres

filamentosus haplotype (GefiH1) 16SrRNA; partial sequence; 562

bp linear DNA; 02-MAR-2013.

14 KC774734 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

marmoratus haplotype (NamaH1) 16SrRNA; partial sequence;

573 bp linear DNA; 02-MAR-2013.

15 KC774735 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

nandus haplotype (NanaH1) 16SrRNA; partial sequence; 561 bp

linear DNA; 02-MAR-2013.

16 KC774736 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

nandus haplotype (NanaH2) 16SrRNA; partial sequence; 561 bp

linear DNA; 02-MAR-2013.

17 KC774737 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Pristolepis

marginata haplotype (PrmaH1) 16SrRNA; partial sequence; 545

bp linear DNA; 03-MAR-2013.

18 KC774738 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Pristolepis

rubripinnis haplotype (PrruH1) 16SrRNA; partial sequence; 601

bp linear DNA; 03-MAR-2013.

19 KC774739 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Pristolepis

rubripinnis haplotype (PrruH2) 16SrRNA; partial sequence; 601

bp linear DNA; 03-MAR-2013.

20 KC774740 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Scatophagus argus haplotype (ScarH1) 16SrRNA; partial

sequence; 551 bp linear DNA; 03-MAR-2013.

21 KC774741 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

sihama haplotype (SisiH1) 16SrRNA; partial sequence; 608 bp

linear DNA; 03-MAR-2013.

22 KC774742 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

vincenti haplotype (SiviH1) 16SrRNA; partial sequence; 620 bp

linear DNA; 03-MAR-2013.

23 KC774743 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

vincenti haplotype (SiviH2) 16SrRNA; partial sequence; 619 bp

linear DNA; 03-MAR-2013.

24 KC774744 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Terapon

jarbua haplotype (TejaH1) 16SrRNA; partial sequence; 561 bp

linear DNA; 03-MAR-2013.

25 KC774745 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Terapon

puta haplotype (TepuH1) 16SrRNA; partial sequence; 561 bp

linear DNA; 03-MAR-2013.

26 KC774746 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Terapon

theraps haplotype (TethH1) 16SrRNA; partial sequence; 557 bp

linear DNA; 03-MAR-2013.

Appendix

211

27 KC774747 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Ambassis

commersoni haplotype (AmcoH1) 16SrRNA; partial sequence; 571

bp linear DNA; 02-MAR-2013.

28 KC774748 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Ambassis

commersoni haplotype (AmcoH2) 16SrRNA; partial sequence; 571

bp linear DNA; 02-MAR-2013.

29 KC774749 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Ambassis

commersoni haplotype (AmcoH3) 16SrRNA; partial sequence; 571

bp linear DNA; 02-MAR-2013.

30 KC774750 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Chanda

nama haplotype (ChnaH1) 16SrRNA; partial sequence; 521 bp

linear DNA; 02-MAR-2013.

31 KC774751 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Chanda

nama haplotype (ChnaH2) 16SrRNA; partial sequence; 521 bp

linear DNA; 02-MAR-2013.

32 KC774752 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

fasciatus haplotype (CofaH1) 16SrRNA; partial sequence; 555 bp

linear DNA; 02-MAR-2013.

33 KC774753 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

lalia haplotype (ColaH1) 16SrRNA; partial sequence; 559 bp linear

DNA; 02-MAR-2013.

34 KC774754 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

lalia haplotype (ColaH2) 16SrRNA; partial sequence; 559 bp linear

DNA; 02-MAR-2013.

35 KC774755 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

sota haplotype (CosoH1) 16SrRNA; partial sequence; 545 bp

linear DNA; 02-MAR-2013.

36 KC774756 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis dayi haplotype (PadaH1) 16SrRNA; partial

sequence; 570 bp linear DNA; 02-MAR-2013.

37 KC774757 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis lala haplotype (PalaH1) 16SrRNA; partial sequence;

548 bp linear DNA; 02-MAR-2013.

38 KC774758 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis ranga haplotype (ParaH1) 16SrRNA; partial

sequence; 560 bp linear DNA; 02-MAR-2013.

39 KC774759 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis ranga haplotype (ParaH2) 16SrRNA; partial

sequence; 560 bp linear DNA; 02-MAR-2013.

40 KC774760 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis thomassi haplotype (PathH1) 16SrRNA; partial

sequence; 513 bp linear DNA; 02-MAR-2013.

41 KC774761 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis thomassi haplotype (PathH2) 16SrRNA; partial

sequence; 515 bp linear DNA; 02-MAR-2013.

42 KC774762 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Pseudosphromenus cupanus haplotype (PscuH1) 16SrRNA; partial

sequence; 534 bp linear DNA; 02-MAR-2013.

Appendix

212

43 KC774763 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Pseudosphromenus dayi haplotype (PsdaH1) 16SrRNA; partial

sequence; 542 bp linear DNA; 02-MAR-2013.

44 KC835200 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Channa

diplogramma haplotype (ChdiH1) 16SrRNA; partial sequence;

526 bp linear DNA; 27-MAR-2013.

45 KC835201 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

canarensis haplotype (EtcaH1) 16SrRNA; partial sequence; 522

bp linear DNA; 27-MAR-2013.

46 KC835202 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

canarensis haplotype (EtcaH2) 16SrRNA; partial sequence; 522

bp linear DNA; 27-MAR-2013.

47 KC835203 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

maculatus haplotype (EtmaH2) 16SrRNA; partial sequence; 522

bp linear DNA; 27-MAR-2013.

48 KC835204 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

suratensis haplotype (EtsuH1) 16SrRNA; partial sequence; 523

bp linear DNA; 27-MAR-2013.

49 KC835205 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

suratensis haplotype (EtsuH2) 16SrRNA; partial sequence; 523

bp linear DNA; 27-MAR-2013.

50 KC835206 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

species 1 haplotype (Sisp1H1) 16SrRNA; partial sequence; 531

bp linear DNA; 27-MAR-2013.

51 KC835207 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

species 1 haplotype (Sisp1H2) 16SrRNA; partial sequence; 531

bp linear DNA; 27-MAR-2013.

52 KC835208 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

species 2 haplotype (Sisp2H1) 16SrRNA; partial sequence; 538

bp linear DNA; 27-MAR-2013.

Partial sequences (Haplotypes only) of mitochondrial Cytochrome-c oxidase subunit I (COI)

submitted to NCBI

Sl. Accession Details

No. Numbers

1 KC774633 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Ambassis

commersoni haplotype (AmcoH1) Cytochrome oxidase subunit I

(COI); partial sequence; 659 bp linear DNA; 04-MAR-2013.

2 KC774634 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Ambassis

commersoni haplotype (AmcoH2) Cytochrome oxidase subunit I

(COI); partial sequence; 659 bp linear DNA; 04-MAR-2013.

3 KC774635 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Anabas oligolepis haplotype (AnolH1) Cytochrome oxidase

subunit I (COI); partial sequence; 647 bp linear DNA; 04-MAR-2013.

4 KC774636 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena J.K.;

Anabas oligolepis haplotype (AnolH2) Cytochrome oxidase subunit

I (COI); partial sequence; 652 bp linear DNA; 04-MAR-2013.

5 KC774637 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Anabas testudineus haplotype (AnteH1) Cytochrome

Appendix

213

oxidase subunit I (COI); partial sequence; 655 bp linear DNA;

04-MAR-2013.

6 KC774638 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

assamensis haplotype (BaasH1) Cytochrome oxidase subunit I

(COI); partial sequence; 632 bp linear DNA; 04-MAR-2013.

7 KC774639 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

assamensis haplotype (BaasH2) Cytochrome oxidase subunit I

(COI); partial sequence; 632 bp linear DNA; 04-MAR-2013.

8 KC774640 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

badis haplotype (BabaH1) Cytochrome oxidase subunit I (COI);

partial sequence; 633 bp linear DNA; 04-MAR-2013.

9 KC774641 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

badis haplotype (BabaH2) Cytochrome oxidase subunit I (COI);

partial sequence; 633 bp linear DNA; 04-MAR-2013.

10 KC774642 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Chanda

nama haplotype (ChnaH1) Cytochrome oxidase subunit I (COI);

partial sequence; 648 bp linear DNA; 04-MAR-2013.

11 KC774643 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Chanda

nama haplotype (ChnaH2) Cytochrome oxidase subunit I (COI);

partial sequence; 648 bp linear DNA; 04-MAR-2013.

12 KC774644 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

fasciatus haplotype (CofaH1) Cytochrome oxidase subunit I (COI);

partial sequence; 667 bp linear DNA; 04-MAR-2013.

13 KC774645 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

lalia haplotype (ColaH1) Cytochrome oxidase subunit I (COI);

partial sequence; 666 bp linear DNA; 04-MAR-2013.

14 KC774646 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

lalia haplotype (ColaH2) Cytochrome oxidase subunit I (COI);

partial sequence; 666 bp linear DNA; 04-MAR-2013.

15 KC774647 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

sota haplotype (CosoH1) Cytochrome oxidase subunit I (COI);

partial sequence; 638 bp linear DNA; 04-MAR-2013.

16 KC774648 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Dario

dario haplotype (DadaH1) Cytochrome oxidase subunit I (COI);

partial sequence; 637 bp linear DNA; 04-MAR-2013.

17 KC774649 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Gerres

abbreviatus haplotype (GeabH1) Cytochrome oxidase subunit I

(COI); partial sequence; 634 bp linear DNA; 04-MAR-2013.

18 KC774650 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Gerres

filamentosus haplotype (GefiH1) Cytochrome oxidase subunit I

(COI); partial sequence; 626 bp linear DNA; 04-MAR-2013.

19 KC774651 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

marmoratus haplotype (NamaH1) Cytochrome oxidase subunit

I (COI); partial sequence; 648 bp linear DNA; 04-MAR-2013.

20 KC774652 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

marmoratus haplotype (NamaH2) Cytochrome oxidase subunit

I (COI); partial sequence; 648 bp linear DNA; 04-MAR-2013.

21 KC774653 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

marmoratus haplotype (NamaH3) Cytochrome oxidase subunit

I (COI); partial sequence; 648 bp linear DNA; 04-MAR-2013.

Appendix

214

22 KC774654 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

nandus haplotype (NanaH1) Cytochrome oxidase subunit I (COI);

partial sequence; 647 bp linear DNA; 04-MAR-2013.

23 KC774655 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

nandus haplotype (NanaH2) Cytochrome oxidase subunit I (COI);

partial sequence; 647 bp linear DNA; 04-MAR-2013.

24 KC774656 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis dayi haplotype (PadaH1) Cytochrome oxidase subunit

I (COI); partial sequence; 632 bp linear DNA; 04-MAR-2013.

25 KC774657 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis dayi haplotype (PadaH2) Cytochrome oxidase subunit

I (COI); partial sequence; 632 bp linear DNA; 04-MAR-2013.

26 KC774658 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis lala haplotype (PalaH1) Cytochrome oxidase subunit

I (COI); partial sequence; 640 bp linear DNA; 04-MAR-2013.

27 KC774659 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis ranga haplotype (ParaH1) Cytochrome oxidase

subunit I (COI); partial sequence; 643 bp linear DNA; 04-MAR-2013.

28 KC774660 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis ranga haplotype (ParaH2) Cytochrome oxidase

subunit I (COI); partial sequence; 643 bp linear DNA; 04-MAR-2013.

29 KC774661 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis thomassi haplotype (PathH1) Cytochrome oxidase

subunit I (COI); partial sequence; 639 bp linear DNA; 04-MAR-2013.

30 KC774662 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Pristolepis

marginata haplotype (PrmaH1) Cytochrome oxidase subunit I

(COI); partial sequence; 639 bp linear DNA; 04-MAR-2013.

31 KC774663 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Pristolepis

rubripinnis haplotype (PrruH1) Cytochrome oxidase subunit I

(COI); partial sequence; 641 bp linear DNA; 04-MAR-2013.

32 KC774664 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Pristolepis

rubripinnis haplotype (PrruH2) Cytochrome oxidase subunit I

(COI); partial sequence; 641 bp linear DNA; 04-MAR-2013.

33 KC774665 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Pseudosphromenus cupanus haplotype (PscuH1) Cytochrome

oxidase subunit I (COI); partial sequence; 650 bp linear DNA; 04-

MAR-2013.

34 KC774666 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Pseudosphromenus cupanus haplotype (PscuH2) Cytochrome

oxidase subunit I (COI); partial sequence; 650 bp linear DNA; 04-

MAR-2013.

35 KC774667 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Pseudosphromenus dayi haplotype (PsdaH1) Cytochrome oxidase

subunit I (COI); partial sequence; 639 bp linear DNA; 04-MAR-2013.

36 KC774668 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Scatophagus argus haplotype (ScarH1) Cytochrome oxidase

subunit I (COI); partial sequence; 627 bp linear DNA; 04-MAR-2013.

37 KC774669 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

sihama haplotype (SisiH1) Cytochrome oxidase subunit I (COI);

partial sequence; 627 bp linear DNA; 04-MAR-2013.

Appendix

215

38 KC774670 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

vincenti haplotype (SiviH1) Cytochrome oxidase subunit I (COI);

partial sequence; 675 bp linear DNA; 04-MAR-2013.

39 KC774671 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

vincenti haplotype (SiviH2) Cytochrome oxidase subunit I (COI);

partial sequence; 675 bp linear DNA; 04-MAR-2013.

40 KC774672 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

vincenti haplotype (SiviH3) Cytochrome oxidase subunit I (COI);

partial sequence; 675 bp linear DNA; 04-MAR-2013.

41 KC774673 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

vincenti haplotype (SiviH4) Cytochrome oxidase subunit I (COI);

partial sequence; 675 bp linear DNA; 04-MAR-2013.

42 KC774674 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Terapon

jarbua haplotype (TejaH1) Cytochrome oxidase subunit I (COI);

partial sequence; 646 bp linear DNA; 04-MAR-2013.

43 KC774675 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Terapon

puta haplotype (TepuH1) Cytochrome oxidase subunit I (COI);

partial sequence; 636 bp linear DNA; 04-MAR-2013.

44 KC774676 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Terapon

puta haplotype (TepuH2) Cytochrome oxidase subunit I (COI);

partial sequence; 636 bp linear DNA; 04-MAR-2013.

45 KC774677 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Terapon

puta haplotype (TethH1) Cytochrome oxidase subunit I (COI);

partial sequence; 648 bp linear DNA; 04-MAR-2013.

46 KC858282 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

canarensis haplotype (EtcaH1) Cytochrome oxidase subunit I

(COI); partial sequence; 649 bp linear DNA; 27-MAR-2013.

47 KC858283 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

canarensis haplotype (EtcaH2) Cytochrome oxidase subunit I

(COI); partial sequence; 649 bp linear DNA; 27-MAR-2013.

48 KC852884 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

maculatus haplotype (EtmaH1) Cytochrome oxidase subunit I

(COI); partial sequence; 649 bp linear DNA; 29-MAR-2013.

49 KC858285 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

suratensis haplotype (EtsuH1) Cytochrome oxidase subunit I

(COI); partial sequence; 655 bp linear DNA; 29-MAR-2013.

50 KC858286 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

suratensis haplotype (EtsuH2) Cytochrome oxidase subunit I

(COI); partial sequence; 655 bp linear DNA; 29-MAR-2013.

51 KC858287 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

species 1 haplotype (Sisp1H1) Cytochrome oxidase subunit I

(COI); partial sequence; 628 bp linear DNA; 27-MAR-2013.

52 KC858288 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

species 1 haplotype (Sisp1H2) Cytochrome oxidase subunit I

(COI); partial sequence; 628 bp linear DNA; 27-MAR-2013.

53 KC858289 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

species 2 haplotype (Sisp2H1) Cytochrome oxidase subunit I

(COI); partial sequence; 629 bp linear DNA; 27-MAR-2013.

Appendix

216

Partial sequences (Haplotypes only) of mitochondrial Cytochrome b (Cyt b) subunit I (COI)

submitted to NCBI

Sl. Accession Details

No. Numbers

1 KC774678 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Ambassis

commersoni haplotype (AmcoH1) Cytochrome b (Cyt b); partial

sequence; 1135 bp linear DNA; 04-MAR-2013.

2 KC774679 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Ambassis

commersoni haplotype (AmcoH2) Cytochrome b (Cyt b); partial

sequence; 1135 bp linear DNA; 04-MAR-2013.

3 KC774680 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Ambassis

commersoni haplotype (AmcoH3) Cytochrome b (Cyt b); partial

sequence; 1135 bp linear DNA; 04-MAR-2013.

4 KC774681 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Anabas oligolepis haplotype (AnolH1) Cytochrome b (Cyt

b); partial sequence; 1094 bp linear DNA; 04-MAR-2013.

5 KC774682 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Anabas testudineus haplotype (AnteH1) Cytochrome b (Cyt

b); partial sequence; 1103 bp linear DNA; 05-MAR-2013.

6 KC774683 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Anabas testudineus haplotype (AnteH2) Cytochrome b (Cyt

b); partial sequence; 1103 bp linear DNA; 05-MAR-2013.

7 KC774684 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

assamensis haplotype (BaasH1) Cytochrome b (Cyt b); partial

sequence; 978 bp linear DNA; 05-MAR-2013.

8 KC774685 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

assamensis haplotype (BaasH2) Cytochrome b (Cyt b); partial

sequence; 978 bp linear DNA; 05-MAR-2013.

9 KC774686 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

assamensis haplotype (BaasH3) Cytochrome b (Cyt b); partial

sequence; 978 bp linear DNA; 05-MAR-2013.

10 KC774687 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

badis haplotype (BabaH1) Cytochrome b (Cyt b); partial

sequence; 1053 bp linear DNA; 05-MAR-2013.

11 KC774688 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Badis

badis haplotype (BabaH2) Cytochrome b (Cyt b); partial

sequence; 1053 bp linear DNA; 05-MAR-2013.

12 KC774689 Lenka S., Gopalakrishnan A., Basheer V.S., Divya P.R. and Jena

J.K. Channa diplogramma haplotype (ChdiH1) Cytochrome b (Cyt

b); partial sequence; 1100 bp linear DNA; 05-MAR-2013.

13 KC774690 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Chanda

nama haplotype (ChnaH1) Cytochrome b (Cyt b); partial

sequence; 868 bp linear DNA; 05-MAR-2013.

14 KC774691 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Chanda

nama haplotype (ChnaH2) Cytochrome b (Cyt b); partial

sequence; 868 bp linear DNA; 05-MAR-2013.

15 KC774692 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

lalia haplotype (ColaH1) Cytochrome b (Cyt b); partial sequence;

1119 bp linear DNA; 05-MAR-2013.

Appendix

217

16 KC774693 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

lalia haplotype (ColaH2) Cytochrome b (Cyt b); partial sequence;

1119 bp linear DNA; 05-MAR-2013.

17 KC774694 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Colisa

sota haplotype (CosoH1) Cytochrome b (Cyt b); partial sequence;

1108 bp linear DNA; 05-MAR-2013.

18 KC774695 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Dario

dario haplotype (DadaH1) Cytochrome b (Cyt b); partial

sequence; 1111 bp linear DNA; 05-MAR-2013.

19 KC774696 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

canarensis haplotype (EtcaH1) Cytochrome b (Cyt b); partial

sequence; 1050 bp linear DNA; 05-MAR-2013.

20 KC774697 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

canarensis haplotype (EtcaH2) Cytochrome b (Cyt b); partial

sequence; 1050 bp linear DNA; 05-MAR-2013.

21 KC774698 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

maculatus haplotype (EtmaH1) Cytochrome b (Cyt b); partial

sequence; 1044 bp linear DNA; 05-MAR-2013.

22 KC774699 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

maculatus haplotype (EtmaH2) Cytochrome b (Cyt b); partial

sequence; 1044 bp linear DNA; 05-MAR-2013.

23 KC774700 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

maculatus haplotype (EtmaH3) Cytochrome b (Cyt b); partial

sequence; 1044 bp linear DNA; 05-MAR-2013.

24 KC774701 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Etroplus

suratensis haplotype (EtsuH1) Cytochrome b (Cyt b); partial

sequence; 1066 bp linear DNA; 05-MAR-2013.

25 KC774702 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Gerres

abbreviatus haplotype (GeabH1) Cytochrome b (Cyt b); partial

sequence; 1092 bp linear DNA; 05-MAR-2013.

26 KC774703 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Gerres

filamentosus haplotype (GefiH1) Cytochrome b (Cyt b); partial

sequence; 1013 bp linear DNA; 05-MAR-2013.

27 KC774704 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Gerres

filamentosus haplotype (GefiH2) Cytochrome b (Cyt b); partial

sequence; 1013 bp linear DNA; 05-MAR-2013.

28 KC774705 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

marmoratus haplotype (NamaH1) Cytochrome b (Cyt b); partial

sequence; 1104 bp linear DNA; 05-MAR-2013.

29 KC774706 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Nandus

nandus haplotype (NanaH1) Cytochrome b (Cyt b); partial

sequence; 1098 bp linear DNA; 05-MAR-2013.

30 KC774707 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis dayi haplotype (PadaH1) Cytochrome b (Cyt b);

partial sequence; 1105 bp linear DNA; 05-MAR-2013.

31 KC774708 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis lala haplotype (PalaH1) Cytochrome b (Cyt b);

partial sequence; 888 bp linear DNA; 05-MAR-2013.

32 KC774709 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Appendix

218

Parambassis lala haplotype (PalaH2) Cytochrome b (Cyt b);

partial sequence; 888 bp linear DNA; 05-MAR-2013.

33 KC774710 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Parambassis thomassi haplotype (PathH1) Cytochrome b (Cyt

b); partial sequence; 1104 bp linear DNA; 05-MAR-2013.

34 KC774711 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Pseudosphromenus cupanus haplotype (PscuH1) Cytochrome b

(Cyt b); partial sequence; 1107 bp linear DNA; 05-MAR-2013.

35 KC774712 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.;

Pseudosphromenus dayi haplotype (PsdaH1) Cytochrome b (Cyt

b); partial sequence; 1142 bp linear DNA; 05-MAR-2013.

36 KC774713 Lenka S., Gopalakrishnan A., Basheer V.S., Raj K. and Jena J.K.;

Scatophagus argus haplotype (ScarH1) Cytochrome b (Cyt b);

partial sequence; 943 bp linear DNA; 05-MAR-2013.

37 KC774714 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

sihama haplotype (SisiH1) Cytochrome b (Cyt b); partial

sequence; 966 bp linear DNA; 05-MAR-2013.

38 KC774715 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

vincenti haplotype (SiviH1) Cytochrome b (Cyt b); partial

sequence; 1107 bp linear DNA; 05-MAR-2013.

39 KC774716 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

vincenti haplotype (SiviH2) Cytochrome b (Cyt b); partial

sequence; 1107 bp linear DNA; 05-MAR-2013.

40 KC774717 Lenka S., Gopalakrishnan A., Basheer V.S., Divya P.R. and Jena

J.K. Terapon jarbua haplotype (TejaH1) Cytochrome b (Cyt b);

partial sequence; 1074 bp linear DNA; 05-MAR-2013.

41 KC774718 Lenka S., Gopalakrishnan A., Basheer V.S., Divya P.R. and Jena

J.K. Terapon jarbua haplotype (TejaH2) Cytochrome b (Cyt b);

partial sequence; 1074 bp linear DNA; 05-MAR-2013.

42 KC858290 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Pristolepis rubripinnis haplotype (PrruH1) Cytochrome b (Cyt

b); partial sequence; 1065 bp linear DNA; 29-MAR-2013.

43 KC858291 Lenka S., Gopalakrishnan A., Basheer V.S., Sajeela K.A. and Jena

J.K.; Pristolepis rubripinnis haplotype (PrruH2) Cytochrome b (Cyt

b); partial sequence; 1065 bp linear DNA; 29-MAR-2013.

44 KC858292 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Sillago

species 2 haplotype (Sisp2H1) Cytochrome b (Cyt b); partial

sequence; 980 bp linear DNA; 29-MAR-2013.

45 KC880525 Lenka S., Gopalakrishnan A., Basheer V.S. and Jena J.K.; Pristolepis

marginata haplotype (PrmaH1) Cytochrome b (Cyt b); partial

sequence; 980 bp linear DNA; 29-MAR-2013.

MOLECULAR IDENTIFICATION AND PHYLOGENY OF MOLECULAR IDENTIFICATION AND PHYLOGENY OF FRESHWATER PERCHES OF INDIAN WATERFRESHWATER PERCHES OF INDIAN WATER

Smita Lenka1, A. Gopalakrishnan2, V.S. Basheer2, K.A. Sajeela2

1National Bureau of Plant Genetic Resources, New Delhi, India2National Bureau of Fish Genetic Resources, Cochin Unit, Kochi, Kerala, India

meet_smeeta@yahoo.co.in

The increasing global loss of biodiversity has led to numerous proposals to intensify the efforts to produce a census of all biological diversity and to modernize the taxonomy.

DNA barcoding data plays an important role in ichthyologic diversity assessment, management and conservation which helps in construction of a comprehensive, consistent reference library of DNA sequences and development of economical technologies for species identification at national and international level.

Perciformes is the largest and the most diversified of all finfish orders containing about 9300 species. About 80 species are recorded from freshwaters of Indian region. Despite the abundance of perciforms and their commercial and scientific importance, the classification and phylogeny of this group remain extremely confused (Nelson, 2005).

The present study is aimed to generate species-specific DNA signatures for accurate documentation of freshwater perciform diversity, its sustainable utilization and management and to resolve taxonomic disputes.

Introduction

Material and Methods

Results and Discussion

Identified specimens (Total 40 species; 5 specimens each) were collected from different drainages in India and preserved with 95% ethanol.

Total genomic DNA was extracted from the collected tissue samples (muscle/fin) using salting out method (Miller et al., 1988).

Partial sequence information of mitochondrial COI (655bp), Cyt b (800bp) and 16S rRNA (560bp) genes of fishes were generated using primers given in the table 1.

The raw DNA sequences were aligned and edited using BIOEDIT (version 7.0.5.2; Hall, 1999). Phylogenetic and molecular evolutionary analyses were made using MEGA version 3.1 (Kumar et al., 2004). Fstand its significance were calculated using ARLEQUIN version 3.01(Excoffier et al., 2005).

The K2P pair-wise genetic divergence values between species ranged from 3.58 to 31.36 % (COI); from 4.19 to 31.69 % (Cyt b) and from 2.21 to 21.34% (16S rRNA).

The mean within species genetic distance values were 0.68% (COI); 0.59% (Cyt b) and 0.30% (16S rRNA) except for two species.

Phylogenetic relationships based on morphological characters and molecular data were generally concordant and all the species were partitioned into distinct entities without any haplotype sharing or overlapping. Congeneric species always clustered together and so did the confamilial species.

High genetic divergence and significant Fst values (P<0.01) in Anabas testudineus collected from Kerala, Andhra Pradesh and Orissa and Pristolepis marginata from 2 locations in Kerala indicate occurrence of unrecognized cryptic species; and further taxonomic and genetic investigations are recommended.

It is concluded that partial sequence information of the three mitochondrial genes- COI, Cyt b and 16S rRNA can be used as diagnostic tools for unambiguous identification of the freshwater perches of the Indian region with applications in its management and conservation.

ReferencesExcoffi er, L., Laval, G. and Schneider, S., 2005. Arlequin ver. 3.0: an integrated

software package for population genetics data analysis. Evol BioinformOnline. 1:47–50.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41:95-98.

Kumar, S., Tamura, K. and Nei, M., 2004. MEGA 3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics. 5:150-163.

Miller, S.A., Dykes, D.D. and Polesky, H.F., 1988. A simple salting out procedure for extracting DNA from nucleated cells. Nucleic Acid Research, 16 (3): 1215.

Nelson, J.S. 2006 Fishes of the world. 4th ed. John Wiley & Sons, Inc. Hoboken, New Jersey, USA. 624 p.5050°°CC2323CTCCGATCTCCGGATTACAAGACCTCCGATCTCCGGATTACAAGACHHH15915H15915

5050°°CC2020GACTTGAAAAACCACCGTTGGACTTGAAAAACCACCGTTGLLL14724L14724

5959°°CC2828AACCTCCGACATCCGGCTTACAAGACCGAACCTCCGACATCCGGCTTACAAGACCGR3R3THRTHR--Fish2Fish2--RR

5959°°CC2828ACCACCGTTGTTATTCAACTACAAGAACACCACCGTTGTTATTCAACTACAAGAACF3F3FishcytBFishcytB--FF

5656°°CC2323CCGACTTCCGGATTACAAGACCGCCGACTTCCGGATTACAAGACCGR2R2TruccytBTruccytB--RR

5656°°CC2525AACCACCGTTGTTATTCAACTACAAAACCACCGTTGTTATTCAACTACAAF2F2GluGlu FishFish--FF

5454°°CC2626ACCTCCGATCTTCGGATTACAAGACCACCTCCGATCTTCGGATTACAAGACCR1R1THRTHR--FishFish--RR

5454°°CC2525AACCACCGTTGTTATTCAACTACAAAACCACCGTTGTTATTCAACTACAAF1F1GluGlu FishFish--FFCytbCytb33

5050°°CC2626ACTTCAGGGTGACCGAAGAATCAGAAACTTCAGGGTGACCGAAGAATCAGAAR2R2WRD COIWRD COI

5050°°CC2626TCGACTAATCATAAAGATATGGGCACTCGACTAATCATAAAGATATGGGCACF2F2WRD COIWRD COI5050°°CC2626TAGACTTCTGGGTGGCCAAAGAATCATAGACTTCTGGGTGGCCAAAGAATCAR1R1WRD COIWRD COI

5050°°CC2626TCAACCAACCACAAAGACATTGGCACTCAACCAACCACAAAGACATTGGCACF1F1WRD COIWRD COICOICOI22

5858°°CC2222CCGGTCTGAACTCAGATCACGTCCGGTCTGAACTCAGATCACGTHHH3080H3080

5858°°CC2020CGCCTGTTTATCAAAAACATCGCCTGTTTATCAAAAACATLLL2510L251016S 16S rRNArRNA11

Annealing Annealing TemeratureTemerature

No of No of basesbasesSequence 5'Sequence 5'--3'3'Primers usedPrimers usedmtDNAmtDNA

RegionRegionSlSl NoNo

Taable 1. List of mtDNA primers used

Fig. Nj tree of COI