Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii...

Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus: the Role of CAPA Peptides

by

Jean-Paul Paluzzi

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Department of Cell and Systems Biology University of Toronto

© Copyright by Jean-Paul Paluzzi 2010

ii

Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus:

the Role of CAPA Peptides

Jean-Paul Paluzzi

Doctor of Philosophy

Department of Cell and Systems Biology

University of Toronto

2010

Abstract

CAPA-related peptides belong to a family of neuropeptides localized to the central nervous

system that can function in diverse roles in the regulation of water and salt homeostasis in

insects. These peptides are known to stimulate fluid secretion by Malpighian tubules (MTs) in

Dipteran species, thus serving a diuretic function. In contrast, this thesis demonstrates that

members of this family of peptides in Rhodnius prolixus serve an anti-diuretic role and have

multiple tissue targets, whereby they oppose the activity of diuretic hormones such as serotonin

(5-Hydroxytryptamine hydrochloride; 5-HT). I have identified two genes each encoding three

peptides in R. prolixus, suggesting this insect is capable of producing a greater number of

CAPA-peptides compared to other insects that contain only a single CAPA gene. Interestingly,

while the second peptide encoded in each R. prolixus gene (RhoprCAPA-α2/-β2) inhibits the

stimulatory effects of serotonin on tissues such as the anterior midgut and Malpighian tubules, it

appears the other CAPA-related and pyrokinin-related peptides do not play a major role in

inhibiting the effects of serotonin on these tissues. More specifically, serotonin-stimulated fluid

secretion by MTs and fluid absorption by the anterior midgut are reduced by the anti-diuretic

peptide, RhoprCAPA-α2. In addition, I have also identified a G protein-coupled receptor which

likely mediates the anti-diuretic effect associated with RhoprCAPA-α2 and have functionally

characterized this receptor in Chinese hamster ovary cells. Spatial transcript expression analysis

in fifth-instars reveals a wide distribution of the receptor in tissues associated with the rapid post-

gorging diuresis. Thus, my findings suggest that numerous tissues are regulated by the CAPA

iii

peptides in R. prolixus. Gene structure and phylogenetic analyses demonstrate that this receptor

is the orthologue of the D. melanogaster capa receptor (CG14575) with homologs in other

insects. Taken together, my thesis demonstrates that the RhoprCAPA peptides play an integral

role in the coordination and maintenance of anti-diuresis in R. prolixus. This mechanism is

necessary following the rapid diuresis associated with blood-feeding by this medically-important

insect.

iv

Acknowledgments

I would like to thank my supervisor, Dr. Ian Orchard, for the opportunity to work and carry out

my research in his laboratory. This experience has been most rewarding when I consider the

plethora of knowledge that I have gained during my graduate tenure. Opportunities to interact

with many experts in the field of insect neuroendocrinology, as well as related research realms,

have been plentiful and could not have occurred without the guidance and support of Dr.

Orchard. Also, a special thanks to my co-supervisor, Dr. Angela Lange, who first gave me the

opportunity to carry out research in her lab during my undergraduate thesis project. Additional

thanks for allowing me to pursue and fulfill my interests in university administrative and

leadership roles that have helped to enrich my academic and social perspectives.

Sincere thanks to all of my lab mates, including post-doctoral fellows and graduate student peers,

for the guidance, support and input in every aspect of my academic research and professional

development.

To my parents: thank you for always believing in me, for accepting my decision to pursue

research and for your ongoing support of my journey in academia. The love and guidance you

have given me has been much appreciated.

To my family members and close friends – those whom have little idea of what I really do in the

lab and think academic research conferences are nothing more than glorified science fairs!

Thanks for the many enjoyable activities over the years including fishing trips, chalet and cottage

celebrations, and those unforgettable summer barbeques!

Finally, I must thank my biggest aficionado, Christine. This thesis would not have been possible

without the love and support you have given me over these last few years. Thanks for respecting

my dedication and focus during this time and believing in my all my goals and ambitions.

v

Table of Contents

Abstract .......................................................................................................................................... ii

Acknowledgments ........................................................................................................................ iv

Organization of the Thesis ........................................................................................................ viii

List of Figures and Tables ........................................................................................................... ix

List of Appendices ...................................................................................................................... xiii

List of Abbreviations ................................................................................................................. xiv

Chapter 1: General Introduction .................................................................................................1

Rhodnius prolixus ......................................................................................................................1

Osmoregulation .........................................................................................................................2

Diuretic and anti-diuretic hormones .......................................................................................3

G protein-coupled receptors (GPCRs) ....................................................................................6

Overview of the R. prolixus central nervous system (CNS) ...................................................7

Regulation of diuresis in R. prolixus ........................................................................................7

Regulation of anti-diuresis in insects .......................................................................................9

Objectives .................................................................................................................................12

References ................................................................................................................................14

Chapter 2: Distribution, activity and evidence for the release of an anti-diuretic peptide in the kissing bug, Rhodnius prolixus ....................................................................................26

Abstract ....................................................................................................................................27

Introduction .............................................................................................................................28

Materials & Methods ..............................................................................................................30

vi

Results ......................................................................................................................................33

Discussion .................................................................................................................................54

References ................................................................................................................................57

Acknowledgements ..................................................................................................................60

Copyright Acknowledgements ...............................................................................................61

Chapter 3: Isolation, cloning, and expression mapping of a gene encoding an anti-diuretic hormone and other CAPA-related peptides in the disease vector, Rhodnius prolixus .....................................................................................................................................62

Abstract ....................................................................................................................................63

Introduction .............................................................................................................................64

Materials & Methods ..............................................................................................................66

Results ......................................................................................................................................73

Discussion .................................................................................................................................89

References ................................................................................................................................93

Acknowledgments ...................................................................................................................99

Copyright Acknowledgments ...............................................................................................100

Chapter 4: A second gene encodes the anti-diuretic hormone in the insect, Rhodnius prolixus ...................................................................................................................................101

Abstract ..................................................................................................................................102

Introduction ...........................................................................................................................103

Materials & Methods ............................................................................................................106

Results ....................................................................................................................................112

Discussion ...............................................................................................................................134

References ..............................................................................................................................139

vii

Acknowledgments .................................................................................................................144


Chapter 5: Isolation, expression analysis and functional characterization of the first anti-diuretic hormone receptor in insects ...........................................................................146

Abstract ..................................................................................................................................147

Introduction ...........................................................................................................................148

Materials and Methods .........................................................................................................151

Results ....................................................................................................................................156

Discussion ...............................................................................................................................171

Acknowledgments .................................................................................................................181

Appendices .............................................................................................................................182


Chapter 6: General Discussion .................................................................................................186

Linking the chapters .............................................................................................................187

Integrating the whole ............................................................................................................198

Future directions ...................................................................................................................204

References ..............................................................................................................................208

viii

Organization of the Thesis

Chapter 1 of this thesis provides a general introduction into my research topic and area. Chapter 2 was published in the Journal of Experimental Biology (Paluzzi, J.P. and Orchard, I. (2006) J. Exp. Biol. 209(5): 907-15; doi: 10.1242/jeb.02083). Chapter 3 was published in Endocrinology (Paluzzi, J.P., Russell, W.K., Nachman, R.J. and Orchard, I. (2008) Endo. 149(9): 4638-46; doi:10.1210/en.2008-0353). Dr. Russell and Dr. Nachman performed the MALDI-TOF analysis and Dr. Nachman synthesized the peptides encoded by the R. prolixus CAPA genes. Chapter 4 was published in Molecular and Cellular Endocrinology (Paluzzi, J.P. and Orchard, I. (2010) Mol. Cell. Endo. 317(1-2): 53-63; doi:10.1016/j.mce.2009.11.004). Chapter 5 has been accepted for publication in Proceedings of the National Academy of

Sciences and is currently IN PRESS (Manuscript tracking number: 2010-03666R; Paluzzi, J.P., Park, Y., Nachman, R.J. and Orchard, I.). Dr. Park provided the research space and funding for the receptor-ligand functional analysis. Dr. Nachman synthesized the peptides and analogs tested in the functional assay. Unless stated otherwise, all experiments and data analysis were performed by myself. Dr. Orchard rendered invaluable aid in the form of suggestions and comments for each manuscript and in addition funded all of my research. Copyright permission, if required, was granted from each of the publishers to reprint Chapters 2-5. Chapter 6 summarizes chapters 2-5 and provides a general discussion integrating the findings of this thesis in the area of insect physiology.

ix

List of Figures and Tables

Chapter 1: General Introduction ………….....………………………………………………..1

Figure 1. Schematic overview of the osmotic and ionic concentrations, and the movements of

fluid during the rapid post-prandial diuresis in R. prolixus …………………………………..…..5

Chapter 2: Distribution, activity and evidence for the release of an anti-diuretic peptide in

the kissing bug, Rhodnius prolixus ………………………………………………………..…..26

Figure 1. Composite camera lucida drawing of PRXamide-like immunoreactive cells and

processes in the central nervous system of R. prolixus ……………………………………….....35

Figure 2. Dorsal view of PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus

central nervous system………………………………………………………………….………..37

Figure 3. Ventral view of PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus

central nervous system………………………………………………………………….………..39

Figure 4. PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus in frontal

ganglion and abdominal nerves …...…………………………………………………………….42

Figure 5. Time-course immunohistochemical analysis of the ventral paired medial

neurosecretory cells in the MTGM of fifth-instar R. prolixus …………………………………..45

Figure 6. Dose–response curve demonstrating Mas-CAPA-1 inhibition of secretion by

Malpighian tubules stimulated with 50 nmol l–1 5-HT ………………………………………....48

Figure 7. Inhibition of secretion (stimulated with 50 nmol l–1 5-HT) with increasing doses of

Fraction 25 from RP-HPLC ……………………………………………………………………..50

Figure 8. Change in levels of intracellular cGMP in tubules stimulated with 5-HT alone or in

combination with Mas-CAPA-1 (500 nmol l–1) or Fraction 25 (F25; 10 CNS equivalents) vs

saline alone ………………………………………………………………………………………52

x

Chapter 3: Isolation, cloning, and expression mapping of a gene encoding an anti-diuretic

hormone and other CAPA-related peptides in the disease vector, Rhodnius prolixus …….62

Figure 1. Nucleotide cDNA sequence and deduced amino acid prepropeptide of the R. prolixus

CAPA gene ……………………………………………………………………………………...75

Figure 2. Detection of the peptides predicted from the CAPA gene in R. prolixus …………….78

Figure 3. Genomic Southern blot using a RhoprCAPA cDNA as probe .....................................80

Figure 4. RhoprCAPA developmental and spatial expression profile ………………………….82

Figure 5. RhoprCAPA transcript expression mapping via FISH ……………………………….85

Figure 6. Inhibition of 5-HT stimulated secretion from MTs by the anti-diuretic peptide,

RhoprCAPA-α2 ..…………………………..……………………………………………………88

Chapter 4: A second gene encodes the anti-diuretic hormone in the insect, Rhodnius

prolixus .......................................................................................................................................101

Table 1. Sequences deduced from the RhoprCAPA genes …………………..……………….113

Figure 1. Nucleotide and deduced amino acid sequence of the R. prolixus CAPA-β

(RhoprCAPA-β) gene and genomic organization …………………...................................……115

Figure 2. ClustalW2 alignment and phylogenetic analysis of known and predicted insect CAPA

encoding prepropeptide sequences …………………………………………………………….118

Figure 3. Expression analysis of RhoprCAPA genes in fifth-instar R. prolixus ………………121

Figure 4. Quantitative reverse transcriptase PCR in central nervous system following a blood

meal for RhoprCAPA-α and RhoprCAPA-β transcripts ………………………………………123

Figure 5. Tissue expression analysis of RhoprCAPA genes in adult R. prolixus and comparison

between fifth-instar and adult neuronal and reproductive tissues ……………………………...127

xi

Figure 6. CAPA transcript expression and PRX-amide-like immunoreactivity in the brain,

suboesophageal ganglion (SOG) and prothoracic ganglion (PRO) of adult R. prolixus ………129

Figure 7. CAPA transcript expression and PRX-amide-like immunoreactivity in the

mesothoracic ganglionic mass (MTGM) of adult R. prolixus …………………………………131

Chapter 5: Isolation, expression analysis and functional characterization of the first anti-

diuretic hormone receptor in insects ……………………………...…………………………146

Figure 1. Rhodnius prolixus cDNA for the CAPA receptor and deduced translation ………...158

Figure 2. Predicted membrane topology of the R. prolixus CAPA receptor ………………….160

Figure 3. Sequence and phylogenetic analysis of CAPA receptors in insects ………………...163

Figure 4. CAPA receptor expression profile in fifth-instar tissues ……………………………165

Figure 5. Ligand-receptor interaction analysis of the R. prolixus CAPA receptor by heterologous

expression assay in CHO-K1 cells ……………………………………………………………..168

Table 1. Summary of peptides and analogs structurally related to the CAPA peptides in R.

prolixus tested in the functional expression assays ……………………………………………169

Figure 6. Schematic overview of the proposed CAPA peptide/receptor signaling system in R.

prolixus ………………………………………………………………………………………...176

Table S1. Degenerate primers designed based on conserved regions of previously identified

CAPA receptors used for screening fifth instar R. prolixus upper Malpighian tubules cDNA

library ………………………………………………………………………………………..…182

Table S2. Gene-specific primers for the R. prolixus CAPA receptor ………………………....183

Chapter 6: General Discussion ……………………………………………………………...186

xii

Figure 1. Schematic overview of the diuretic and anti-diuretic regulation of tissues associated

with the rapid post-prandial diuresis in R. prolixus ..…………………………………….…….200

xiii

List of Appendices

Chapter 5: Isolation, expression analysis and functional characterization of the first anti-

diuretic hormone receptor in insects

Appendices:

Table S1. Degenerate primers designed based on conserved regions of previously

identified CAPA receptors used for screening fifth instar R. prolixus upper Malpighian

tubules cDNA library ………………………………………………………………..…182

Table S2. Gene-specific primers for the R. prolixus CAPA receptor ………………....183

xiv

List of Abbreviations

Note: Only abbreviations frequently utilized in this dissertation are included in this list. In addition, each initial use of an abbreviation is noted in the text where appropriate. 5-HT: 5-hydroxytryptamine hydrochloride (or serotonin) ABN: abdominal nerves ADF: anti-diuretic factor cAMP: adenosine 3′,5′-cyclic monophosphate CAPA: capability-gene encoded peptide CAP2b: cadioacceleratory peptide 2b cGMP: guanosine 3′,5′-cyclic monophosphate CNS: central nervous system CRF: corticotropin releasing factor CTSH: chloride transport stimulating hormone DH: diuretic hormone ETH: ecdysis triggering horone ELISA: enzyme-linked immunosorbent assay FISH: fluorescent in situ hybridization GPCR: G protein-coupled receptor ITP: ion transport peptide MALDI-TOF MS/MS: matrix assisted laser desorption ionization time-of-flight tandem

mass spectrometry MT: Malpighian tubules MTGM: mesothoracic ganglionic mass PETH: pre-ecdysis triggering hormone PRO: prothoracic ganglion PRXa-LI: PRXamide-like immunoreactivity PVK: periviscerokinin RACE: rapid amplification of cDNA ends RIA: radioimmunoassay RP-HPLC: reversed phase high performance liquid chromatography SOG: suboesophageal ganglio

Chapter 1: General Introduction

2

Rhodnius prolixus

All post-embryonic stages of Rhodnius prolixus are obligate blood feeders, and fifth instars

consume a blood meal equivalent to or greater than 10 times their unfed body mass. This

increase in body mass leaves the insects more susceptible to predation or detection by their

vertebrate hosts. Therefore, beginning immediately upon blood meal engorgement is a rapid

diuresis that quickly removes the excess salts and water present in the blood meal (mainly from

the plasma) and concentrates the nutritive components (mainly the red blood cells). It is during

excretion of this urine that R. prolixus transmits the protozoan parasite, Trypanosoma cruzi,

which is the etiological agent of Chagas’ disease, also known as American trypanosomiasis (De

Souza, 2002). The human host acquires the parasite unknowingly when they rub the excreted

faeces containing the parasitic protozoan into their eyes, mouth or directly into the bite wound.

Although substantial progress has been made in the control of the main Triatominae species

acting as a vector of Chagas’ disease, it remains a substantial threat in several countries of Latin

America with greatest risks in poor rural areas (Costa and Lorenzo, 2009). Alarmingly, 15-19

million people worldwide are infected with Chagas’ disease, with 1-6% of the Latin American

population afflicted and about 50,000 new cases diagnosed each year (Lima et al., 2010). A

century after this disease was first discovered by Dr. Carlos Chagas, it remains among the most

neglected tropical diseases (Morris, 2009). Therefore, R. prolixus has considerable medical

importance, but in addition, has been the model of choice by pioneers of insect physiology and

endocrinology such as Sir Vincent Wigglesworth. Renewed interest in this insect arose recently

following announcement of the sequencing of the R. prolixus genome, which will be of immense

importance in acquiring knowledge of this important insect disease-vector.

Osmoregulation

Maintenance of osmotic and ionic levels in insects represents an essential physiological activity

that allows them to succeed in many environmental and ecological niches, and to utilize a variety

of feeding strategies. Terrestrial insects that reside in arid environments, or which consume dry

materials, must ensure that water loss is minimized or absolutely prevented. In contrast, aquatic

insects living in wet habitats or insects which engorge liquid meals must eliminate excess water

3

and/or salts, but maintain osmotic balance and essential salts. Thus, insects challenged with

excess water and salts undergo diuresis, whereas insects faced with limited intake of dietary

water and salts must prevent their loss, and have anti-diuretic strategies.

In R. prolixus, the rapid diuresis involves the anterior midgut, Malpighian tubules (MTs), and

hindgut, and lasts several hours, producing urine excreted from the anus that is hypo-osmotic to

both the haemolymph and the engorged blood meal (Maddrell, 1964a; 1976). In fact over 50%

of the blood-meal volume is excreted within the first few hours following feeding (Maddrell,

1964b; 1966a; 1966b). Initially, the blood enters the anterior midgut, where excess water and

ions (Na+ and Cl-) are absorbed into the haemolymph. This absorption is matched by the

excretion of water and ions (Na+, K+ and Cl-) by the upper segments of the MTs. Importantly,

the lower segments of the MTs are responsible for the reabsorption of K+ and Cl-, which would

otherwise be quickly depleted in the haemolymph. This urine is then emptied into the hindgut

and is subsequently excreted with no significant reabsorption during the rapid diuresis (for a

review, see Coast, 2009). The movement of the principal ions and water across the various

tissues involved in the rapid diuresis is summarized in Figure 1.

Diuretic and anti-diuretic hormones

Historically, the successful purification, identification, and characterization of diuretic and anti-

diuretic hormones have involved a variety of techniques. These include in vivo and in vitro

biological assays investigating the physiological or behavioral effects of a given factor (peptide

or amine) on a target tissue. One such assay is the Ramsay assay (Ramsay, 1954), or a derived

version of this assay (Donini et al., 2008; Ianowski and O'Donnell, 2001; O'Donnell and

Maddrell, 1995;1984; Te Brugge et al., 2002), where Malpighian tubule (MT) fluid secretion

rates and/or composition can be measured following treatment with a particular peptide or amine.

Other assays have involved measuring putative second messenger levels with radioimmunoassay

(RIA), or enzyme-linked immunosorbent assay (ELISA) for cyclic AMP or cyclic GMP. Of

particular importance for peptides, has been the tissue fractionation via reversed-phase high-

performance liquid chromatography (RP-HPLC), beginning in the mid 1980s (see Coast et al.,

2002). Using such methods, peptides have been isolated to purity, making their subsequent

4

Figure 1. Schematic overview of the osmotic and ionic concentrations, and the movements of

water and ions (direction of movement denoted by arrows) during the rapid post-prandial

diuresis in R. prolixus. In addition, a summary of the biological activity of diuretic factors on the

principal tissues associated with the rapid diuresis that follows engorgement on a blood meal in

R. prolixus is provided (see text for details). Based on data reviewed in Coast et al., 2002;

Orchard, 2006; 2009; and Coast, 2009. Adapted figure of alimentary canal drawn by Zach

McLaughlin.

6

usage in biological assays more convincing compared to assays using crude extracts, and also

facilitating their sequencing via Edman degradation. In recent times, however, with the

emergence of the peptidomics era, the structural identity of a large number of peptides from

neuronal tissues (Baggerman et al., 2002; Li et al., 2008; Nachman et al., 2006; Neupert et al.,

2009; Ons et al., 2009; Predel et al., 2004, 2006; Schoofs and Baggerman, 2003) or even single

cells (Neupert et al., 2005; 2007) has been accomplished. These studies have made use of

genome-predicted sequences, predicted peptide masses, and predicted post-translational

processing, coupled to MALDI-TOF MS/MS or comparable methods.

A number of (neuro)endocrine factors have been identified that regulate tissues of the insect

excretory system which is composed of the MTs, midgut and hindgut (Coast et al., 2002; Coast,

2009; Farmer et al., 1981; Orchard, 2009; Te Brugge et al., 2002; 2009 ). These factors are

responsible for maintenance of fluid and salt homeostasis within a normal physiological range

(see Coast, 2007). Factors that stimulate the removal of excess water and salts (diuretic factors)

include the biogenic amines tyramine (Blumenthal, 2003; 2005) and serotonin (Orchard, 2006;

2009), as well as several families of peptides such as the corticotropin-releasing factor (CRF)-

related peptides (Baldwin et al., 2001; Blackburn et al., 1991; Furuya et al., 2000a; Kataoka et

al., 1989; Kay et al., 1991; Patel et al., 1995), insect kinins (Blackburn et al., 1995; Coast et al.,

1990; Hayes et al., 1989; Holman et al., 1999; Terhzaz et al., 1999; Veenstra et al., 1997),

calcitonin-like peptides (Coast et al., 2005; Furuya et al., 2000b) and the CAPA family of

peptides (Davies et al., 1995; Kean et al., 2002; Pollock et al., 2004). Generally speaking, few of

these have been shown to be true diuretic hormones (i.e. actually shown to be present in the

haemolymph at appropriate times). Currently, true diuretic hormones include Locusta DH in

locust (Patel et al., 1995) and serotonin in R. prolixus (Lange et al., 1989).

G protein-coupled receptors (GPCRs)

In a number of cases, the diuretic factors have been shown to work via GPCRs, which are

characterized by the presence of seven transmembrane domains which traverse the plasma

membrane and facilitate coupling with various signaling pathways (for a review, see Coast et al.,

2002). For example, the DH peptides utilize GPCRs that generally couple positively with

7

adenylate cylase (Reagen, 1994; 1996) which satisfies the observed physiological data (MTs

fluid secretion) and second messenger assays for cyclic AMP (Coast et al., 1994; Audsley et al.,

1995).

Overview of the R. prolixus central nervous system (CNS)

The anatomy of the CNS and retrocerebral complex of R. prolixus has been described previously

(Tsang and Orchard, 1991). Briefly, the CNS consists of a dorsally-located brain, connected to

the ventral suboesophageal ganglion (SOG) via circum-oesophageal connectives. This ganglion

is connected to the prothoracic ganglion (PRO), which in turn is connected to the mesothoracic,

metathoracic and abdominal neuromeres that are condensed into a mesothoracic ganglionic mass

(MTGM). The retrocerebral complex consists of a set of ganglia associated with the anterior

digestive system. The retrocerebral complex consists of a frontal ganglion that is found

connected via a pair of nerves to the frontal part of the brain. A recurrent nerve then projects

from the frontal ganglion posteriorly to a hypocerebral ganglion that lies on the dorsal surface of

the oesophagus. Paired nerves from the hypocerebral ganglion then project posteriorly along the

oesophagus to paired ingluvial ganglia that again lie on the dorsal surface of the oesophagus.

Regulation of diuresis in R. prolixus

In R. prolixus, it is now well established that at least two diuretic hormones are involved in the

regulation of the rapid post-prandial diuresis. One hormone has been identified as serotonin

(Lange et al., 1989; Maddrell et al., 1991), which is present in five dorsal unpaired medial

(DUM) neurons in the mesothoracic ganglionic mass (MTGM) that form neurohemal sites on

each of the abdominal nerves (Orchard et al., 1989; Orchard, 1989). The intensity of

immunoreactive staining at these neurohemal sites is decreased after feeding (Orchard, 1989)

and haemolymph levels have been shown to increase immediately following engorgement on a

blood meal (Lange et al., 1989). This diuretic hormone stimulates secretion by MTs (Maddrell,

1969; Maddrell et al., 1971; Te Brugge et al., 2002) and fluid absorption by the anterior midgut

(Farmer et al., 1981; Te Brugge et al., 2009). Thus, the circulating titers in the haemolymph are

capable of stimulating substantial fluid transport by these two tissues (Lange et al., 1989).

Another important diuretic hormone is the CRF-related peptide, RhoprDH, which has been

8

identified (Te Brugge & Orchard, personal communication). Cross-species assays with insect

CRF-related peptides have shown them to be potent stimulators of fluid secretion by MTs (Te

Brugge and Orchard, 2002; Te Brugge et al., 2002) and of fluid absorption by the anterior

midgut (Te Brugge et al., 2009) in R. prolixus. Although haemolymph titers of RhoprDH are not

known, immunoreactivity in the CNS and associated neurohemal sites indicates that this peptide

is released into the haemolymph after the start of feeding (Te Brugge et al., 1999) and appears to

be co-released with kinin-related peptides (Te Brugge et al., 2001). Some neurons (e.g. posterior

lateral neurosecretory cells in the MTGM) contain immunoreactivity for both peptides (Te

Brugge et al., 2001). Interestingly, colocalization of serotonin and calcitonin-related peptides

has also been shown in DUM neurons in the MTGM, and these factors may also be co-released

during feeding (Te Brugge et al., 2005). In R. prolixus, however, the kinin-related and

calcitonin-related peptides do not appear to play a major role in stimulation of fluid secretion by

the MTs; however, the latter do elicit small increases equivalent to 14-fold over basal secretion

rates (Te Brugge et al., 2002; 2005) relative to the 1000-fold increase in secretion rates elicited

by serotonin (Maddrell, 1963). Thus, although calcitonin- and kinin-related peptides are potent

diuretic hormones in other insects (see Coast et al., 2002), they have minimal or no effect on

fluid secretion by MTs (Donini et al., 2008; Te Brugge et al., 2002) or absorption by the anterior

midgut in R. prolixus (Te Brugge et al., 2009); however, these peptides likely play other

important roles in the control of feeding-related tissues, such as the salivary glands, anterior

midgut and hindgut, where they are known to have myotropic activity (see Orchard, 2009; Te

Brugge et al., 2009). The diuretic hormones in R. prolixus have both been shown to act through

cAMP (Te Brugge et al., 2002), leading to a potent increase in fluid absorption by the anterior

midgut (Farmer et al., 1981; Te Brugge et al., 2009) and fluid secretion by MTs. Both serotonin

and the CRF-related peptides elicit similar effects on upper Malpighian tubules where they lead

to a characteristic triphasic response in transepithelial potential (TEP). This triphasic TEP

response has been attributed to the sequential activation of apical Cl- channels, an apical V-type

ATPase, and a basolateral Na+:K+:2Cl- (NKCC) cotransporter (Donini et al., 2008; Ianowski and

O'Donnell, 2001; O'Donnell and Maddrell, 1984). Interestingly, only serotonin leads to

reabsorption of K+ and Cl- by the lower MTs (Donini et al., 2008; Maddrell et al., 1993); an

important feature of R. prolixus MTs that prevents the loss of K+ ions. An overview of the

9

biological activity of diuretic factors on the principal tissues involved in the rapid post-gorging

diuresis in R. prolixus is presented in Figure 1.

Regulation of anti-diuresis in insects

In contrast to the breadth of factors identified as being diuretic in insects, identification of insect

anti-diuretic strategies has been limited. Anti-diuresis is of great importance in insects, since this

is the normal physiological state sustained by the majority of terrestrial insects, interrupted only

occasionally by diuresis associated with increased water intake from dietary or metabolic sources

(see Coast et al., 2002).

Three factors contributing to an anti-diuretic strategy in locusts act on the hindgut: Cl- transport

stimulating hormone (CTSH), ion transport peptide (ITP) and neuroparsins (Fournier and

Girardie, 1988; Phillips et al., 1980, 1996; Spring and Phillips, 1980). Only the latter two have

been amino acid sequenced, and in addition, the neuroparsin’s stimulatory role on the locust

hindgut is not well understood, and data has been conflicting (see Coast et al., 2002; Jeffs and

Phillips, 1996). CTSH (Spring and Phillips, 1980) acts on specific ion transport mechanisms via

cAMP (Chamberlin and Phillips, 1988), and leads to reabsorption of fluid and ions by the

rectum. The third factor known to regulate absorption by the locust hindgut, ITP, was originally

identified and purified from the locust corpus cardiacum (Audsley et al., 1992; Phillips et al.,

1996) and the 72 residue full length peptide was determined following cDNA cloning (Meredith

et al., 1996). Similar to CTSH, ITP is also known to utilize cAMP as a second messenger and

this leads to an increase in apical cation conductance and stimulation of an apical electrogenic

Cl- pump, while simultaneously acting via another, unidentified, second messenger to inhibit

apical acid secretion (see Phillips et al., 1998).

An endogenous factor capable of inhibiting fluid secretion of MTs was first described in the

forest ant, Formica polyctena (Laenen et al., 2001); however this factor has not been sequenced.

Native anti-diuretic factors, ADF-a and ADF-b, have been identified in Tenebrio molitor, with

10

potent inhibitory effects on MT secretion rates, via increases in cGMP levels (Eigenheer et al.,

2002; 2003). The ADF-stimulated increases in cGMP are independent of nitric oxide signaling,

and so a soluble guanylate cyclase is unlikely (Eigenheer et al., 2003). In addition, cAMP levels

stimulated with the native CRF-related DH, T. molitor DH37, are decreased in MTs treated with

ADFs (Eigenheer et al., 2003). Thus, these ADFs provide the first examples of endogenous

peptides, along with their cognate intracellular mediators, which antagonistically regulate fluid

secretion of MTs in insects (Wiehart et al., 2002b). However, there is no evidence that the ADF

neuropeptides are released as neurohormones, since immunohistochemical analysis has not

revealed any staining associated with classical neurohemal storage sites (Eigenheer et al., 2003;

Wiehart et al., 2002a), although this has been shown for the endogenous diuretic peptide

(Wiehart et al., 2002a). Interestingly, in cross-species assays, TenmoADFa has been shown to

inhibit fluid secretion by MTs via cGMP in Aedes aegypti (Massaro et al., 2004), but this peptide

has no stimulatory or inhibitory effect on Acheta domesticus MTs (Coast et al., 2007).

Surprisingly, TenmoADFb has been shown to stimulate fluid secretion with activity similar to

native kinin-related peptides in A. domesticus (Coast et al., 2007). Finally, in a Coleopteran

relative, a factor with similar hydrophobicity and presumed molecular weight to T. molitor ADF-

a and ADF-b was partially isolated in the Colorado potato beetle, Leptinotarsa decemlineata

(Lavigne et al., 2001), although the sequence of this factor has not been resolved.

The Lepidopteran cardioacceleratory peptide, ManseCAP2b, which belongs to the CAPA peptide

family (i.e. peptides coded on the capability gene in D. melanogaster), was originally sequenced

in the tobacco hornworm, Manduca sexta (Huesmann et al., 1995), and was shown to be a potent

inhibitor of fluid secretion in R. prolixus (Quinlan et al., 1997; Quinlan and O'Donnell, 1998),

with cGMP proposed as a possible intracellular messenger (Quinlan et al., 1997; Quinlan and

O'Donnell, 1998). However, the endogenous peptide remained unknown. Genes that encode the

CAPA peptides are named capability and identified originally in the fruit fly, D. melanogaster

(Kean et al., 2002) and subsequently in the tobacco hornworm, M. sexta (Loi and Tublitz, 2004).

It was proposed that the CAPA peptide-induced inhibition of secretion by MTs in R. prolixus

resulted from activation of a cGMP-dependent phosphodiesterase that degrades cAMP (Quinlan

et al., 1997; Quinlan and O'Donnell, 1998), the second messenger of the diuretic hormones

11

(Aston, 1975; Montoreano et al., 1990; Te Brugge et al., 2002). Quinlan & O’Donnell also

demonstrated that at higher doses of cGMP, the ratio of the primary secreted ions, Na+ and K+,

reverted to an unstimulated state with K+ being the dominant ion secreted (Quinlan et al., 1997;

Quinlan and O'Donnell, 1998). The physiological relevance of this reversal in the ratio of

secreted ions has not yet been determined for any anti-diuretic factors, including the CAPA-

related peptides, which are involved in inhibiting fluid secretion by R. prolixus MTs (Quinlan et

al., 1997; Quinlan and O'Donnell, 1998). CAPA peptides, which usually have a conserved

FPRV-NH2 carboxy terminus, are also referred to as periviscerokinins in some insect species,

due to their abundance in perivisceral organs, and their described myotropic activities (see Predel

and Wegener, 2006). These peptides are produced within the CNS and are released at

neurohemal sites where they function as neuroendocrine factors regulating visceral tissues

(Wegener et al., 2001). Although an anti-diuretic function has been proposed in R. prolixus

(Quinlan et al., 1997; Quinlan and O'Donnell, 1998), the CAPA peptides in Dipterans activate

fluid secretion by principal cells of MTs via nitric oxide, cGMP and Ca2+ intracellular signaling

(Davies et al., 1995; Davies et al., 1997; Pollock et al., 2004). Interestingly, neither an anti-

diuretic nor diuretic function has been demonstrated for CAPA-related peptides in other insects,

such as locust, Schistocerca gregaria (Pollock et al., 2004) or the house cricket, A. domesticus

(Coast et al., 2007).

Receptors for insect CAPA-related peptides also belong to the GPCR super family and have been

characterized in D. melanogaster (Cazzamali et al., 2005; Iversen et al., 2002; Park et al., 2002),

Anopheles gambiae (Olsen et al., 2007) and predicted in T. castaneum (Li et al., 2008).

Expression of CAPA receptor transcripts has been localized to the MTs in Diptera (Pollock et al.,

2004), and more specifically in principal cells in D. melanogaster where activation of the

receptor leads to increased mitochondrial membrane polarization and elevated cellular ATP

levels (Terhzaz et al., 2006). This ultimately leads to activation of an apical membrane proton

pump (vacuolar-type H+-ATPase) that energizes the epithelium (Terhzaz et al., 2006) and

provides the necessary gradient for transport of ions from cell to lumen through a K+ or Na+/H+

exchanger and the subsequent passive movement of osmotically-obliged water (Linton and

O'Donnell, 1999; Maddrell and O'Donnell, 1992; O'Donnell et al., 1982). Aside from expression

12

in Dipteran MTs, it is unknown if other insect visceral tissues express the CAPA receptor;

however, such information might reveal novel physiological roles for these neuropeptides.

In R. prolixus, it was previously believed that anti-diuresis was facilitated by a reduction in the

circulating levels of diuretic hormones in the haemolymph (Maddrell, 1964b). However, it was

subsequently suggested that this mechanism would be unlikely since diuretic hormone titers

would be increased as the haemolymph volume declines over the progression of the rapid

diuresis (Quinlan et al., 1997). In addition, the mechanical properties of the plasticized cuticle,

stimulated by serotonin (Orchard et al., 1988), and the associated abdominal distention leading to

activation of stretch receptors (Maddrell, 1964b), would likely not permit a sufficiently-precise

detection of reduced distention leading to inhibition of diuretic hormone release (Quinlan et al.,

1997; Maddrell and Phillips, 1975). Thus, as shown in other insects, it was suggested that R.

prolixus may also contain endogenous peptides that control the cessation of diuresis. This would

ensure that essential water and salts are maintained and desiccation avoided. However, no native

anti-diuretic factor has been identified in R. prolixus. Of specific importance in this regard is the

fact that there is no significant absorption by the hindgut during the rapid diuresis following a

blood meal in R. prolixus (Maddrell and Phillips, 1975). Thus, any anti-diuretic factor would

have to act elsewhere, possibly by having a dual inhibitory role on fluid secretion by MTs and

absorption by the anterior midgut.

Objectives

This thesis aims to elucidate the native factors in R. prolixus which function to inactivate the

rapid post-prandial diuresis and ensure the maintenance of physiologically-relevant levels of

water and salts in order to avoid desiccation. The central hypothesis tested in this thesis is as

follows: An endogenous factor with structural and physiological properties similar to

ManseCAP2b is present in R. prolixus and is involved in an anti-diuretic mechanism which

follows the rapid post-prandial diuresis. Use of a number of different experimental techniques

and approaches has enabled for the isolation of the native anti-diuretic peptide, characterization

of its physiological role, and the discovery of a range of target tissues under its regulation. The

role of endogenous anti-diuretic factors on the principal tissues involved in the rapid post-

13

prandial diuresis, namely the anterior midgut and MTs, has also been explored. More

specifically, the second chapter of this thesis provides evidence in support of endogenous

peptides in R. prolixus which are involved in coordinating the cessation of the rapid post-

prandial diuresis. Using an array of molecular biology techniques, the genetic origin of these

anti-diuretic factors has been elucidated and characterized. More specifically, the third chapter

of this thesis identifies the primary structure of the native anti-diuretic peptide along with two

additional peptides arising from the same precursor which is the product of a gene highly

expressed in the CNS. The fourth chapter of this thesis describes data in support of a second

closely related gene encoding the CAPA-related peptides in R. prolixus and investigates the

transcript expression profile of these two paralogs. Similarly, the receptor responsible for

mediating the anti-diuretic effects along with the transcript expression profile on prospective

target tissues has been characterized. This data is included in the fifth chapter of this thesis

where I describe the isolation, functional characterization and transcript expression profile of a

receptor structurally-related to insect CAPA receptors. As a result of this extensive study, this

thesis confirms that R. prolixus contains peptides belonging to the insect CAPA-related family

that are involved in coordination of an anti-diuretic strategy by their inhibitory action on the

primary tissues involved in the rapid post-prandial diuresis. The findings of this research will

greatly advance our knowledge of anti-diuresis in R. prolixus and may serve as a model in other

insects. In addition, this work may be instrumental in the future development of CAPA peptide

mimetics or receptor agonists which could help reduce the transmission of Chagas’ disease that

occurs during the rapid-diuresis following blood-feeding by this medically-important insect.

14

References

Aston, R. J. (1975). The role of adenosine 3′:5′-cyclic monophosphate in relation to the diuretic

hormone of Rhodnius prolixus. J. Insect Physiol. 21, 1873-1877.

Audsley, N., McIntosh, C. and Phillips, J. E. (1992). Isolation of a neuropeptide from locust

corpus cardiacum which influences ileal transport. J. Exp. Biol. 173, 261.

Audsley, N., Kay, I., Hayes, T. K. and Coast, G. M. (1995). Cross reactivity studies of CRF-

related peptides on insect Malpighian tubules. Comp. Biochem. Physiol. Part A. 110(1), 87-93.

Baggerman, G., Cerstiaens, A., De Loof, A. and Schoofs, L. (2002). Peptidomics of the larval

Drosophila melanogaster central nervous system. The Journal of biological chemistry 277,

40368.

Baldwin, D. C., Schegg, K. M., Furuya, K., Lehmberg, E. and Schooley, D. A. (2001).

Isolation and identification of a diuretic hormone from Zootermopsis nevadensis. Peptides 22,

147-152.

Blackburn, M. B., Kingan, T. G., Bodnar, W., Shabanowitz, J., Hunt, D. F., Kempe, T.,

Wagner, R. M., Raina, A. K., Schnee, M. E. and Ma, M. C. (1991). Isolation and

identification of a new diuretic peptide from the tobacco hornworm, Manduca sexta. Biochem.

Biophys. Res. Commun. 181, 927-932.

Blackburn, M. B., Wagner, R. M., Shabanowitz, J., Kochansky, J. P., Hunt, D. F. and

Raina, A. K. (1995). The isolation and identification of three diuretic kinins from the abdominal

ventral nerve cord of adult Helicoverpa zea. J. Insect Physiol. 41, 723-730.

Blumenthal, E. (2003). Regulation of chloride permeability by endogenously produced tyramine

in the Drosophila Malpighian tubule. American journal of physiology. Cell physiology 284,

C718.

Blumenthal, E. (2005). Modulation of tyramine signaling by osmolality in an insect secretory

epithelium. American journal of physiology. Cell physiology 289, C1261.

15

Cazzamali, G., Torp, M., Hauser, F., Williamson, M. and Grimmelikhuijzen, C. J. P.

(2005). The Drosophila gene CG9918 codes for a pyrokinin-1 receptor. Biochem. Biophys. Res.

Commun. 335, 14-19.

Chamberlin, M. and Phillips, J. E. (1988). Effects of stimulants of electrogenic ion-transport

on cyclic AMP and cyclic GMP levels in the locust rectum. J. Exp. Zool. 245, 9.

Coast, G. (2007). The endocrine control of salt balance in insects. General and Comparative

Endocrinology 152, 332-338.

Coast, G. (2009). Neuroendocrine control of ionic homeostasis in blood-sucking insects. J. Exp.

Biol. 212, 378.

Coast, G. M., Holman, G. M. and Nachman, R. J. (1990). The diuretic activity of a series of

cephalomyotropic neuropeptides, the Achetakinins, on isolated Malpighian tubules of the house

cricket, Acheta domesticus. J. Insect Physiol. 36, 481-488.

Coast, G. M. and Kay, I. (1994). The effects of Acheta diuretic peptide on isolated Malpighian

tubules from the house cricket Acheta domesticus. J. Exp. Biol. 187, 225-243.

Coast, G. M., Nachman, R. J. and Schooley, D. A. (2007). An anti-diuretic peptide (Tenmo-

ADFb) with kinin-like diuretic activity on Malpighian tubules of the house cricket, Acheta

domesticus (L.). J. Exp. Biol. 210, 3979-3989.

Coast, G. M., Orchard, I., Phillips, J. E. and Schooley, D. A. (2002). Insect diuretic and anti-

diuretic hormones. In Advances in Insect Physiology, pp. 279-409: Academic Press.

Coast, G., Garside, C., Webster, S., Schegg, K. and Schooley, D. (2005). Mosquito natriuretic

peptide identified as a calcitonin-like diuretic hormone in Anopheles gambiae (Giles). J. Exp.

Biol. 208, 3281.

Costa, J. and Lorenzo, M. (2009). Biology, diversity and strategies for the monitoring and

control of Triatomines - Chagas disease vectors. Mem. Inst. Oswaldo Cruz 104, 46-51.

16

Davies, S. A., Huesmann, G. R., Maddrell, S. H., O'Donnell, M. J., Skaer, N. J., Dow, J. A.

and Tublitz, N. J. (1995). CAP2b, a cardioacceleratory peptide, is present in Drosophila and

stimulates tubule fluid secretion via cGMP. Am J Physiol Regul Integr Comp Physiol 269,

R1321-1326.

Davies, S. A., Stewart, E. J., Huesmann, G. R., Skaer, N. J. V., Maddrell, S. H. P., Tublitz,

N. J. and Dow, J. A. T. (1997). Neuropeptide stimulation of the nitric oxide signaling pathway

in Drosophila melanogaster Malpighian tubules. American Journal of Physiology-Regulatory

Integrative and Comparative Physiology 42, R823-R827.

De Souza, W. (2002). Basic Cell biology of Trypanosoma cruzi. Curr. Pharm. Des. 8, 269-285.

Donini, A., O'Donnell, M. J. and Orchard, I. (2008). Differential actions of diuretic factors on

the Malpighian tubules of Rhodnius prolixus. J. Exp. Biol. 211, 42-48.

Eigenheer, R. A., Wiehart, U. M., Nicolson, S. W., Schoofs, L., Schegg, K. M., Hull, J. J.

and Schooley, D. A. (2003). Isolation, identification and localization of a second beetle anti-

diuretic peptide. Peptides 24, 27-34.

Eigenheer, R., Nicolson, S., Schegg, K., Hull, J. J. and Schooley, D. (2002). Identification of a

potent anti-diuretic factor acting on beetle Malpighian tubules. Proceedings of the National

Academy of Sciences 99, 84-89.

Farmer, J., Maddrell, S. H. P. and Spring, J. H. (1981). Absorption of fluid by the midgut of

Rhodnius. J. Exp. Biol. 94, 301-316.

Fournier, B. and Girardie, J. (1988). A new function for the Locust neuroparsins - stimulation

of water reabsorption. J. Insect Physiol. 34, 309.

Furuya, K., Harper, M. A., Schegg, K. M. and Schooley, D. A. (2000a). Isolation and

characterization of CRF-related diuretic hormones from the whitelined sphinx moth Hyles

lineata. Insect Biochem. Mol. Biol. 30, 127-133.

Furuya, K., Milchak, R. J., Schegg, K. M., Zhang, J., Tobe, S. S., Coast, G. M. and

Schooley, D. A. (2000b). Cockroach diuretic hormones: characterization of a calcitonin-like

17

peptide in insects. Proceedings of the National Academy of Sciences of the United States of

America 97, 6469-6474.

Hayes, T. K., Pannabecker, T. L., Hinckley, D. J., Holman, G. M., Nachman, R. J., Petzel,

D. H. and Beyenbach, K. W. (1989). Leucokinins, a new family of ion transport stimulators and

inhibitors in insect Malpighian tubules. Life Sci. 44, 1259-1266.

Holman, G. M., Nachman, R. J. and Coast, G. M. (1999). Isolation, characterization and

biological activity of a diuretic myokinin neuropeptide from the housefly, Musca domestica.

Peptides 20, 1-10.

Huesmann, G. R., Cheung, C. C., Loi, P. K., Lee, T. D., Swiderek, K. M. and Tublitz, N. J.

(1995). Amino acid sequence of CAP2b, an insect cardioacceleratory peptide from the tobacco

hawkmoth Manduca sexta. FEBS Lett. 371, 311-314.

Ianowski, J. P. and O'Donnell, M. J. (2001). Transepithelial potential in Malpighian tubules of

Rhodnius prolixus: lumen-negative voltages and the triphasic response to serotonin. J. Insect

Physiol. 47, 411-421.

Iversen, A., Cazzamali, G., Williamson, M., Hauser, F. and Grimmelikhuijzen, C. J. P.

(2002). Molecular cloning and functional expression of a Drosophila receptor for the

neuropeptides capa-1 and -2. Biochem. Biophys. Res. Commun. 299, 628.

Jeffs, L. and Phillips, J. (1996). Pharmacological study of the second messengers that control

rectal ion and fluid transport in the desert locust (Schistocerca gregaria). Arch. Insect Biochem.

Physiol. 31, 169.

Kataoka, H., Troetschler, R., Li, J., Kramer, S., Carney, R. and Schooley, D. (1989).

Isolation and identification of a diuretic hormone from the tobacco hornworm, Manduca sexta.

Proc. Natl. Acad. Sci. U. S. A. 86, 2976.

Kay, I., Coast, G. M., Cusinato, O., Wheeler, C. H., Totty, N. F. and Goldsworthy, G. J.

(1991). Isolation and characterization of a diuretic peptide from Acheta domesticus. Evidence for

a family of insect diuretic peptides. Biol. Chem. Hoppe-Seyler 372, 505.

18

Kean, L., Cazenave, W., Costes, L., Broderick, K. E., Graham, S., Pollock, V. P., Davies, S.

A., Veenstra, J. A. and Dow, J. A. T. (2002). Two nitridergic peptides are encoded by the gene

capability in Drosophila melanogaster. Am J Physiol Regul Integr Comp Physiol 282, R1297-

1307.

Laenen, B., De Decker, N., Steels, P., Van Kerkhove, E. and Nicolson, S. (2001). An anti-

diuretic factor in the forest ant: purification and physiological effects on the Malpighian tubules.

J. Insect Physiol. 47, 185-193.

Lange, A. B., Orchard, I. and Barrett, F. M. (1989). Changes in hemolymph serotonin levels

associated with feeding in the bloodsucking bug, Rhodnius prolixus. J. Insect Physiol. 35, 393-

399.

Lavigne, C., Embleton, J., Audy, P., King, R. R. and Pelletier, Y. (2001). Partial purification

of a novel insect anti-diuretic factor from the Colorado potato beetle, Leptinotarsa decemlineata

(Say) (Coleoptera: Chrysomelidae), which acts on Malpighian tubules. Insect Biochemistry and

Molecular Biology 31, 339-347.

Li, B., Predel, R., Neupert, S., Hauser, F., Tanaka, Y., Cazzamali, G., Williamson, M.,

Arakane, Y., Verleyen, P., Schoofs, L. et al. (2008). Genomics, transcriptomics, and

peptidomics of neuropeptides and protein hormones in the red flour beetle Tribolium castaneum

Genome Res. 18, 113-122.

Lima, F. M., Oliveira, P., Mortara, R. A., Silveira, J. F. and Bahia, D. (2010). The challenge

of Chagas’ disease: has the human pathogen, Trypanosoma cruzi, learned how to modulate

signaling events to subvert host cells? N Biotechnol IN PRESS

Linton, S. and O'Donnell, M. (1999). Contributions of K+:Cl- cotransport and Na+/K+-ATPase

to basolateral ion transport in Malpighian tubules of Drosophila melanogaster. J. Exp. Biol. 202,

1561-1570.

Loi, P. K. and Tublitz, N. J. (2004). Sequence and expression of the CAPA/CAP2b gene in the

tobacco hawkmoth, Manduca sexta. J. Exp. Biol. 207, 3681-3691.

19

Maddrell, S. H. (1963). Excretion in the blood-sucking bug, Rhodnius prolixus Stal. 1. The

control of diuresis. J. Exp. Biol. 40, 247-256.

Maddrell, S. H. (1964a). Excretion in the blood-sucking bug, Rhodnius prolixus Stal. 2. The

normal course of diuresis and the effect of temperature. J. Exp. Biol. 41, 163-176.

Maddrell, S. H. (1964b). Excretion in the blood-sucking bug Rhodnius prolixus Stal. 3. The

control of release of diuretic hormone. J. Exp. Biol. 41, 459-472.

Maddrell, S. H. (1966a). Nervous control of the mechanical properties of the abdominal wall at

feeding in Rhodnius. J. Exp. Biol. 44, 59-68.

Maddrell, S. H. (1966b). The site of release of the diuretic hormone in Rhodnius - a new

neurohemal system in insects. J. Exp. Biol. 45, 499-508.

Maddrell, S. H. (1969). Secretion by the Malpighian tubules of Rhodnius. The movements of

ions and water. J. Exp. Biol. 51, 71-97.

Maddrell, S. H., Pilcher, D. E. M. and Gardiner, B. O. (1971). Pharmacology of the

Malpighian tubules of Rhodnius and Carausius - The structure-activity relationship of

tryptamine analogues and the role of cyclic AMP. J. Exp. Biol. 54, 779-804.

Maddrell, S. H. P. (1976). Functional design of neurosecretory-system controlling diuresis in

Rhodnius prolixus. Am. Zool. 16, 131-139.

Maddrell, S. H. P., O'Donnell, M. J. and Caffrey, R. (1993). The regulation of hemolymph

potassium activity during initiation and maintenance of diuresis in fed Rhodnius prolixus. J. Exp.

Biol. 177, 273-285.

Maddrell, S. H. P. and Phillips, J. E. (1975). Secretion of hypo-osmotic fluid by the lower

Malpighian tubules of Rhodnius prolixus. J. Exp. Biol. 62, 671-683.

Maddrell, S., Herman, W., Mooney, R. and Overton, J. (1991). 5-Hydroxytryptamine: A

second diuretic hormone in Rhodnius prolixus. J Exp Biol 156, 557-566.

20

Maddrell, S. and O'Donnell, M. (1992). Insect Malpighian tubules: V-ATPase action in ion and

fluid transport. J. Exp. Biol. 172, 417-429.

Massaro, R. C., Lee, L. W., Patel, A. B., Wu, D. S., Yu, M., Scott, B. N., Schooley, D. A.,

Schegg, K. M. and Beyenbach, K. W. (2004). The mechanism of action of the anti-diuretic

peptide Tenmo ADFa in Malpighian tubules of Aedes aegypti. J. Exp. Biol. 207, 2877-2888.

Meredith, J., Ring, M., Macins, A., Marschall, J., Cheng, N. N., Theilmann, D., Brock, H.

W. and Phillips, J. E. (1996). Locust ion transport peptide (ITP): Primary structure, cDNA and

expression in a baculovirus system. J. Exp. Biol. 199, 1053.

Montoreano, R., Triana, F., Abate, T. and Rangel-Aldao, R. (1990). Cyclic AMP in the

Malpighian tubule fluid and in the urine of Rhodnius prolixus. Gen. Comp. Endocrinol. 77, 136-

142.

Morris, K. (2009). After 100 years, time to break silence on Chagas disease. The Lancet

Infectious Diseases 9, 468-468.

Nachman, R. J., Russell, W. K., Coast, G. M., Russell, D. H., Miller, J. A. and Predel, R.

(2006). Identification of PVK/CAP2b neuropeptides from single neurohemal organs of the stable

fly and horn fly via MALDI-TOF/TOF tandem mass spectrometry. Peptides 27, 521-526.

Neupert, S., Predel, R., Russell, W. K., Davies, R., Pietrantonio, P. V. and Nachman, R. J.

(2005). Identification of tick periviscerokinin, the first neurohormone of Ixodidae: single cell

analysis by means of MALDI-TOF/TOF mass spectrometry. Biochem. Biophys. Res. Commun.

338, 1860-1864.

Neupert, S., Johard, H. A. D., Nassel, D. and Predel, R. (2007). Single-cell peptidomics of

Drosophila melanogaster neurons identified by Gal4-driven fluorescence. Anal. Chem. 79, 3690.

Neupert, S., Russell, W. K., Russell, D. H., López Jr., J. D., Predel, R. and Nachman, R. J.

(2009). Neuropeptides in Heteroptera: identification of allatotropin-related peptide and

tachykinin-related peptides using MALDI-TOF mass spectrometry. Peptides 30, 483-488.

21

O'Donnell, M.,J., Aldis, G.,K. and Maddrell, S. H.,P. (1982). Measurements of osmotic

permeability in the Malpighian tubules of an insect, Rhodnius prolixus Stal. Proc. R. Soc. Lond.

B 216, 267-277.

O'Donnell, M.,J. and Maddrell, S. H. (1995). Fluid reabsorption and ion transport by the lower

Malpighian tubules of adult female Drosophila. J Exp Biol 198, 1647-1653.

O'Donnell, M. J. and Maddrell, S. H. P. (1984). Secretion by the Malpighian tubules of

Rhodnius prolixus Stal - electrical events. J. Exp. Biol. 110, 275-290.

Olsen, S. S., Cazzamali, G., Williamson, M., Grimmelikhuijzen, C. J. P. and Hauser, F.

(2007). Identification of one capa and two pyrokinin receptors from the malaria mosquito

Anopheles gambiae. Biochemical and biophysical research communications 362, 245-251.

Ons, S., Richter, F., Urlaub, H. and Pomar, R. (2009). The neuropeptidome of Rhodnius

prolixus brain. Proteomics 9, 788.

Orchard, I. (1989). Serotonergic neurohemal tissue in Rhodnius prolixus - synthesis, release and

uptake of serotonin. J. Insect Physiol. 35, 943-947.

Orchard, I. (2006). Serotonin: a coordinator of feeding-related physiological events in the

blood-gorging bug, Rhodnius prolixus. Comparative Biochemistry and Physiology A-Molecular

& Integrative Physiology 144, 316-324.

Orchard, I. (2009). Peptides and serotonin control feeding-related events in Rhodnius prolixus

Front. Biosci. (Elite Ed) 1, 250-262.

Orchard, I., Lange, A. B., Cook, H. and Ramirez, J. M. (1989). A subpopulation of dorsal

unpaired median neurons in the blood-feeding insect Rhodnius prolixus displays serotonin-like

immunoreactivity. J. Comp. Neurol. 289, 118-128.

Orchard, I., Lange, A. B. and Barrett, F. M. (1988). Serotonergic supply to the epidermis of

Rhodnius prolixus: evidence for serotonin as the plasticising factor. Journal of Insect Physiology

34, 873-879.

22

Park, Y., Kim, Y. and Adams, M. E. (2002). Identification of G protein-coupled receptors for

Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-

receptor coevolution. Proc. Natl. Acad. Sci. U. S. A. 99, 11423-11428.

Patel, M., Hayes, T. and Coast, G. (1995). Evidence for the hormonal function of a CRF-

related diuretic peptide (Locusta-DP) in Locusta migratoria. J. Exp. Biol. 198, 793.

Phillips, J. E., Mordue, W., Meredith, J. and Spring, J. (1980). Purification and

characteristics of the chloride transport stimulating factor from locust corpora cardiaca - a new

peptide. Can. J. Zool. 58, 1851-1860.

Phillips, J., Meredith, J., Audsley, N., Richardson, N., Macins, A. and Ring, M. (1998).

Locust ion transport peptide (ITP): A putative hormone controlling water and ionic balance in

terrestrial insects. Am. Zool. 38, 461.

Phillips, J. E., Wiens, C., Audsley, N., Jeffs, L., Bilgen, T. and Meredith, J. (1996). Nature

and control of chloride transport in insect absorptive epithelia. J. Exp. Zool. 275, 292-299.

Pollock, V. P., McGettigan, J., Cabrero, P., Maudlin, I. M., Dow, J. A. T. and Davies, S. A.

(2004). Conservation of capa peptide-induced nitric oxide signaling in Diptera. J. Exp. Biol. 207,

4135-4145.

Predel, R., Russell, W. K., Neupert, S., Russell, D. H., Esquivel, J. F. and Nachman, R. J.

(2006). Identification of the first neuropeptides from the CNS of Hemiptera: CAPA peptides of

the southern green Stinkbug Nezara viridula (L.). Peptides 27, 2670-2677.

Predel, R. and Wegener, C. (2006). Biology of the CAPA peptides in insects. Cell Mol Life Sci

63, 2477-2490.

Predel, R., Wegener, C., Russell, W. K., Tichy, S. E., Russell, D. H. and Nachman, R. J.

(2004). Peptidomics of CNS-associated neurohemal systems of adult Drosophila melanogaster:

A mass spectrometric survey of peptides from individual flies. J. Comp. Neurol. 474, 379-392.

23

Quinlan, M., Tublitz, N. and O'Donnell, M. (1997). Anti-diuresis in the blood-feeding insect

Rhodnius prolixus Stal: the peptide CAP2b and cyclic GMP inhibit Malpighian tubule fluid

secretion. J Exp Biol 200, 2363-2367.

Quinlan, M. C. and O'Donnell, M. J. (1998). Anti-diuresis in the blood-feeding insect

Rhodnius prolixus Stal: antagonistic actions of cAMP and cGMP and the role of organic acid

transport. Journal of Insect Physiology 44, 561-568.

Ramsay, J. A. (1954). Active transport of water by the Malpighian tubules of the stick insect,

Dixippus morosus (Orthoptera, Phasmidae). J. Exp. Biol. 31, 104-113.

Reagan, J. D. (1994). Expression cloning of an insect diuretic hormone receptor: a member of

the calcitonin/secretin receptor family. J. Biol. Chem. 269, 9-12.

Reagan, J. D. (1996). Molecular cloning and function expression of a diuretic hormone receptor

from the house cricket, Acheta domesticus. Insect Biochem. Mol. Biol. 26, 1-6.

Schoofs, L. and Baggerman, G. (2003). Peptidomics in Drosophila melanogaster. Briefings in

Functional Genomics Proteomics 2, 114.

Spring, J. H. and Phillips, J. E. (1980). Studies on locust rectum. 2. Identification of specific

ion-transport processes regulated by corpora cardiaca and cyclic AMP. J. Exp. Biol. 86, 225-236.

Te Brugge, V. A. and Orchard, I. (2002). Evidence for CRF-like and kinin-like peptides as

neurohormones in the blood-feeding bug, Rhodnius prolixus. Peptides 23, 1967-1979.

Te Brugge, V., Ianowski, J. P. and Orchard, I. (2009). Biological activity of diuretic factors

on the anterior midgut of the blood-feeding bug, Rhodnius prolixus. Gen. Comp. Endocrinol.

162, 105-112.

Te Brugge, V. A., Lombardi, V. C., Schooley, D. A. and Orchard, I. (2005). Presence and

activity of a Dippu-DH31-like peptide in the blood-feeding bug, Rhodnius prolixus. Peptides 26,

29-42.

24

Te Brugge, V. A., Miksys, S. M., Coast, G. M., Schooley, D. A. and Orchard, I. (1999). The

distribution of a CRF-like diuretic peptide in the blood-feeding bug Rhodnius prolixus. J. Exp.

Biol. 202, 2017-2027.

Te Brugge, V. A., Nassel, D. R., Coast, G. M., Schooley, D. A. and Orchard, I. (2001). The

distribution of a kinin-like peptide and its co-localization with a CRF-like peptide in the blood-

feeding bug, Rhodnius prolixus. Peptides 22, 161-173.

Te Brugge, V. A., Schooley, D. A. and Orchard, I. (2002). The biological activity of diuretic

factors in Rhodnius prolixus. Peptides 23, 671-681.

Terhzaz, S., O'Connell, F., Pollock, V., Kean, L., Davies, S., Veenstra, J. and Dow, J.

(1999). Isolation and characterization of a leucokinin-like peptide of Drosophila melanogaster.

J. Exp. Biol. 202, 3667-3676.

Terhzaz, S., Southall, T., Lilley, K., Kean, L., Allan, A., Davies, S. and Dow, J. A. T. (2006).

Differential gel electrophoresis and transgenic mitochondrial calcium reporters demonstrate

spatiotemporal filtering in calcium control of mitochondria. The Journal of biological chemistry

281, 18849.

Tsang, P. W. and Orchard, I. (1991). Distribution of FMRFamide-related peptides in the

blood-feeding bug, Rhodnius prolixus. J Comp Neurol 311, 17-32.

Veenstra, J. A., Pattillo, J. M. and Petzel, D. H. (1997). A single cDNA encodes all three

Aedes leucokinins, which stimulate both fluid secretion by the Malpighian tubules and hindgut

contractions. Journal of Biological Chemistry 272, 10402-10407.

Wegener, C., Linde, D. and Eckert, M. (2001). Periviscerokinins in cockroaches: release,

localization, and taxon-specific action on the hyperneural muscle. Gen. Comp. Endocrinol. 121,

1-12.

Wiehart, U., Torfs, P., Van Lommel, A., Nicolson, S. and Schoofs, L. (2002a).

Immunocytochemical localization of a diuretic hormone of the beetle Tenebrio molitor, Tenmo-

DH37, in nervous system and midgut. Cell Tissue Res. 308, 421-429.

25

Wiehart, U. I. M., Nicolson, S. W., Eigenheer, R. A. and Schooley, D. A. (2002b).

Antagonistic control of fluid secretion by the Malpighian tubules of Tenebrio molitor: effects of

diuretic and anti-diuretic peptides and their second messengers. J Exp Biol 205, 493-501.

26

Chapter 2:

Distribution, activity and evidence for the release of an anti-diuretic

peptide in the kissing bug, Rhodnius prolixus

27

Abstract

In the haematophagous insect Rhodnius prolixus, diuresis is accomplished through the combined

actions of peptidergic diuretic hormones and 5-HT released from neurohemal sites on the

abdominal nerves. Preliminary work on anti-diuresis in this blood-feeder, previously believed to

occur through a decrease in the levels of the diuretic factors, indicates that an anti-diuretic

hormone, with properties similar to CAP2b (pELYAFPRVamide; recently renamed Mas-CAPA-

1), might also be present in R. prolixus. Here, we present evidence from immunohistochemical

analysis that suggests a PRXamide-like neuropeptide may be released from the abdominal

neurohemal sites beginning 3–4 h following feeding; a time that coincides with the cessation of

diuresis. We also show evidence for an endogenous factor, isolated from the central nervous

system using reversed-phase high performance liquid chromatography, which mimics the effects

of Mas-CAPA-1. Specifically, this endogenous anti-diuretic factor inhibits rates of 5-HT-

stimulated secretion in a dose-dependent manner and elevates intracellular cGMP levels of

Malpighian tubules stimulated with 5-HT.

28

Introduction

In the haematophagous insect Rhodnius prolixus tubule fluid secretion is accomplished through

the combined actions of peptidergic diuretic hormones and serotonin (5-hydroxytryptamine

hydrochloride; 5-HT) (see Maddrell et al., 1971; 1993; Te Brugge et al., 1999; 2005) acting

through the intracellular second messenger, cyclic 3',5'-adenosine monophosphate (cAMP) (see

Barrett and Orchard, 1990; Montoreano et al., 1990; Te Brugge et al., 1999). Similar mechanisms

controlling diuresis exist in other insect species (see Coast et al., 2002) but, in addition, in

Drosophila melanogaster and Manduca sexta, another second messenger, cyclic 3',5'-guanosine

monophosphate (cGMP) has also been shown to be involved in increasing the rate of tubule fluid

secretion (Skaer et al., 2002; Davies et al., 1995).

Anti-diuresis in R. prolixus, or the cessation of diuresis, has typically been considered to occur

through a decrease in the levels of diuretic hormones 3–4 h following feeding (Maddrell, 1964).

More recent studies on R. prolixus have identified ManseCAP2b (M. sexta cardioactive peptide

2b) and cGMP as components of an anti-diuretic mechanism (Quinlan et al., 1997). Specifically,

cGMP was identified as an intracellular second messenger to ManseCAP2b, and Malpighian

tubule cGMP levels were shown to increase in response to ManseCAP2b and also as tubule

secretion rates declined in vivo (Quinlan et al., 1997). In addition, application of cGMP to tubules

elicited effects that were antagonistic to the secretory effects of cAMP (Quinlan and O'Donnell,

1998). It has been proposed that cGMP activates a cAMP phosphodiesterase that degrades

cAMP, thus lowering the level of the second messenger that stimulates diuresis (O'Donnell and

Spring, 2000).

ManseCAP2b (pELYAFPRVamide, recently renamed Mas-CAPA-1, see later) is a cardioactive

peptide first isolated in M. sexta (Huesmann et al., 1995). It is now known that ManseCAP2b is a

member of a family of peptides sharing the C-terminal PRVamide motif (Loi and Tublitz, 2004).

In the central nervous system (CNS) these include some periviscerokinins (see Wegener et al.,

2002) and CAP2b-related peptides in D. melanogaster and M. sexta (Kean et al., 2002; Loi and

Tublitz, 2004). In the periphery, the PRVamide motif is retained by M. sexta pre-ecdysis-

triggering hormone (MansePETH) from the peripheral endocrine Inka cells. Some other related

peptides have a C-terminal PRXamide motif (where X=I, L, M or V). For example, in

29

Lepidopteran species, these include the pheromone biosynthesis activating neuropeptides

(PBAN) (see Teal et al., 1996) within the central nervous system, and peripherally include

ecdysis-triggering hormone (ETH) (Žitnaň et al., 2002).

Recent studies have isolated and sequenced the gene coding for ManseCAP2b (Loi and Tublitz,

2004). Owing to its high degree of homology with the capability gene in D. melanogaster (Kean

et al., 2002), it was named the Manduca CAPA gene (Loi and Tublitz, 2004). This gene encodes

three propeptides, a CAP2b propeptide and two CAP2b-related propeptides referred to as Mas-

CAPA-1, Mas-CAPA-2 and Mas-pyrokinin-1 (Mas-PK-1), respectively (Loi and Tublitz, 2004).

The capability gene in D. melanogaster encodes three neuropeptides termed CAPA-1 and

CAPA-2, which are CAP2b related, while CAPA-3 is PBAN/PK related (Kean et al., 2002). To

avoid confusion, we will follow the more recent nomenclature and subsequently refer to

ManseCAP2b as Mas-CAPA-1.

Given the recent finding suggesting a novel anti-diuretic mechanism in R. prolixus involving a

Mas-CAPA-1-like peptide and the intracellular second messenger, cyclic GMP (Quinlan et al.,

1997), we sought to map the location of putative Mas-CAPA-1-like immunoreactive cells and to

seek evidence for an endogenous Mas-CAPA-1-like neuropeptide in R. prolixus with anti-

diuretic properties. Here we describe the distribution of PRXamide-like immunoreactive neurons

and neurohemal sites in R. prolixus using an antiserum against MansePETH that recognizes Mas-

CAPA-1. In addition, we provide evidence for the presence of an endogenous Mas-CAPA-1-like

factor from the central nervous system (CNS) of R. prolixus that inhibits 5-HT-stimulated

diuresis and elevates cGMP levels in 5-HT-stimulated tubules.

30

Materials & Methods

Animals

Fifth-instar Rhodnius prolixus Stål were reared at high relative humidity in incubators at 25°C

and routinely fed on rabbits' blood. Experiments were conducted on tissues of the CNS in both

unfed animals (approximately 6 weeks post-ecdysis) and recently fed animals of both sexes.

Immunohistochemical staining

The insects were pinned ventral surface down, and the dorsal cuticle, dorsal diaphragm and

digestive tissue removed under physiological saline (NaCl, 150 mmol l–1; KCl, 8.6 mmol l–1;

CaCl2, 2 mmol l–1; NaHCO3, 4 mmol l–1; glucose, 34 mmol l–1; MgCl2, 8.5 mmol l–1; Hepes pH

7.0, 5 mmol l–1). The nervous tissue was fixed in situ with 2% paraformaldehyde (pH 7.0) at 4°C

overnight (16–18 h). Following fixation, the tissues were washed and the CNS and short stretches

of peripheral nerves removed under phosphate-buffered saline (PBS) (Lange et al., 1988). The

nervous tissue was incubated in 4% Triton X-100, 2% bovine serum albumin (BSA) and 10%

normal sheep serum (NSS) in PBS for 1 h at room temperature followed by several washings

with PBS. The polyclonal rabbit antiserum to MasPETH (generously provided by Dr Dusan

Žitnaň and Dr Mike Adams) diluted 1:1000 was preincubated in 0.4% Triton X-100, 2% bovine

serum albumin (BSA) and 2% normal sheep serum (NSS) in PBS at 4°C overnight (16–18 h)

prior to use. The nervous tissue was then incubated in the antiserum for 48 h on a flatbed shaker

at 4°C. Following this, tissues were washed several times in PBS, including an overnight

washing at 4°C with shaking. Tissues were subsequently incubated overnight (16–18 h) with

Cy3-labelled sheep anti-rabbit immunoglobulin G (IgG; Sigma-Aldrich, St Louis, MO, USA)

diluted 1:200 with 10% NSS in PBS at 4°C with shaking and then washed numerous times at

room temperature. Tissues were mounted in glycerol on microscope slides and observed under a

Nikon epifluorescence microscope. PRXamide-like immunoreactivity (PRXa-LI) was mapped

with the aid of a drawing tube attachment and images were obtained using confocal microscopy

consisting of a helium-neon laser (543 nm line) and Zeiss LSM Image Browser software.

Tissues from fed and unfed insects, of identical age, were compared for intensity of staining,

keeping settings on the confocal microscope constant. All insects, fed or unfed, were kept at

room temperature until they were dissected. To ensure consistency in measurement of intensity

31

of staining, images of individual immunoreactive cell bodies were taken keeping the nucleus of

the cell in focus. Several post-feeding time points were compared to insects that had been

exposed to the rabbit but not allowed to feed. Staining intensity was converted into grayscale

values using the ImageJ Software (Rasband, 2005) and then subjected to statistical analyses

including analysis of variance (ANOVA) and Tukey post-test. Grayscale values of confocal

images were analyzed over an intensity scale from 0 to 255 (minimum to maximum intensity

threshold for an 8-bit image, respectively).

Reverse phase high performance liquid chromatography (RP-HPLC)

Central nervous systems were dissected under saline and pooled in a 500 µl volume of

methanol:acetic acid:water (90:9:1, by volume) and stored at –20°C for later use. The CNS tissue

from 250 insects was then sonicated and centrifuged at 10 000 g for 10 min. The supernatant was

collected and dried in a Speed Vac concentrator (Savant, Farmingdale, NY, USA) and then

reconstituted in 0.1% trifluoroacetic acid (TFA). This sample was then applied to a C18 Sep-Pak

cartridge (Waters Associates, Mississauga, ON, Canada) that had been sequentially equilibrated

with 8 ml of methanol, 8 ml ddH2O, 8 ml 0.1% TFA, and finally 5 ml 0.1% TFA containing 1 µg

protease-free bovine serum albumin (BSA; Sigma, Mississauga, ON, Canada). Once the sample

was loaded, the cartridge was first washed with 0.1% TFA and subsequently extracts were

collected by eluting with 5 ml of 60% acetonitrile (ACN; Burdick and Jackson, Muskegon, MI,

USA) with 0.1% TFA. The eluant was dried in a Speed Vac concentrator and then resuspended in

high performance liquid chromatography (HPLC) start buffer (9% acetonitrile, 0.1% TFA) to be

fractionated by reverse phase HPLC (RP-HPLC) using a Brownlee C18 column (Mandel/Alltech,

Guelph, ON, Canada) with a linear gradient of 9–60% ACN over 34 min, beginning 5 min after

injection. Fractions with Mas-CAPA-1-like biological activity were identified by tubule secretion

assays and cGMP RIA.

Malpighian tubule fluid secretion assay

Rhodnius prolixus have four Malpighian tubules (two bilateral pairs) composed of both upper

and lower segments. Whole tubules from fifth instars were dissected under saline and transferred

on glass probes to a Sylgard-coated Petri dish containing 20 µl drops of saline overlaid with

water-saturated mineral oil. Two tubules were mounted in each 20 µl bathing droplet. The

proximal end of the tubule was pulled out of the saline droplet and wrapped around a nearby

32

minuten pin. The equilibrating saline was removed and replaced with saline containing 50 nmol

l–1 5-hydroxytryptamine (5-HT; Sigma, Oakville, ON, Canada) alone or combined with different

concentrations of Mas-CAPA-1 (custom synthesized by GenScript Corp., Piscataway, NJ, USA)

or CNS RP-HPLC fractions. Tubules were allowed to secrete for 30 min. Droplets of secreted

fluid from the nicked end of the tubule were then collected using an oil-filled micropipette tip.

The droplet was then blown out under oil to be measured on the bottom of the Sylgard-coated

Petri dish. The droplet volume was calculated using the equation V=(π/6)d3, where d is the

droplet diameter measured using an eyepiece micrometer. At the end of the experiment, a

maximal rate of secretion was established by stimulating with 1 µmol l–1 5-HT to check on the

viability of the tubules. Values, expressed as mean ± standard errors of the mean (s.e.m.), were

then subjected to statistical analysis using Student's t-test.

Malpighian tubule cyclic GMP radioimmunoassay

Malpighian tubules were dissected under saline and tested as a set, including all four tubules

from fifth instars, and transferred to a microcentrifuge tube containing saline, 50 nmol l–1 5-HT

alone or 50 nmol l–1 5-HT combined with either Mas-CAPA-1 or CNS RP-HPLC fractions in a

total volume of 50 µl. Tubules were incubated for 10 min and the experiment terminated by

adding 250 µl of boiling 50 mmol l–1 sodium acetate (pH 6.2). The incubation tubes were then

immediately placed in a boiling water bath for 5 min and then stored at –20°C. To prepare the

samples for the assay, tubes were thawed, sonicated briefly on ice and centrifuged at 4°C for 10

min at 8800 g. The supernatant was then collected and assayed using a cyclic GMP RIA kit

(PerkinElmer/NEN, Boston, MA, USA). Assays were performed according to the manufacturer's

instructions except for some minor changes in volumes and ratio of reagents.

33

Results

PRXamide-like immunoreactivity

Overview

In general, PRXamide-like immunoreactivity (PRXa-LI) in the central nervous system of R.

prolixus is present in bilaterally paired cells and processes, as illustrated in the composite camera

lucida drawings (Figure 1). With the exception of strongly staining cells in the posterior-ventral

mesothoracic ganglionic mass (MTGM), most processes could only be traced a short distance

within the CNS. The processes, excluding those associated with the dorsal vessel and abdominal

nerves, did not appear to exit the CNS. There were no differences observed in PRXa-LI between

male and female fifth instar R. prolixus; however the intensity of immunoreactive staining

differed greatly following a blood meal (see later). Overnight preincubation of the antiserum with

Mas-CAPA-1 (50 µmol l–1) eliminated all immunoreactivity of cells and processes within the

CNS with the exception of the very intensely staining cells of the posterior-ventral MTGM,

which were greatly reduced in intensity.

Brain and retrocerebral complex

On the dorsal surface of the brain, two main groups of cells showed PRXa-LI (Figure 2A). The

first group consists of a bilateral pair of lateral neurosecretory cells (LNCs) prominently

identified in the border region of the optic lobe and brain, which have processes projecting

medially through the brain. A second group of cells consists of five pairs of medial

neurosecretory cells (MNCs) arranged as a cluster along the boundary between the protocerebral

lobes. Immunoreactive varicosities were also present along the periphery of the protocerebral

lobes originating at the optic lobe/brain boundary and also present anterior to the MNCs. Some

immunoreactivity appeared to be associated with the corpus cardiacum, however, extensive

PRXamide-like immunoreactive processes were present along the walls of the aorta, decreasing

in intensity as they proceed posteriorly (Figure 2B).

The ventral surface of the brain contains two sets of bilaterally paired cells (Figure 3A), which

are located posterior to the LNCs. These cells project processes posteriorly. Varicosities similar

34

Figure 1. Composite camera lucida drawing of PRXamide-like immunoreactive cells and

processes in the central nervous system of R. prolixus. Left, dorsal view; right, ventral view.

Filled cells indicate strong PRXamide-like immunoreactivity (PRXa-LI) and open cells indicate

weak PRXa-LI. Within the mesothoracic ganglionic mass (MTGM), the ventral paired median

cells give rise to immunoreactive processes which project dorsally and then exit the CNS via the

second, third and fourth abdominal nerves (ABN) where they develop neurohemal sites. PRO,

prothoracic ganglion; SOG, sub-oesophageal ganglion. Scale bar, 200 µm.

36

Figure 2. PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus. Dorsal views

of (A) brain, (B) sub-oesophageal ganglion (SOG), (C) prothoracic ganglion and (D) the

mesothoracic ganglionic mass (MTGM). In A, putative lateral neurosecretory cells and medial

neurosecretory cells are indicated by open and filled arrows, respectively. In B, note the strong

immunoreactivity in putative neurohemal sites on the dorsal vessel (open arrows) and light

staining over the corpus cardiacum (filled arrow). In C, note the numerous medial processes with

PRXa-LI that originate in the SOG and project into the MTGM. In D, note the lateral paired cells

(open arrows) and the processes originating from the ventral paired neurosecretory cells (filled

arrows). Scale bar, 100 µm.

38

Figure 3. PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus. Ventral views

of (A) brain, (B) sub-oesophageal ganglion, (C) prothoracic ganglion (PRO) and (D) the

mesothoracic ganglionic mass. In A, note the lateral immunoreactive cells (open arrows). In B,

note the numerous bilaterally paired cell bodies (open arrows) lying medially. In C, note the

lightly staining immunoreactive varicosities over the ventral PRO. In D, note the

immunoreactive cell bodies (open arrows) and extensive neurohemal-like immunoreactivity on

the abdominal nerves (closed arrows). The intensity of staining of these cells is greatly reduced

3–4 h following feeding (see later). Scale bar, 100 µm.

40

to the pattern visible on the dorsal surface of the brain were also observed on the ventral surface

of the brain. Immunoreactive processes were also seen in the recurrent nerve with numerous cell

bodies staining for PRXa-LI in the frontal ganglion (Figure 4A).

Sub-oesophageal ganglion (SOG)

The dorsal sub-oesophageal ganglion (SOG) did not contain any PRXamide-like immunoreactive

cell bodies; however, two bilaterally paired immunoreactive processes were observed passing in

the medial and lateral margins of the SOG (Figure 2B). On the ventral SOG, several bilaterally

paired cells demonstrate strong PRXa-LI. Some of these cells can be seen projecting processes

posteriorly in Figure 3B. PRXamide-like immunoreactive processes were present at the posterior

margin of the SOG and within the connectives of the SOG and prothoracic ganglion.

Prothoracic ganglion (PRO)

Processes originating from the SOG are observed in the dorsal prothoracic ganglion (PRO). The

medial processes continue through to the posterior of the PRO whereas some lateral processes

arborise in the central neuropile (Figure 2C). On the ventral surface of the PRO, some faint PRX-

amide immunoreactive staining was observed in the central neuropile (Figure 3C).

Mesothoracic ganglionic mass (MTGM)

On the dorsal surface of the mesothoracic ganglionic mass (MTGM), a small number of cell

bodies showed faint PRXa-LI in both the mesothoracic and the abdominal neuromeres (Figure

2D). Specifically, in the mesothoracic neuromere there were two cells (bilaterally paired) with

posteriorly projecting processes. In the abdominal neuromeres, there are four cells (two

bilaterally paired) along the lateral margins with processes projecting medially. The processes

originating from the SOG and passing through the PRO continue into the MTGM where they

arborise in the metathoracic neuromere. Processes from three pairs of strongly staining cell

bodies located on the ventral MTGM project dorsally and then posteriorly continue into the

41

Figure 4. PRXamide-like immunoreactivity (PRXa-LI) in fifth-instar R. prolixus. (A) Frontal

ganglion (FG) with numerous immunoreactive cell bodies; (B) immunoreactive neurohemal sites

on the second (ABN2), third (ABN3) and fourth (ABN4) abdominal nerves. In B, note that

abdominal nerves two and three contain more elaborate immunoreactive neurohemal sites. Scale

bar, 100 µm.

43

second, third and fourth abdominal nerves that stem from the abdominal neuromeres in the

posterior MTGM (Figure 2D, Figure 3D). These immunoreactive processes form extensive

neurohemal sites over the proximal portion of the nerves and distally continue as fine processes

(Figure 3D, Figure 4B).

Cell bodies with variable PRXa-LI were observed on the ventral surface of the MTGM.

Beginning anteriorly, there was a ventral unpaired medial (VUM) neuron within the

mesothoracic neuromere, which had strong PRXa-LI. Moving posteriorly, within the

metathoracic neuromere, a bilateral pair of cells showed weak PRXa-LI. Finally, within the

midline of the abdominal neuromeres, the six (three bilaterally paired) strongly staining cells,

referred to earlier, were consistently seen with their processes projecting dorsally and then

posteriorly out of corresponding abdominal nerves. Of this strongly staining group, the most

anterior pair projects through the second abdominal nerve, whereas the second pair project to the

third abdominal nerves, and the last strongly staining pair, and most posterior, project processes

through the fourth abdominal nerves. Each cell of the most posterior pair have a diameter of 29

µm, which is considerably larger than the two more anterior pairs of cells (16 µm).

Time-course immunohistochemical analysis

Following a blood meal, extensive changes in the intensity of staining of PRXamide-like cells

and processes are observed. Specifically, over the MTGM, the staining of the six strongly

staining cells within the abdominal neuromeres becomes weaker in intensity, beginning as early

as 3 h following a blood meal (Figure 5). These cells project into the abdominal nerves, and form

neurohemal sites, suggesting a location for release into the haemolymph. Changes in PRXa-LI

post-feeding were analyzed by evaluating staining intensity of the six strongly staining cell

bodies over the MTGM using the ImageJ software package. No significant changes in staining

intensity were seen in unfed control animals across all time points analyzed. In contrast, staining

intensity appears to weaken as early as 3 h following feeding (see Figure 5). As time post-feeding

progresses, significant decreases in staining intensity were observed. Interestingly, the largest and

most posterior pair of cells regained staining before the two smaller and more anterior pairs of

cells. This last pair of cells projects processes into the fourth abdominal nerves, which has

44

Figure 5. Time-course immunohistochemical analysis of the ventral paired medial

neurosecretory cells in the MTGM of fifth-instar R. prolixus. Immunohistochemical analysis was

conducted on a group of animals that were either fed for 20 min on rabbit's blood (hatched bars)

or not fed (white bars). (A–G) PRXamide-like immunoreactivity (PRXa-LI) was examined at 1,

2, 3, 4, 5, 24 and 48 h post feeding, respectively. (H) Confocal image of the ventral paired

median neurosecretory cells showing the labelling scheme utilized in A–G. Scale bar, 50 µm.

*PRXa-LI that differs significantly from controls (unfed) (P<0.05, ANOVA and Tukey post-

test).

46

notably fewer neurohemal sites than the second and third abdominal nerves. Nonetheless, the

intensity of staining of the neurohemal sites and processes over the abdominal nerves was visibly

assessed and was reduced at the same time points.

Malpighian tubule fluid secretion assay

To better characterize the anti-diuretic mechanism in R. prolixus, we tested various

concentrations of Mas-CAPA-1 on 5-HT-stimulated tubules and observed a dose-dependent

inhibition on tubule secretion (Figure 6). Threshold was observed at approximately 0.1 nmol l–1

Mas-CAPA-1 and maximal inhibition at a dose of 1 µmol l–1 Mas-CAPA-1. In order to provide

further empirical evidence for the presence of a Mas-CAPA-1-like neuropeptide in R. prolixus,

we tested individual fractions from RP-HPLC against 5-HT-stimulated tubules and identified an

anti-diuretic fraction. This fraction (fraction 25) ran in close proximity to synthetic Mas-CAPA-

1, which eluted from the C18 column at 24.5 min (an acetonitrile concentration of 38.25%).

Tubules incubated in this fraction, in the presence of 50 nmol l–1 5-HT, showed a dose-dependent

decrease in secretion rate (Figure 7). Thus, tubules stimulated with 50 nmol l–1 5-HT and this

anti-diuretic fraction from 1 CNS equivalent inhibited secretion by 11%, from 5 CNS equivalents

by 27% and from 10 CNS equivalents by 74%. The ability of a single CNS equivalent to decrease

secretion by only 11% could be due to the combined influence of losses associated with

sonication of tissues and preparatory steps prior to HPLC as well as impurity of the factor. Since

CNS extracts were run only through a single column, other factors eluting within this fraction

could be contributing to the biological activity observed.

Malpighian tubule cyclic GMP radioimmunoassay

To further understand the mechanism of action of this endogenous Mas-CAPA-1-like anti-

diuretic neuropeptide in R. prolixus, cyclic GMP radioimmunoassays were conducted on fifth

instars to confirm the previous observation of an elevation of intracellular cGMP in response to

Mas-CAPA-1 in third-instar tubules stimulated with 5-HT. 5-HT (50 nmol l–1) lowered cGMP

47

levels of fifth-instar tubules and these levels were restored to control values by Mas-CAPA-1 at

500 nmol l–1 (Figure 8). Similarly, fraction 25 at 10 CNS equivalents also increased the cGMP

Figure 6. Dose–response curve demonstrating Mas-CAPA-1 inhibition of secretion by

Malpighian tubules stimulated with 50 nmol l–1 5-HT. Control tubules received 50 nmol l–1 5-

HT. Values are mean ± s.e.m., N=8 or more tubules.

49

Figure 7. Inhibition of secretion (stimulated with 50 nmol l–1 5-HT) with increasing doses of

Fraction 25 from RP-HPLC. Values are expressed as a percentage of control (normal secretion of

tubules stimulated with 50 nmol l–1 5-HT). Values are mean ± s.e.m., N=8 or more tubules.

*Statistically significant inhibition (P<0.001).

51

Figure 8. Change in levels of intracellular cGMP in tubules stimulated with 5-HT alone or in

combination with Mas-CAPA-1 (500 nmol l–1) or Fraction 25 (F25; 10 CNS equivalents) vs

saline alone. 5-HT lowers cGMP levels, and these levels can be restored to those with saline

alone or above by Mas-CAPA-1 or Fraction 25 (* significantly different from 5-HT alone at

P<0.05). In addition, levels of intracellular cGMP in tubules stimulated with Fraction 25 were

also significantly higher (†) than tubules stimulated with Mas-CAPA-1 or saline alone (P<0.05).

53

levels of 5-HT-stimulated tubules (Figure 8). The levels of cGMP in tubules stimulated with

fraction 25, in the presence of 50 nmol l–1 5-HT, were found to be significantly higher than

unstimulated tubules, suggesting that the actions of this endogenous Mas-CAPA-1-like factor

involve augmenting levels of intracellular cGMP.

54

Discussion

Using a polyclonal antiserum to MasPETH, which identifies peptides sharing a common C-

terminal tripeptide motif PRXamide [X=I, L, M or V (Žitnaň et al., 2003)], we have

demonstrated the presence of cell bodies and processes having PRXa-LI throughout the central

and peripheral nervous system of fifth-instar R. prolixus. Several insect neuropeptides sharing

this common C-terminal motif have been identified and the CAPA gene encodes three extended

PRXamides, including CAPA-1 (a PRVamide). Of these closely related neuropeptides, the

PRXa-LI observed in fifth-instar R. prolixus closely resembles the immunocytochemical

localization of the CAPA gene peptides in D. melanogaster (Kean et al., 2002). More

specifically, the strongly immunoreactive ventral medial cells over the abdominal neuromeres in

the posterior MTGM closely resemble three pairs of abdominal neurosecretory cells in D.

melanogaster, which stain for the CAPA precursor protein, and thus provides evidence that these

cell types produce CAP2b-related peptides (Kean et al., 2002). In addition, the distribution in R.

prolixus of PRXamide-like immunoreactive cells over the MTGM resembles CAPA gene-

expressing cells in the abdominal ganglia of larval and adult M. sexta (Loi and Tublitz, 2004).

Medial neurosecretory cells showing PRXa-LI over the dorsal brain of fifth-instar R. prolixus

resemble cells over the dorsal brain of M. sexta larvae that express CAPA transcripts (Loi and

Tublitz, 2004). Taken together, these similarities in immunoreactivity along with the abolition of

immunoreactivity following preincubation of the antiserum with Mas-CAPA-1, suggests that the

immunoreactivity observed indicates the presence of Mas-CAPA-1-like neuropeptides in the

CNS of R. prolixus. More importantly, the medial ventral cell bodies in the MTGM project

processes into the abdominal nerves, well-known neurohemal release sites (Miksys and Orchard,

1994), and thus provides a location for release of these peptides into the haemolymph.

Furthermore, the intensity of staining of immunoreactivity in these cell bodies and their

neurohemal release sites is greatly reduced 3–4 h post feeding – a time when the cessation of

diuresis is observed (Maddrell, 1964), suggesting the release of an anti-diuretic factor.

We suggest that the strong PRXa-LI observed over the MTGM and abdominal nerves provides

evidence for a CAPA-like neuropeptide in the CNS of R. prolixus, which includes a Mas-CAPA-

1-like peptide. The presence of PRXamide-like immunoreactive cell bodies in addition to

55

processes and neuropiles over the length of the CNS suggest additional roles as neurotransmitters

and/or neuromodulators. Future studies will help elucidate whether the PRXamide-like peptide

functions as a neurotransmitter and/or neuromodulator in R. prolixus. Certainly, the results

indicate that the PRXamide-like neuropeptide in R. prolixus acts as a neurohormone since there is

evidence of release from the MTGM and abdominal nerves as well as activity on a non-

innervated visceral tissue (Malpighian tubules).

Previous analyses on third-instar R. prolixus tubules showed dose-dependent effects of Mas-

CAPA-1in the nanomolar range (Quinlan et al., 1997). To better understand the response of

tubules to Mas-CAPA-1-like peptides in fifth-instar R. prolixus, we tested a broad range of

physiological doses of Mas-CAPA-1 to determine the dose-dependency on isolated tubules. At

0.1 nmol l–1, the lowest dose tested, Mas-CAPA-1 caused a 5% decrease in secretion. This

neuropeptide had a maximal effect on tubules at 1 µmol l–1, inhibiting secretion by over 75%. A

higher dose (10 µmol l–1) of this neuropeptide was slightly less effective at inhibiting fluid

secretion, possibly indicating the beginning of receptor desensitization.

Further evidence for the presence of a Mas-CAPA-1-like neuropeptide in R. prolixus sharing

similar characteristics to Mas-CAPA-1 was revealed by bioassay of native material. Analysis of

RP-HPLC fractions from 250 CNSs revealed a factor with anti-diuretic effects on Malpighian

tubules stimulated with 5-HT. This factor eluted from the C18 column at a similar time and

acetonitrile concentration to Mas-CAPA-1, suggesting that this factor shares similar

chromatographic properties to Mas-CAPA-1. Doses as low as a single CNS equivalent were

adequate in eliciting an anti-diuretic effect on tubules. Furthermore, tubules stimulated with

higher doses of this factor demonstrated a greater inhibition of secretion, indicating the effects of

this factor are dose dependent. To our knowledge, this is the first study to show direct evidence

for the presence of an endogenous anti-diuretic factor in R. prolixus, which significantly inhibits

5-HT-stimulated secretion in a dose-dependent manner.

This same fraction elevated intracellular cyclic GMP levels in tubules stimulated with 5-HT,

indicating that this second messenger may be exploited by the native Mas-CAPA-1-like anti-

diuretic peptide in R. prolixus. Moreover, this fraction not only reversed the effects of 5-HT on

cGMP, but at this dose also increased cGMP above its original saline control values. This result

56

implies that this factor is actively involved in the synthesis of intracellular cGMP, which, as

suggested previously, may involve the actions of a guanylate cyclase belonging to the class of

membrane-bound enzymes (Quinlan et al., 1997). Interestingly, Mas-CAPA-1 has been shown to

increase the synthesis of nitric oxide and cGMP leading to an increase in fluid production in D.

melanogaster tubules (Davies et al., 1995; Davies et al., 1997). Expression of the receptor for

Mas-CAPA-1 in tubules has been shown in a number of Dipterans (see Pollock et al., 2004). It is

interesting that there has been a divergence in signaling between these organisms.

In conclusion, this study investigated the distribution of PRXa-LI throughout the CNS of R.

prolixus. It is probable that many of these cells, especially those in the abdominal neuromeres,

are Mas-CAPA-1-like since: (1) preincubation of the antiserum with Mas-CAPA-1 peptide

eliminated all immunoreactivity within the CNS; (2) immunoreactivity was significantly reduced

beginning 3–4 h post-feeding in accordance with the time of anti-diuretic behaviour (Maddrell,

1964), which suggests the release of an anti-diuretic peptide from the putative neurohemal release

sites on the abdominal nerves; (3) this study, as well as previous studies on third-instar R.

prolixus, have shown that Mas-CAPA-1 elicits an anti-diuretic effect on R. prolixus tubules

(Quinlan et al., 1997); (4) tubule secretion assay utilizing CNS fractions from a C18 HPLC run

identified a factor with Mas-CAPA-1-like biological activity, which inhibits 5-HT-induced

tubule secretion; lastly, (5) this same RP-HPLC fraction containing an anti-diuretic factor was

also effective at increasing levels of intracellular cGMP in Malpighian tubules.

57

References

Barrett, F. M. and Orchard, I. (1990). Serotonin-induced elevation of cyclic AMP levels in the

epidermis of the blood-sucking bug, Rhodnius prolixus. J. Insect Physiol. 36, 625 -633.


diuretic hormones. Adv. Insect Physiol. 29, 279 -409.

Davies, S. A., Huesmann, G. R., Maddrell, S. H. P., O'Donnell, M. J., Skaer, N. J. V., Dow,

J. A. T. and Tublitz, N. J. (1995). CAP2b, a cardioacceleratory peptide, is present in

Drosophila and stimulates tubule fluid secretion via cGMP. Am. J. Physiol. 269, R1321 -

R1326.

Davies, S. A., Stewart, E. J., Huesmann, G. R., Skaer, N. J., Maddrell, S. H., Tublitz, N. J.

and Dow, J. A. (1997). Neuropeptide stimulation of the nitric oxide signaling pathway in

Drosophila melanogaster Malpighian tubules. Am. J. Physiol. 273, R823 -R827.


(1995). Amino acid sequence of CAP2b, an insect cardioacceleratory peptide from the

tobacco hawkmoth Manduca sexta. FEBS Lett. 371, 311 -314.


A., Veenstra, J. A. and Dow, J. A. (2002). Two nitridergic peptides are encoded by the

gene capability in Drosophila melanogaster. Am. J. Physiol. 269, R1297 -R1307.

Lange, A. B., Orchard, I. and Llyod, R. J. (1988). Immunohistochemical and electrochemical

detection of serotonin in the nervous system of the blood-feeding bug, Rhodnius prolixus.

Arch. Insect Biochem. Physiol. 8, 187-201.


tobacco hawkmoth, Manduca sexta. J. Exp. Biol. 207, 3681 -3691.

Maddrell, S. H. P. (1964). Excretion in the blood-sucking bug, Rhodnius prolixus Stål. II. The

normal course of diuresis and the effect of temperature. J. Exp. Biol. 41, 163 -176.

Maddrell, S. H. P., Pilcher, D. E. M. and Gardiner, B. O. C. (1971). Pharmacology of the

Malpighian tubules of Rhodnius and Carausius: the structure-activity relationship of

tryptamine analogues and the role of cyclic AMP. J. Exp. Biol. 54, 779 -804.

58

Maddrell, S. H. P., Herman, W. S., Farndale, R. W. and Riegel, J. A. (1993). Synergism of

hormones controlling epithelial fluid transport in an insect. J. Exp. Biol. 174, 65-80.

Miksys, S. and Orchard, I. (1994). Immunogold labelling of serotonin-like and FMRFamide-

like immunoreactive material in neurohemal areas on abdominal nerves of Rhodnius

prolixus. Cell Tissue Res. 278, 145 -151.

Montoreano, R., Triana, F., Abate, T. and Rangel-Aldao, R. (1990). Cyclic AMP in the

Malpighian tubule fluid and in the urine of Rhodnius prolixus. Gen. Comp. Endocrinol.

77, 136 -142.

O'Donnell, M. J. and Spring, J. H. (2000). Modes of control of insect Malpighian tubules:

synergism, antagonism, cooperation and autonomous regulation. J. Insect Physiol. 46,

107 -117.


(2004). Conservation of capa peptide-induced nitric oxide signaling in Diptera. J. Exp.

Biol. 207, 4135 -4145.

Quinlan, M. C. and O'Donnell, M. J. (1998). Anti-diuresis in the blood-sucking insect

Rhodnius prolixus Stål: antagonistic actions of cAMP and cGMP and the role of organic

acid transport. J. Insect Physiol. 44, 561 -568.

Quinlan, M. C., Tublitz, N. J. and O'Donnell, M. J. (1997). Anti-diuresis in the blood-sucking

insect Rhodnius prolixus Stål: the peptide CAP2b and cyclic GMP inhibit Malpighian

tubule fluid secretion. J. Exp. Biol. 200, 2363 -2367.

Rasband, W. S. (2005). ImageJ, US National Institutes of Health, Bethesda, Maryland, USA.

Skaer, N. J. V., Nässel, D. R., Maddrell, S. H. P. and Tublitz, N. J. (2002). Neurochemical

fine tuning of a peripheral tissue: peptidergic and aminergic regulation of fluid secretion

by Malpighian tubules in the tobacco hawkmoth M. sexta. J. Exp. Biol. 205, 1869 -1880.

Teal., P. E., Abernathy, R. L., Nachman, R. J., Fang, N., Meredith, J. A. and Tumlinson, J.

H. (1996). Pheromone biosynthesis activating neuropeptides: Functions and chemistry.

Peptides 17, 337 -344.

59


distribution of a CRF-like diuretic peptide in the blood-feeding bug Rhodnius prolixus. J.

Exp. Biol. 202, 2017 -2027.


activity of a Dippu-DH31-like peptide in the blood-feeding bug, Rhodnius prolixus.

Peptides 26, 29-42.

Wegener, C., Herbert, Z., Eckert, M. and Predel, R. (2002). The periviscerokinin (PVK)

peptide family in insects: evidence for the inclusion of CAP(2b) as a PVK family

member. Peptides 23, 605 -611.

Žitnaň, D., Hollar, L., Spalovská, I., Takác, P., Zitnanová, I., Gill, S. S. and Adams, M. E.

(2002). Molecular cloning and function of ecdysis-triggering hormones in the silkworm

Bombyx mori. J. Exp. Biol. 205, 3459 -3473.

Žitnaň, D., Zitnanová, I., Spalovská, I., Takác, P., Park, Y. and Adams, M. E. (2003).

Conservation of ecdysis-triggering hormone signaling in insects. J. Exp. Biol. 206, 1275 -

1289.

60

Acknowledgements

We are grateful to Dr Mike Adams and Dr Dusan Žitnaň for their generous gift of the anti-PETH

antiserum. This research was supported through an NSERC grant to I.O.

61

Copyright Acknowledgements

The preceeding chapter was reproduced / adapted with permission from The Company of

Biologists.

Full citation details:

Distribution, activity and evidence for the release of an anti-diuretic peptide in the kissing bug Rhodnius prolixus. Paluzzi JP, Orchard I. J Exp Biol. 2006 Mar;209(Pt 5):907-15. doi: 10.1242/jeb.02083

62

Chapter 3:

Isolation, cloning, and expression mapping of a gene encoding an anti-

diuretic hormone and other CAPA-related peptides in the disease

vector, Rhodnius prolixus

63

Abstract

After a blood meal, Rhodnius prolixus undergoes a rapid diuresis to eliminate excess water and

salts. During the voiding of this primary urine, R. prolixus acts as a vector of Chagas’ disease,

with the causative agent, Trypanosoma cruzi, infecting the human host via the urine. Diuresis in

R. prolixus is under the neurohormonal control of serotonin and peptidergic diuretic hormones,

and thus, diuretic hormones play an important role in the transmission of Chagas’ disease.

Although diuretic hormones may be degraded or excreted, resulting in the termination of diuresis,

it would also seem appropriate, given the high rates of secretion, that a potent anti-diuretic factor

could be present and act to prevent excessive loss of water and salts after the postgorging

diuresis. Despite the medical importance of R. prolixus, no genes for any neuropeptides have

been cloned, including obviously, those that control diuresis. Here, using molecular biology in

combination with matrix-assisted laser desorption ionization-time of flight-tandem mass

spectrometry, we determined the sequence of the CAPA gene and CAPA-related peptides in R.

prolixus, which includes a peptide with anti-diuretic activity. We have characterized the

expression of mRNA encoding these peptides in various developmental stages and also examined

the tissue-specific distribution in fifth-instars. The expression is localized to numerous bilaterally

paired cell bodies within the central nervous system. In addition, our results show that

RhoprCAPA gene expression is also associated with the testes, suggesting a novel role for this

family of peptides in reproduction.

64

Introduction

The hematophagous insect, Rhodnius prolixus, can transmit Chagas’ disease after feeding on

humans in Central and South America where the insects are endemic (Rabinovich and

Himschoot, 1990; Ramsey et al., 2000; Monroy et al., 2003; Feliciangeli et al., 2004). The

parasite, Trypanosoma cruzi, infects humans when it is passed out of the insect in the primary

urine produced as a result of the large blood meal imbibed. The parasite often enters the human

host through the wound left after the blood meal. The postprandial diuresis is under the

neurohormonal control of serotonin [5-hydroxytryptamine (5-HT)] and various peptidergic

diuretic hormone (DH) families acting on the Malpighian tubules (MTs) (Maddrell, 1963; 1964;

Maddrell et al., 1991; Te Brugge et al., 1999; 2002; 2005; Orchard, 2006). In this regard, it might

be stated that serotonin and the DHs aid in the transmission of Chagas’ disease; disrupting

diuresis would therefore disrupt the transmission of the parasite. Despite the medical importance

of R. prolixus, no genes have been cloned for any neuropeptides, although with the

announcement of National Institutes of Health funding the R. prolixus genome project, prospects

for the future are positive (http://www.genome.gov/13014443).

Much is known about the neurohormonal control of diuresis in insects, including R. prolixus, and

a number of DH families have been identified. These peptide families include the corticotropin-

releasing factor-related DHs, calcitonin-related DHs, kinin-related DHs, and cardioacceleratory

peptide 2b (CAP2b)-related DHs (Maddrell, 1963; 1964; Maddrell et al., 1991; Te Brugge et al.,

1999; 2002; 2005; Orchard, 2006; Coast et al., 2002; Coast, 2007).

In contrast to these diuretic factors that stimulate MT secretion, only a few anti-diuretic factors

that specifically inhibit MT secretion have been identified. Two peptides have been isolated from

the yellow mealworm beetle, Tenebrio molitor, anti-diuretic factor (ADF)-a and ADFb, which

act via cGMP to inhibit basal as well as native corticotropin-releasing factor-stimulated secretion

of tubules (Eigenheer et al., 2002; 2003; Wiehart et al., 2002). Additional factors have been

partially isolated from other insects such as the cricket, Acheta domesticus (Spring et al., 1988);

the mosquito, Aedes aegypti (Petzel and Conlon, 1991); the forest ant, Formica polyctena (de

Decker et al., 1994); and the Colorado potato beetle, Leptinotarsa decemlineata (Lavigne et al.,

2001). Interestingly, CAP2b, originally identified in Manduca sexta, has been shown to have

65

anti-diuretic activity in R. prolixus and appears to use cGMP as a second messenger (Quinlan et

al., 1997). This is surprising because CAP2b-related peptides are potent stimulators of MT

secretion in some other insects, including Drosophila melanogaster. Using a combination of

immunohistochemical, physiological, and chromatographic methods, we recently partially

isolated a native CAP2b-related peptide from the central nervous system (CNS) of R. prolixus

that has anti-diuretic activity. This endogenous anti-diuretic factor appears to be released at a

time when the cessation of diuresis is observed naturally and has a potent inhibitory effect on

serotonin-stimulated fluid secretion and elevates levels of its cognate intracellular mediator,

cGMP (Paluzzi and Orchard, 2006). For a blood-gorging insect such as R. prolixus, which

undergoes a very rapid diuresis after a blood meal, it is of importance to understand the efficient

anti-diuretic mechanism acting to prevent excessive loss of water and salts.

Here, using molecular biology in combination with matrix-assisted laser desorption ionization-

time of flight (MALDI-TOF) tandem mass spectrometry, we determined the sequence of the

capability (CAPA) gene in R. prolixus, which encodes the peptidergic anti-diuretic peptide,

CAP2b. This peptide inhibits serotonin-stimulated diuresis and elevates cGMP content of

serotonin-stimulated MTs. We characterized the expression of mRNA encoding these peptides in

all postembryonic developmental stages and have examined the spatial expression pattern in

various tissues of fifth-instars using RT-PCR. In addition, fluorescent in situ hybridization

(FISH) using peroxidase-mediated tyramide signal amplification was used to monitor the cell-

specific expression of the R. prolixus CAPA gene in fifth-instars. With the identification of this

potent endogenous anti-diuretic peptide, future investigations may focus on the design of

mimetic analogs of this peptide that would serve as prospective pest management agents to

inhibit the rapid production of primary urine that immediately follows blood gorging, thereby

impeding the transmission of Chagas’ disease by this human blood-feeding disease vector.

66

Materials & Methods

Animals

Fifth-instar R. prolixus Stål were reared at high relative humidity in incubators at 25°C and

routinely fed on rabbits’ blood. Tissues were dissected from insects under physiological saline

prepared as described previously (Paluzzi and Orchard, 2006) in diethyl pyrocarbonate-treated

double distilled water to remove contaminating nucleases.

Degenerate primer design over conserved regions of insect CAPA precursors

Previously identified CAPA precursor sequences from D. melanogaster (Kean et al., 2002) and

Manduca sexta (Loi and Tublitz, 2004) along with putative sequences from online genome

databases for Anopheles gambiae, Bombyx mori, and Tribolium castaneum, identified by

TBLASTN search using the D. melanogaster precursor sequence (accession no. NP_524552.1),

were aligned with ClustalW and conserved regions were used to design degenerate primers to

amplify the CAPA precursor in R. prolixus. The amino acid sequence FPRVGR corresponding to

the C-terminal region of the first commonly encoded peptide was chosen for design of the

forward degenerate primers FPRVGR for1a and FPRVGR for1b with sequences of

TTYCCNCGNGTNGGRCG and TTYCCNCGNGTNGGYCG, respectively. The amino acid

sequence WFGPRLG corresponding to the C-terminal region of the third encoded peptide was

chosen for design of the reverse degenerate primers WFGPRLG rev1a and WFGPRLG rev1b

with sequences of CCNARNCKNGGRCCRAACCA and CCNARNCKNGGYCCRAACCA,

respectively. Two primer variants were designed to lower the degeneracy and reduce

amplification of nonspecific products.

Two-step RT-PCR methods

Using R. prolixus fifth instar CNS total RNA, synthesis of first-strand cDNA was carried out

using the RevertAid H Minus first strand cDNA synthesis kit (Fermentas, Burlington, Ontario,

Canada) following manufacturer recommendations. An aliquot of this first-strand synthesis

reaction was used as a template for the subsequent PCR using the degenerate primers indicated

above. Conditions for PCR were as follows: initial denaturation for 3 min at 95°C, 40 cycles of

denaturation at 94°C for 45 sec, annealing at 57°C for 45 sec, and extension at 72°C for 1 min

and a final extension at 72°C for 10 min. Based on CAP2b/CAPA encoding nucleotide sequences

67

identified in other orders, the predicted size of the PCR product would be in the range of 100–300

bp.

Construction and screening of fifth-instar CNS cDNA library

The Creator SMART cDNA library construction kit (CLONTECH, Mountain View, CA) was

used to produce a cDNA library from CNS tissues of fifth-instar R. prolixus. Briefly, 400 central

nervous systems (CNSs) from insects fed 7–8 wk previously were dissected and mRNA isolated

using the Quickprep micro-mRNA purification kit (GE Healthcare, Piscataway, NJ). Library

construction followed a PCR-based protocol following the manufacturer’s recommendations with

some minor modifications. Specifically, 1.5 µg mRNA was used in the first-strand synthesis

reaction and second-strand synthesis (cDNA amplification) was carried out using long-distance

PCR with the fewest number of cycles recommended to reduce the number of nonspecific PCR

products. Once cycling was complete, amplified transcripts were prepared for ligation to the

supplied library cloning vector, pDNR-LIB. Transformation of recombinant plasmids into

Escherichia coli was carried out using ElectroMAX DH5α-E cells (Invitrogen, Burlington,

Ontario, Canada) and electroporator set at 1.8 kV. The final amplified library had a titer of

greater than 1010 cfu/ml and recombinant efficiency of more than 90%.

Library plasmid DNA prepared by standard maxiprep procedure was used as template for 5' and

3' rapid amplification of cDNA ends (RACE) PCR. Gene-specific primers (gsp) were designed

based on the partial sequence encoding a R. prolixus CAPA precursor obtained in the two-step

RT-PCR using degenerate primers (see Results). 3' RACE gsp were as follows: CAPA FOR1,

TGCAAGAAATTTCCCAGCC; CAPA FOR2, TTGGGGGATGATAGTCGG; and CAPA

FOR3, CAAGAGGAACGGAGGTGG. These 3' RACE gsp were used successively combined

with the plasmid reverse primer (pDNR-LIB REV1, with the sequence

GCCAAACGAATGGTCTAGAAAG) in a seminested PCR approach to increase the specificity

of the amplified 3' RACE products. Similarly, 5' RACE gsp were designed as follows: CAPA

REV1, ATAGGCCTCCACCGTTTCC; CAPA REV2, CTTGGGGCCAGATCTTCC; and

CAPA REV3, CTATCATCCCCCAAGTGGC. These 5' RACE gsp were used successively

combined with the plasmid forward primer (pDNR-LIB FOR1, with the sequence

GTGGATAACCGTATTACCGCC) in a seminested PCR approach to increase the specificity of

the amplified 5' RACE products. Conditions for both 5' and 3' RACE PCR were as follows: 3

68

min initial denaturation at 95°C, 40 cycles of denaturation for 30 sec at 94°C, annealing for 30

sec at 61°C, extension for 1 min at 72°C, and a final extension for 10 min at 72°C. Amplified

fragments were visualized on an agarose gel-stained with ethidium bromide, extracted, and

cloned using the pGEM-T Easy Vector System (Promega, Madison, WI). Sequencing was carried

out at the Centre for Applied Genomics at the Hospital for Sick Children (MaRS Centre,

Toronto, Ontario, Canada), and sequences were confirmed from at least three independent clones

to ensure base accuracy.

Genomic Southern blot analysis

High-molecular-weight genomic DNA was isolated from various tissues of fifth-instar R.

prolixus and digested with a selection of restriction endonucleases. The digest reactions were

carried out in a total volume of 500 µl, and additional enzyme was added every 6 h for a total

incubation of 24 h to ensure complete digestion of genomic DNA. Fragmented DNA was then

purified, electrophoresed on a 1% agarose gel for 4 h at 10 V/cm (2 µg per lane), and transferred

to a positively charged nylon membrane (Roche, Mannheim, Germany) via downward capillary

transfer. The membrane was then baked at 80°C for 2 h to bind the DNA and subsequently stored

in a sealed plastic bag at room temperature until hybridization. Southern hybridization was

carried out using the Gene Images AlkPhos direct labeling and detection system (GE Healthcare).

Manufacturer recommendations were followed with some minor modifications and user-defined

conditions. Specifically, hybridization included an alkaline phosphatase-labeled RhoprCAPA

675bp cDNA (nucleotide ranging 12–687) at a probe concentration of 25 ng/ml hybridization

solution containing 4% block and 0.5M NaCl and 60°C overnight (~18–20 h) incubation.

Stringency washes and signal generation with ECF substrate were carried out following

manufacturer recommendations. Signal development was monitored at various time points and

detected using fluorescence scanning instrumentation (STORM 840; Molecular Dynamics, GE

Healthcare, Piscataway, NJ) and analyzed using ImageQuant TL software (Amersham

Biosciences, Piscataway, NJ).

Developmental and tissue-specific expression profile monitored with RT-PCR

Insects from each postembryonic developmental stage of R. prolixus subjected to similar feeding

regimens were flash frozen in liquid nitrogen and ground using a mortar and pestle. The ground

tissues were then used in mRNA isolation as discussed above. RhoprCAPA gene expression

69

associated with each stage examined was monitored using a OneStep RT-PCR approach

(QIAGEN, Mississauga, Ontario, Canada). The reaction parameters were as follows: forward,

CAPA FOR2 (see above) and reverse primer, CAPA REVII

(CAAGTATTACATAAAATGAAACGAGTGC); 20 ng template mRNA from each stage (first

to fifth-instar and adult); reverse transcription for 30 min at 50°C followed directly by the initial

PCR activation step for 15 min at 95°C, 33 cycles of denaturation for 30 sec at 94°C, annealing

for 30 sec at 59°C, and extension for 1 min at 72°C. Lastly, the reaction included a final

extension step for 10 min at 72°C. Similar experimental parameters were used for monitoring the

spatial expression profile in various tissues of fifth-instar R. prolixus. Tissues were dissected

from insects and stored in RNAlater solution (Ambion, Austin, TX) until mRNA was isolated as

discussed above. Again, 20 ng mRNA from each tissue source were used as a template in RT-

PCR, and all parameters were maintained as above with the following exceptions: a reduction to

30 cycles and different forward and reverse primers: RhoprSPISSfor,

GCATGCGACATTGTTTTTTC and CAPA REV1 (see sequence above), respectively. For both

the developmental and tissue-specific expression analysis, a Rhopr β-actin 317-bp fragment was

amplified using forward and reverse primers, RhoprACTIN for1,

ACACCCAGTTTTGCTTACGG and RhoprACTIN rev1, GTTCGGCTGTGGTGATGA,

respectively, which served as a positive control to monitor the integrity of template mRNA.

Expression localization using FISH

Assessment of cell-specific spatial expression was accomplished using methods modeled on the

FISH protocols optimized for D. melanogaster embryos and tissues using peroxidase-mediated

tyramide signal amplification (Saunders and Cohen, 1999; Hughes and Krause, 1998; Lecuyer et

al., 2008). Digoxigenin (DIG)-labeled RNA was synthesized from a linearized recombinant

plasmid DNA containing a 716-bp RhoprCAPA cDNA fragment by in vitro transcription using

the DIG RNA labeling kit SP6/T7 (Roche Applied Science, Mannheim, Germany) following

manufacturer recommendations. Once DIG-labeled RNA synthesis was complete, template DNA

was removed with deoxyribonuclease I, and the probe was precipitated by adding 0.1 vol 3M

sodium acetate and 2.5 vol 100% ice-cold ethanol and placed at –80°C overnight. The next day,

precipitated labeled-RNA probe was pelleted by centrifugation, washed with ice-cold 70%

ethanol, resuspended in 40 µl of ribonuclease-free double-distilled H2O, and stored at –80°C.

Tissues were dissected in PBS and stored briefly (<5 min) in a microcentrifuge tube containing

70

the same solution. Once enough tissue was dissected, the PBS was replaced with freshly prepared

working-stock fixation solution (40% paraformaldehyde-PBS, 1:9) and incubated for 30 min at

room temperature. After this primary fixation, tissues were washed five times with PBS and

0.1% Tween 20 (PBT) and subsequently incubated in 4% Triton X-100 (Sigma Aldrich,

Oakville, Ontario, Canada) in PBT for 10 min at room temperature and an extended incubation

on ice for 30 min. The detergent solution was then removed and tissues were washed several

times in PBT for 5 min each to terminate digestion, with the final wash in PBT extended for 15

min.

Tissues were subsequently incubated at room temperature in working-stock fixation solution (see

above). After this secondary fixation, tissues were washed five times with PBT for 2 min each to

remove all remaining fixative. The tissues were then rinsed in a 1:1 mixture of PBT-RNA

hybridization solution (50% formamide, 5x saline sodium citrate, 100 µg/ml heparin, 100 µg/ml

sonicated salmon sperm DNA, and 0.1% Tween 20; filter sterilized through a 0.2-µm filter, and

stored in aliquots at –20°C), which was then replaced by 100% RNA hybridization solution in

which tissues were stored at –20°C for several days. An aliquot (300 µl/sample) of hybridization

solution was boiled at 100°C for 5 min and then cooled on ice for a minimum of 5 min and used

as the prehybridization solution. Samples were transferred to 0.5-ml microcentrifuge tubes and

incubated with prehybridization solution in an incubator set at 56°C for a minimum of 1.5–2 h.

Toward the end of the prehybridization incubation, an additional aliquot as above of

hybridization solution plus 200 ng of antisense probe (or sense probe for controls) was incubated

at 75°C for 3–4 min to denature the probe and cooled on ice for at least 5 min or until

prehybridization was completed. At the end of the prehybridization, the solution was removed

and replaced with hybridization solution containing labeled probe and incubated overnight (16–

18 h) at 56°C. Wash solutions were preheated to 56°C and the hybridization solution-containing

probe was removed and tissues rinsed twice with 400 µl fresh hybridization solution and

incubated at 56°C for 10 min. The samples were then washed with 400 µl of prewarmed 3:1, 1:1,

and 1:3 (vol/vol) mixtures of hybridization solution-PBT for 10 min each. The samples were then

washed three times with prewarmed PBT and acclimatized to room temperature. Samples were

then processed for signal development using PBT with 1% blocking reagent (PBTB) containing

primary or secondary antibodies or tyramide substrate. PBT was removed from samples and

71

replaced with 400 µl of PBTB and incubated at room temperature with constant mixing for 15

min.

After this initial block, tissue samples were incubated with biotin-SP-conjugated IgG fraction

monoclonal mouse antidigoxin (Jackson ImmunoResearch Laboratories Inc., West Grove, PA) at

a dilution of 1:400 for 2 h with constant mixing and protected from light. After this primary

antibody incubation, tissues were washed for 2 h with several changes of PBTB. Tissues were

then transferred to a 1:100 dilution of horseradish peroxidase-streptavidin stock solution

(Molecular Probes, Eugene, OR) in PBTB and incubated for 1 h with constant mixing and

protected from light. Tissue samples were then washed for 2 h with several changes of PBTB

followed by two brief washes in PBT and three 5-min washes in PBS. Toward the end of the

final wash, Alexa Fluor 568 tyramide working solution was prepared by diluting stock solution

1:100 in working stock amplification buffer containing 0.015% H2O2. The last PBS wash

solution was removed from the samples and replaced with 50–100 µl of tyramide substrate and

incubated in the dark for 2 h at room temperature with constant mixing. Once incubation was

complete, the samples were rinsed three times with PBS and then washed at room temperature

with constant mixing for 1 h, changing the wash buffer every 15 min. Tissues were then mounted

onto slides in glycerol and viewed under a laser-scanning confocal microscope consisting of a

helium-neon laser (543 nm line) and LSM Image browser software (Zeiss, Jena, Germany).

Sample preparation for MALDI TOF/TOF tandem mass spectrometry

The CNSs from 50 insects were dissected under saline, pooled in a 500-µl volume of methanol-

acetic acid-water (90:9:1, by volume), and stored overnight at –20°C. Samples were then

sonicated and centrifuged at 10,000 x g for 10 min. The supernatant was collected and dried in a

Speed Vac concentrator (Savant, Farmingdale, NY) and then reconstituted in 0.1% trifluoroacetic

acid (TFA). This sample was then applied to a C18 Sep-Pak cartridge (Waters Associates,

Mississauga, Ontario, Canada) prepared as described previously (Paluzzi and Orchard, 2006).

The loaded sample was initially washed with 0.1% TFA and subsequently eluted with 5 ml of

60% acetonitrile (Burdick and Jackson, Muskegon, MI) with 0.1% TFA. The eluant was dried in

a Speed Vac concentrator, reconstituted in a small volume of pure water and transferred directly

to a stainless steel MALDI plate insert (Applied Biosystems, Foster City, CA). Once the samples

were dried, a small aliquot of -cyano-4-hydroxycinnamic acid matrix solution (Agilent

72

Technologies, New Castle, DE) was added on the dried samples and allowed to dry again. Mass

spectrometric analysis was performed on the ABI 4800 proteomics analyzer (Applied

Biosystems, Framingham, MA). Due to the nature of the samples, all acquisitions were taken in

manual mode. Initially the instrument was operated in reflectron mode to determine the parent

masses. For the tandem MS experiments, the collision-induced dissociation acceleration was 2

kV in all cases. An internal standard [des-Arg1-bradykinin (904.47)] was used to calibrate the

masses. To change the net amount of activation energy imparted to the primary ions, the collision

gas (atmospheric air) pressure was increased. Two gas pressures were used by selecting the

following two instrument settings: none and high. The fragmentation patterns from these

different settings were used to determine the sequence of the peptide with MH+ at 1107.58, the

only one to have sufficient intensity to yield fragmentation data. An unambiguous assignment of

internal Leu/Ile was achieved by means of collision-induced dissociation under high gas pressure

that revealed unique and distinct patterns for the side chains of Leu and Ile (Nachman et al.,

2005). RhoprCAPA-2 was synthesized and purified according to previous methods (Nachman

and Coast, 2007).

Malpighian tubule fluid secretion assay and intracellular cGMP RIA

Anti-diuretic activity of RhoprCAPA-2 was tested at various doses on upper segments of MTs

stimulated with 5-HT and cGMP RIA performed as previously described (Paluzzi and Orchard,

2006). Values are expressed as mean ± SEM and, where appropriate, were analyzed using

Student’s t test or one-way ANOVA with Tukey multiple comparison post test.

73

Results

Preliminary sequence and cloning of full-length cDNA of RhoprCAPA

Using degenerate primers designed against conserved C-terminal residues of peptides processed

from CAPA precursor proteins in other insects, a 177-bp partial sequence encoding an

incomplete CAPA prepropeptide was isolated from R. prolixus. This partial sequence was then

used for design of gene-specific primers used in 5' and 3' RACE that yielded the full-length

sequence of the R. prolixus CAPA cDNA (RhoprCAPA cDNA) shown in Figure 1 (GenBank

accession no. EF989016). The cDNA is 789 nucleotides long with an 85-nucleotide 5'

untranslated region (UTR), a single open reading frame of 473 nucleotides (bases 86–559), and a

229-nucleotide 3' UTR. A putative polyadenylyation signal (AATAA) is present between bases

747 and 752. The single open reading frame encodes a prepropeptide of 157 amino acids

containing a predicted signal peptide with likely cleavage occurring between residue 23 and 24

(Ser23 and Ala24; SignalP3.0, ExPASy Server) (Bendtsen et al., 2004). The prepropeptide

sequence encodes three deduced propeptides: two CAP2b-related peptides numbered in the order

they appear on the gene, RhoprCAPA-1 (SPISSVGLFPFLRA, bases 206–247) and RhoprCAPA-

2 (EGGFISFPRV, bases 311–340), and a third pyrokinin-related propeptide common to other

insect CAPA prepropeptides, RhoprCAPA-PK1 (NGGGGNGGGLWFGPRL, bases 362–409).

Each of these three deduced propeptides are flanked at their N terminus by dibasic (Lys-Arg)

residues and at their C terminus by a monobasic (Arg) residue necessary for posttranslational

proteolytic processing after cleavage of the signal peptide. In addition, each of the predicted

peptides are flanked at their C terminus by a glycine residue, which is well known to provide the

amino group for amidation, thus suggesting the mature peptides are amidated. Based on these

proposed processing steps, the mature RhoprCAPA-1, RhoprCAPA-2, and RhoprCAPA-PK1

peptides would have predicted monoisotopic masses of 1489.83, 1107.58, and 1514.74 Da

(PeptideMass, ExPASy Server) (Wilkins et al., 1997), respectively.

Detection of predicted peptides from the R. prolixus CAPA gene

To confirm the presence of peptides predicted from the RhoprCAPA gene, extracts from CNS

were directly analyzed using MALDI-TOF mass spectrometry. These preparations revealed the

presence of three substances with mass of 1107.58, 1489.83, and 1514.74 Da, corresponding to

74

Figure 1. Nucleotide cDNA sequence and deduced amino acid prepropeptide of the R. prolixus

CAPA gene (GenBank accession: EF989016). Sequences are numbered on the right starting with

the first nucleotide in the 5' UTR and initial methionine start codon (capitalized), respectively.

The three encoded peptides are shown in bold, with N-terminal dibasic and C-terminal

monobasic posttranslational cleavage sites shaded, and glycine residues required for amidation

boxed. The highly predicted signal peptide required for processing in the secretory pathway is

double underlined with predicted cleavage occurring between serine23 and alanine24. The

predicted polyadenylation signal sequence is bold underlined in the 3' UTR.

76

the masses of RhoprCAPA-2, RhoprCAPA-1, and RhoprCAPA-PK1 predicted from the

molecular data (see Figure 2, A and B). One of the peaks (1107.58) was of sufficient intensity to

allow for further fragmentation experiments (see Figure 2A) and produced clear fragments under

conditions of low energy fragmentation. Deduced sequence fragmentation data for RhoprCAPA-

2 is shown in Figure 2C along with a comparison of the fragmentation pattern of a synthetic

replicate of RhoprCAPA-2. The sequence, as predicted by the translation and subsequent

processing of the RhoprCAPA-2 prepropeptide, was manually reconstructed from its fragment

series, EGGFISFPRV-NH2 (1107.58 Da). The internal Ile could be unambiguously determined

over the isosteric residue Leu (Nachman et al., 2005).

Genomic Southern blot analysis

Analysis of restriction fragments generated with restriction endonucleases lacking recognition

sites over the RhoprCAPA cDNA used as a probe showed the presence of two or more positive

bands in genomic Southern blot analysis (Figure 3). This suggests there might be at least two

copies or paralogs of the RhoprCAPA gene per haploid genome of R. prolixus.

Developmental and spatial expression profile of the RhoprCAPA gene in R. prolixus

Insects from each postembyronic developmental stage (first-instar to adult) were analyzed for

expression of the CAPA gene by RT-PCR. The CAPA gene is expressed in all postembryonic

developmental stages of R. prolixus (Figure 4A), indicating a role in all juvenile and mature

forms. To better understand the spatial localization of CAPA gene expression, mRNA was

isolated from male fifth-instar tissues including CNS, MTs, anterior midgut, posterior midgut,

hindgut, dorsal vessel, testes, and salivary glands. Expression was observed in CNS and,

surprisingly, also in the testes; however, expression was absent in the other tissues examined

(Figure 4B). Samples that lacked the reverse transcription step were negative, as were samples

deficient in template mRNA.

77

Figure 2. Detection of the peptides predicted from the CAPA gene in R. prolixus. MALDI-TOF

mass spectrum of a central nervous system extract from R. prolixus fifth-instars. Focus is on the

peptide with greatest intensity at MH+ 1107.58, RhoprCAPA-2 (A) and the other two predicted

peptides at MH+ 1489.83 and 1514.74 (B), corresponding to RhoprCAPA-1 and RhoprCAPA-

PK1, respectively. C, The peptide with MH+ at 1107.58 was selected for further fragmentation

experiments. Prominent y- and b-type fragments of ion signal 1107.58 are labeled, analyzed

manually, and the deduced sequence, an exact match to RhoprCAPA-2, is shown above the

labeled fragments. A comparison with the fragmentation pattern of the synthetic replicate of

RhoprCAPA-2 is depicted in the bottom half of C.

79

Figure 3. Genomic Southern blot using a RhoprCAPA cDNA fragment (12–687) as probe. Each

lane contains 2 µg of R. prolixus genomic DNA digested with restriction enzymes lacking

recognition sites over the length of the cDNA sequence used as a probe. DNA fragments were

electrophoresed, transferred onto a nylon membrane overnight, and hybridized with alkaline

phosphatase-labeled RhoprCAPA cDNA. Lanes 1–3: EcoRI, HindIII, and PstI, respectively.

81

Figure 4. RhoprCAPA developmental and spatial expression profile. A, Expression of the

RhoprCAPA gene assessed in each developmental stage from first- to fifth-instars and adults.

Primers were designed to generate a 413-bp fragment, which covered the majority of the coding

region and 3' UTR. B, RhoprCAPA gene expression in different R. prolixus fifth-instar tissues:

CNS, anterior midgut (AMG), posterior midgut (PMG), hindgut (HG), MT, dorsal vessel (DV),

testes (TST), and salivary glands (SG). Primers were chosen to amplify a 341-bp fragment,

which included the 5' UTR and a sizable region of the coding region of the precursor. For both

the developmental and spatial expression profile, Rhopr β-actin primers were designed to

amplify a 317-bp fragment to serve as a control for quality and integrity of RNA template.

83

Localization of RhoprCAPA gene expression using FISH

Full-length antisense DIG-labeled RNA probes were used to determine the spatial cell-specific

expression pattern of the RhoprCAPA gene in fifth-instar R. prolixus. RhoprCAPA gene

expression was observed in 26 cells of the CNS of starved fifth-instars (fed as fourth-instars 6–8

wk previously). In the brain, RhoprCAPA gene expression was detected in one bilateral pair of

lateral cells located dorsally in the border region of the optic lobe and brain (Figure 5A).

RhoprCAPA gene-expressing cells were also observed in the subesophageal ganglion (SOG;

Figure 5B). Here two pairs of cells are both located along the ventral midline of the SOG. These

pairs of cells differ substantially in size, with the more posterior pair of cells being much larger

(75 µm) than the anterior pair (35 µm). Additional cells were observed lying immediately

posterior of the esophageal foramen; however, these cells stained less intensely (Figure 5B).

Within the prothoracic ganglion, RhoprCAPA gene expression was detected in two bilateral pairs

of cells located centrally on the ventral surface (Figure 5C). The mesothoracic ganglionic mass

(MTGM) also contained cells positive for expression of the RhoprCAPA gene. Specifically,

three bilateral pairs of cells were observed on the ventral surface of the MTGM in the abdominal

neuromeres, with the most posterior pair of cells being larger in size ( 25 µm) relative to the two

anterior pairs of cells (15 µm) (Figure 5D). More anteriorly within the meso- and metathoracic

neuromere, another two pairs of cells demonstrated RhoprCAPA expression; however, these cells

were less intensely stained than the three pairs of cells mentioned earlier within the abdominal

neuromeres (Figure 5, D and E). To verify the specificity of the detection, control experiments

were carried out in parallel in which tissues were hybridized with sense-labeled probe, which did

not identify any cells (results not shown), thus demonstrating that the cells identified using

antisense probe are indeed expressing RhoprCAPA mRNA. In view of the fact that our RT-PCR

findings also demonstrated expression of RhoprCAPA within testes of fifth-instar males, FISH

techniques were again used to determine the localization of expression associated with this

tissue. Unlike the CNS, in which distinct cells were identified expressing the transcript, no

specific cell bodies were detected expressing the RhoprCAPA transcript in testes.

84

Figure 5. RhoprCAPA transcript expression in dorsal brain (A), ventral SOG (B), ventral

prothoracic ganglion (C), and ventral MTGM (D) of R. prolixus fifth-instars. A, A single

bilateral pair of cells are situated in the border region between the optic lobe and brain proper.

Over the ventral surface of the SOG (B), two pairs of cells with prominent expression are

observed located medially and an additional three pairs of cells, which stained more weakly, are

observed just posterior of the esophageal foramen. C, Two small pairs of cells are observed lying

medially in the ventral surface of the prothoracic ganglion. D, The posterior segment of the

ventral MTGM contains three bilaterally paired RhoprCAPA-expressing cells within the

abdominal neuromeres. In the more anterior segment of the ventral MTGM (the meso- and

metathoracic neuromeres), two additional pairs of weakly stained cells are positive for

RhoprCAPA expression. E, Cells in the anterior region of the MTGM within the mesothoracic

neuromere that stained weakly for RhoprCAPA gene expression are shown at a higher

magnification. In A–D, arrows and arrowheads denote strong and weak RhoprCAPA-expressing

cells, respectively; in all figures. Scale bars, 100 µm.

86

Malpighian tubule fluid secretion assay and intracellular cGMP RIA

To confirm biological activity of the predicted anti-diuretic peptide from the RhoprCAPA gene,

RhoprCAPA-2, it was tested on 5-HT-stimulated MTs because unstimulated tubules in this

species secrete at very low levels (~0.1 nl/min; Te Brugge et al., 2002). RhoprCAPA-2 (1 µM)

significantly inhibited 5-HT-stimulated secretion by MTs (Figure 6A). RhoprCAPA-2

demonstrated a dose-dependent inhibition of 50 nM 5-HT-stimulated Malpighian tubule

secretion rate, with a threshold below the nanomolar range, maximal inhibition at a dose of 1 µM,

an IC50 of 4.16 nM, and 95% confidence interval of 0.88–19.77 nM (Figure 6B). Thus, as

predicted from the structural data, RhoprCAPA-2 indeed demonstrates potent anti-diuretic

activity on MTs stimulated with 5-HT. We then sought to confirm that RhoprCAPA-2 elevated

levels of intracellular cGMP in tubules stimulated by 5-HT. In agreement with previous reports

using M. sexta CAP2b or semipurified CNS extracts (Paluzzi and Orchard, 2006), 1 µM

RhoprCAPA-2 elevates levels of intracellular cGMP in Malpighian tubules stimulated with 50

nM 5-HT (Figure 6C).

87

Figure 6. A, Inhibition of 5-HT (50 nM) stimulated secretion from MTs by the anti-diuretic

peptide, RhoprCAPA-2 (1 µM; EGGFISFPRV-NH2). B, Dose-dependent inhibition of 5-HT (50

nM) stimulated secretion from MTs by the anti-diuretic peptide, RhoprCAPA-2. Data fitted by

nonlinear regression using GraphPad Prism (version 3.02; San Diego, CA). The IC50 is 4.16 nM

with 95% confidence interval = 0.88–19.77 nM. Secretion by unstimulated tubules in saline

alone is very small (~0.1 nl/min; Te Brugge et al., 2002) and is not shown here. C, RhoprCAPA-

2 elevates levels of the intracellular messenger, cGMP, in tubules stimulated with 50 nM 5-HT.

Tubules receiving 50 nM 5-HT alone show a significant decrease in cGMP levels. Values are

mean ± SE for n = 8 (A), n = 8–20 (B), and n = 8–10 (C). In A, significant inhibition denoted by

*, where P < 0.0001, and in C, statistically different levels of cGMP from tubules treated with

saline alone are denoted by *, where P < 0.05.

89

Discussion

This is the first study to isolate and characterize a gene encoding neuropeptides in the species-

rich order, Hemiptera. The RhoprCAPA gene encodes three novel peptides from a single

prepropeptide, which, through posttranslational modification and processing, generates the

mature biologically active forms: RhoprCAPA-1 (SPISSVGLFPFLRA-NH2), RhoprCAPA-2

(EGGFISFPRV-NH2), and a third pyrokinin-related peptide, RhoprCAPA-PK1

(NGGGGNGGGLWFGPRL-NH2). The first gene encoding the peptide CAP2b in insects was

identified in the fruit fly, D. melanogaster and called capability (CAPA) owing to its clear ability

to encode neuropeptides belonging to the CAP2b family (Kean et al., 2002). Subsequently in the

hawk moth M. sexta, in which the original Leptidopteran CAP2b peptide was first sequenced

(Huesmann et al., 1995), the gene encoding two CAP2b-related peptides, Mas-CAPA-1 and -2,

as well as a pyrokinin (PK)-related peptide, Mas-PK-1, was isolated and sequenced (Loi and

Tublitz, 2004). Interestingly, the first two peptides encoded in analogous transcripts identified in

other species all share the PRV-NH2 C-terminal motif, whereas in R. prolixus, only the second

encoded peptide, RhoprCAPA-2, shares this motif; RhoprCAPA-1 contains a LRA-NH2 C-

terminal sequence. This is quite surprising, considering the amino acid sequence characteristics

of the CAP2b-related peptides recently identified in neurohemal organs of the more closely

related southern green stink bug, Nezara viridula (Predel et al., 2006). In this Hemipteran, the

two CAP2b-related peptides each contain the PRV-NH2 C terminus common to CAP2b-related

peptides found in other insects. The implications of this varied C terminus on the first encoded

peptide, RhoprCAPA-1, are at this time, unknown but will be pursued in future investigations

during which the physiological role of this unique peptide is studied. One could postulate,

however, that this peptide lacks any involvement in the cessation of diuresis because it is known

from previous studies (Quinlan et al., 1997; Paluzzi and Orchard, 2006) that CAP2b-related

peptides ending with a PRV-NH2 C terminus are anti-diuretic in R. prolixus.

In support of this prediction, structure-activity analysis in a Dipteran species, Musca domestica,

during which alanine-replacement CAP2b analogs were tested, showed that replacement of the

arginine or valine at the C terminus resulted in greatly reduced efficacy of diuretic activity on

MTs (Nachman and Coast, 2007). Moreover, the significant finding here, demonstrating

90

expression associated with a peripheral source, the testes, suggests that one or more of the

RhoprCAPA peptides are involved in reproduction. It is worth emphasizing, though, that no cell

bodies expressing RhoprCAPA mRNA were detected in the testes. Testes samples assessed by

nonquantitative RT-PCR, however, required many more amplification cycles than did the CNS

samples (data not shown), indicating that RhoproCAPA expression in the testes is much lower

than that found in the CNS, so in situ hybridization may not be sufficiently sensitive to reveal low

expression levels in these immature reproductive tissues at this developmental stage. Thus, future

experiments investigating expression in other developmental stages such as adults, in which

reproductive tissues are fully developed, may reveal more clearly the source of this expression.

Alternatively, it is possible that RhoprCAPA expression detected in RT-PCR experiments may

originate in the axonal domain of abdominal nerves originating from the MTGM, in which

extensive CAP2b-like immunoreactivity has been recently identified (Paluzzi and Orchard,

2006). This would not be unusual because it is now well established that many RNA species,

including those encoding neuropeptides, are localized to the axonal domain in addition to the cell

bodies in both vertebrates and invertebrates (Van Minnen et al., 1988; 1989; Van Minnen, 1994;

Mohr and Richter, 2000; Barth and Grossmann, 2000; Garside et al., 2002; Lee and Hollenbeck,

2003). Nonetheless, the identification of cell bodies expressing the RhoprCAPA gene within the

CNS is consistent with previously identified cells bodies expressing CAP2b-related peptides in R.

prolixus (Paluzzi and Orchard, 2006) and other insects (for review see Predel and Wegener,

2006). For R. prolixus, all of the cells expressing the RhoprCAPA gene revealed

immunohistochemical staining for CAP2b-related peptides except the cells localized within the

PRO. These were not identified in previous studies and may contain peptides that are not

immunologically detected using the antibody or may not undergo the appropriate processing

steps to produce the mature peptides.

The occurrence of a varied C terminus on RhoprCAPA-1 suggests that RhoprCAPA-1 and

RhoprCAPA-2 could facilitate their effects via unique receptors. Two independent studies have

shown in D. melanogaster that DroCAPA-1 and DroCAPA-2, which share the PRV-NH2 C

terminus, activate the same G protein-coupled receptor (GPCR) coded by the gene CG14575

(AF522193/AF505865) and with similar affinities (Iversen et al., 2002; Park et al., 2002).

However, the third CAPA peptide, DroPK-1, has its own unique GPCR coded by the D.

melanogaster gene CG9918 (AF368273), which does not bind the CAP2b-related peptides

91

(Cazzamali et al., 2005). With the completion of sequencing and annotation of the R. prolixus

genome in the near future, the database will serve as a tremendous tool to identify candidate

GPCRs for many of the peptides and additional factors that are involved in diuresis and other

feeding-related behaviors. Similar to studies carried out with Dipteran counterparts, expression

and affinity analyses to determine natural ligands will be necessary, as will tissue and cell-

specific expression studies, to determine target tissues of these peptides.

In Dipterans, CAP2b-related peptides stimulate secretion through a pathway involving a nitric

oxide-dependent soluble guanylate cyclase (Davies et al., 1997; Broderick et al., 2003).

Interestingly, both CAP2b and ADF peptides inhibit secretion and elevate levels of cGMP but in

a nitric oxide-independent manner (Eigenheer et al., 2002; Quinlan et al., 1997; Paluzzi and

Orchard, 2006). Here we show that RhoprCAPA-2 has potent anti-diuretic activity inhibiting

secretion and elevating levels of intracellular cGMP in MTs stimulated with the diuretic

hormone, 5-HT. It remains to be seen whether this in vitro activity can be confirmed in vivo. Our

future studies will focus on elucidating the target sites and physiological significance and

deducing the signal transduction pathways involved. For example, it is known that levels of

cGMP increase in MTs stimulated with CAP2b-related peptides (Quinlan et al., 1997; Paluzzi

and Orchard, 2006); however, the source of this increase, a membrane-bound or atypical

guanylate cyclase, is not known. In other insects, CAP2b-related peptides influence the activity

of other tissues, such as the dorsal vessel (heart) in Lepidoptera and Diptera (Huesmann et al.,

1995), and in addition, other myostimulatory effects have been demonstrated in several visceral

muscle preparations in Blattaria (Predel et al., 2001). Studies conducted on Blattarian species

have identified a number of CAPA orthologs termed the periviscerokinins (PVKs), which have

been shown to exert myotropic effects on a number of different visceral tissues in insects

(reviewed in Predel and Wegener, 2006). The designation as a PVK reflects the high abundance

of these orthologs observed within the abdominal perivisceral/neurohemal organ systems of some

insects (Predel and Wegener, 2006); however, in R. prolixus (Paluzzi and Orchard, 2006) and

similarly in other species (Kean et al., 2002; Loi and Tublitz, 2004), these peptides are also

associated with other neurohemal regions; thus, we avoid the PVK nomenclature.

The availability of the synthetic RhoprCAPA peptides should help in the determination of the

physiological relevance of these neuropeptides. A comparison across Insecta reveals that these

92

peptides have evolved unique and remarkably opposite functions: stimulation vs. inhibition of

secretion by MTs. Here our results also suggest a novel function for these peptides, a role in

sexual maturation or reproduction, because expression of the RhoprCAPA gene was localized to

the testes. In addition, the identification of the native peptide, RhoprCAPA-2, which inhibits the

rapid diuresis in this disease vector, may guide future studies focused on development of mimetic

analogs (Nachman et al., 1993; 1995; 2002; Taneja-Bageshwar et al., 2008) for use in novel pest

management strategies for interrupting the transmission of Chagas’ disease, which takes place as

a result of the rapid diuresis after blood gorging.

93

References

Barth, S. and Grossmann, R. (2000). Localization of arginine vasotocin (AVT) mRNA in

extrasomal compartments of magnocellular neurons in the chicken hypothalamo-

neurohypophysial system. Comp. Biochem. Physiol. Part B: Biochem Mol Bio 125, 189-

195.

Bendtsen, J. D., Nielsen, H., von Heijne, G. and Brunak, S. (2004). Improved prediction of

signal peptides: SignalP 3.0. J. Molecular Biology 340, 783-795.

Broderick, K., MacPherson, M., Regulski, M., Tully, T., Dow, J. T. and Davies, S. (2003).

Interactions between epithelial nitric oxide signaling and phosphodiesterase activity in

Drosophila. Am J Physiol Cell Physiol 285, C1207-1218.


(2005). The Drosophila gene CG9918 codes for a pyrokinin-1 receptor. Biochem.


Coast, G. (2007). The endocrine control of salt balance in insects. Gen. Comp. Endo. 152, 332-

338.




N. J. and Dow, J. A. T. (1997). Neuropeptide stimulation of the nitric oxide signaling

pathway in Drosophila melanogaster Malpighian tubules. American Journal of

Physiology-Regulatory Integrative and Comparative Physiology 42, R823-R827.

de Decker, N., Hayes, T. K., Vankerkhove, E. and Steels, P. (1994). Stimulatory and

inhibitory effects of endogenous factors in head extracts of Formica polyctena

(Hymenoptera) on the fluid secretion of Malpighian tubules. J. Insect Physiol. 40, 1025-

1036.


and Schooley, D. A. (2003). Isolation, identification and localization of a second beetle

anti-diuretic peptide. Peptides 24, 27-34.

94


potent anti-diuretic factor acting on beetle Malpighian tubules. Proceedings of the

National Academy of Sciences 99, 84-89.

Feliciangeli, M. D., Carrasco, H., Patterson, J. S., Suarez, B., Martinez, C. and Medina, M.

(2004). Mixed domestic infestation by Rhodnius prolixus Stal, 1859 and Panstrongylus

geniculatus latreille, 1811, Vector incrimination, and seroprevalence for Trypanosoma

cruzi among inhabitants in El Guamito, Lara State, Venezuela. Am. J. Trop. Med. Hyg.

71, 501-505.

Garside, C. S., Koladich, P. M., Bendena, W. G. and Tobe, S. S. (2002). Expression of

allatostatin in the oviducts of the cockroach Diploptera punctata. Insect Biochemistry and

Molecular Biology 32, 1089-1099.



tobacco hawkmoth Manduca sexta. FEBS Lett. 371, 311-314.

Hughes, S. C. and Krause, H. M. (1998). Double labeling with fluorescence in situ

hybridization in Drosophila whole-mount embryos. BIOTECHNIQUES 24, 530-532.





A., Veenstra, J. A. and Dow, J. A. T. (2002). Two nitridergic peptides are encoded by

the gene capability in Drosophila melanogaster. Am J Physiol Regul Integr Comp

Physiol 282, R1297-1307.

Lavigne, C., Embleton, J., Audy, P., King, R. R. and Pelletier, Y. (2001). Partial purification

of a novel insect anti-diuretic factor from the Colorado potato beetle, Leptinotarsa

decemlineata (Say) (Coleoptera: Chrysomelidae), which acts on Malpighian tubules.

Insect Biochemistry and Molecular Biology 31, 339-347.

Lecuyer, E., Parthasarathy, N. and Krause, H. (2008). Fluorescent in situ hybridization

protocols in Drosophila embryos and tissues. Methods in molecular biology 420, 289.

95

Lee, S. and Hollenbeck, P. (2003). Organization and translation of mRNA in sympathetic

axons. J Cell Sci 116, 4467-4478.



Maddrell, S. H. (1963). Excretion in blood-sucking bug, Rhodnius prolixus Stal .1. Control of

diuresis. J. Exp. Biol. 40, 247-256.

Maddrell, S. H. (1964). Excretion in blood-sucking bug Rhodnius prolixus Stal .3. Control of

release of diuretic hormone. J. Exp. Biol. 41, 459-472.



Mohr, E. and Richter, D. (2000). Axonal mRNAs: Functional significance in vertebrates and

invertebrates. Journal of Neurocytology 29, 783-791.

Monroy, C., Rodas, A., Mejia, M., Rosales, R. and Tabaru, Y. (2003). Epidemiology of

Chagas disease in Guatemala: Infection rate of Triatoma dimidiata, Triatoma nitida and

Rhodnius prolixus (Hemiptera, Reduviidae) with Trypanosoma cruzi and Trypanosoma

rangeli (Kinetoplastida, Trypanosomatidae). Mem. Inst. Oswaldo Cruz 98, 305-310.

Nachman, R. J., Holman, G. M. and Haddon, W. F. (1993). Leads for insect neuropeptide

mimetic development. Arch. Insect Biochem. Physiol. 22, 181.

Nachman, R. J., Roberts, V. A., Holman, G. M. and Beier, R. C. (1995). Pseudodipeptide

analogs of the pyrokinin/PBAN (FXPRLa) insect neuropeptide family containing

carbocyclic pro-mimetic conformational components. Regul. Pept. 57, 359.

Nachman, R. J., Russell, W. K., Coast, G. M., Russell, D. H. and Predel, R. (2005). Mass

spectrometric assignment of Leu/Ile in neuropeptides from single neurohemal organ

preparations of insects. Peptides 26, 2151-2156.

Nachman, R., Zabrocki, J., Olczak, J., Williams, H., Moyna, G., Scott, A. I. and Coast, G.

(2002). Cis-peptide bond mimetic tetrazole analogs of the insect kinins identify the active

conformation. Peptides 23, 709.

96

Nachman, R. and Coast, G. (2007). Structure-activity relationships for in vitro diuretic activity

of CAP2b in the housefly. Peptides 28, 57-61.

Orchard, I. (2006). Serotonin: A coordinator of feeding-related physiological events in the

blood-gorging bug, Rhodnius prolixus. Comparative Biochemistry and Physiology A-

Molecular & Integrative Physiology 144, 316-324.

Paluzzi, J. P. and Orchard, I. (2006). Distribution, activity and evidence for the release of an

anti-diuretic peptide in the kissing bug Rhodnius prolixus. J. Exp. Biol. 209, 907-915.




Petzel, D. and Conlon, J. M. (1991). Evidence for an anti-diuretic factor affecting fluid

secretion in mosquito Malpighian tubules. Faseb Journal 5, A1059-A1059.


(2006). Identification of the first neuropeptides from the CNS of Hemiptera: CAPA

peptides of the southern green stinkbug Nezara viridula (L.). Peptides 27, 2670-2677.

Predel, R., Nachman, R. J. and Gade, G. (2001). Myostimulatory neuropeptides in

cockroaches: Structures, distribution, pharmacological activities, and mimetic analogs. J.

Insect Physiol. 47, 311-324.

Predel, R. and Wegener, C. (2006). Biology of the CAPA peptides in insects. Cellular and

molecular life sciences 63, 2477.


Rhodnius prolixus Stal: The peptide CAP2b and cyclic GMP inhibit Malpighian tubule

fluid secretion. J Exp Biol 200, 2363-2367.

Rabinovich, J. E. and Himschoot, P. (1990). A population-dynamics simulation-model of the

main vectors of Chagas-disease transmission, Rhodnius prolixus and Triatoma infestans.

Ecol. Model. 52, 249-266.

Ramsey, J. M., Ordonez, R., Cruz-Celis, A., Alvear, A. L., Chavez, V., Lopez, R., Pintor, J.

R., Gama, F. and Carrillo, S. (2000). Distribution of domestic Triatominae and

97

stratification of Chagas disease transmission in Oaxaca, Mexico. Med. Vet. Entomol. 14,

19-30.

Saunders, C. and Cohen, R. S. (1999). Double FISH and FISH-fluorescence

immunolocalization procedures for whole-mount Drosophila ovaries. Biotechniques 26,

186-188.

Spring, J. H., Morgan, A. and Hazelton, S. R. (1988). A novel target for anti-diuretic hormone

in insects. Science 241, 1096-1098.

Taneja-Bageshwar, S., Strey, A., Kaczmarek, K., Zabrocki, J., Pietrantonio, P. V. and

Nachman, R. J. (2008). Comparison of insect kinin analogs with cis-peptide bond, type

VI-turn motifs identifies optimal stereochemistry for interaction with a recombinant

arthropod kinin receptor from the southern cattle tick Boophilus microplus. Peptides 29,

295.


activity of a Dippu-DH31-like peptide in the blood-feeding bug, Rhodnius prolixus.

Peptides 26, 29-42.


Distribution of a CRF-like diuretic peptide in the blood-feeding bug Rhodnius prolixus. J.

Exp. Biol. 202, 2017-2027.



Van Minnen, J. (1994). RNA in the axonal domain – a new dimension in neuronal functioning.

The Histochemical Journal 26, 377.

Van Minnen, J., Smit, A. B. and Joosse, J. (1989). Central and peripheral expression of genes-

coding for egg-laying inducing and insulin-related peptides in a snail. Arch. Histol. Cytol.

52, 241-252.

Van Minnen, J., Vanderhaar, C., Raap, A. K. and Vreugdenhil, E. (1988). Localization of

ovulation hormone-like neuropeptide in the central nervous system of the snail Lymnaea

stagnalis by means of immunocytochemistry and in situ hybridization. Cell Tissue Res.

251, 477-484.

98

Wiehart, U. I. M., Nicolson, S. W., Eigenheer, R. A. and Schooley, D. A. (2002). Antagonistic

control of fluid secretion by the Malpighian tubules of Tenebrio molitor: Effects of

diuretic and anti-diuretic peptides and their second messengers. J Exp Biol 205, 493-501.

Wilkins, M. R., Lindskog, I., Gasteiger, E., Bairoch, A., Sanchez, J. C., Hochstrasser, D. F.

and Appel, R. D. (1997). Detailed peptide characterization using PEPTIDEMASS – a

World-Wide-Web-Accessible Tool. Electrophoresis 18, 403-408.

99

Acknowledgments

This work was supported by a Natural Sciences and Engineering Research Council of Canada

discovery grant (to I.O.) and in part by Grant 0500-32000-001-01R from the Department of

Agriculture/Department of Defense Deployed War Fighter Protection (DWFP) Initiative (R.J.N.)

and Collaborative Research Grant LST.CLG.979226 from the North Atlantic Treaty

Organization to (R.J.N.).

100

Copyright Acknowledgments

The preceeding chapter was reproduced / adapted with permission from The Endocrine Society.


Isolation, cloning, and expression mapping of a gene encoding an anti-diuretic hormone and other CAPA-related peptides in the disease vector, Rhodnius prolixus. Paluzzi JP, Russell WK, Nachman RJ, Orchard I. Endocrinology. 2008 Sep;149(9):4638-46. Epub 2008 May 29. doi:10.1210/en.2008-0353

Copyright 2008, The Endocrine Society

101

Chapter 4:

A second gene encodes the anti-diuretic hormone in the insect,

Rhodnius prolixus

102

Abstract

In the haematophagous insect, Rhodnius prolixus, a rapid diuresis following engorgement of

vertebrate blood is under the control of two main diuretic hormones: a corticotropin-releasing

factor (CRF)-related peptide and serotonin (5-HT). A CAP2b (CAPA)-related peptide is

involved in the termination of this diuresis, and we have recently identified a gene, now referred

to as RhoprCAPA-α, encoding CAPA peptides in R. prolixus. Here we identify a second gene,

RhoprCAPA-β, which also encodes CAPA peptides and characterize its expression in fifth-instar

and adults. The RhoprCAPA-β gene is more highly expressed in the CNS than the RhoprCAPA-

α gene, but neither gene is expressed in other tested adult tissues. Both genes are expressed in a

subset of immunoreactive neurons identified using an antisera which recognizes CAP2b-related

peptides. The expression of each paralog is modified by feeding and we propose this to be a

result of requirements of anti-diuretic regulation during salt and water homeostasis.

103

Introduction

Insect diuresis and anti-diuresis typically involves hormonal control of the excretory system,

which includes the Malpighian tubules (MTs) and hindgut (Coast et al., 2002). Specifically,

diuresis is induced by stimulating fluid secretion by the MTs, using peptidergic hormones, and/or

biogenic amines, such as serotonin (5-hydroxytryptamine or 5-HT). In contrast, it has been

demonstrated that anti-diuresis involves fluid reabsorption by the hindgut, whereby essential

salts and water are retrieved, and in some cases a concurrent decrease in action of diuretic

hormones on the MTs. In the blood-feeding reduviid bug, Rhodnius prolixus, there are extended

periods of starvation between successful foraging events in search of an appropriate vertebrate

blood meal. It is well documented that the rapid diuresis in R. prolixus following blood gorging

involves stimulation of MTs by a peptidergic hormone, likely related to corticotropin-releasing

factor (CRF) peptides identified in other insects, and the amine, 5-HT, acting via cAMP

(Maddrell et al., 1993; Lange et al., 1989; Te Brugge et al., 1999; Te Brugge and Orchard, 2002).

In R. prolixus, the anterior midgut (or crop) also plays an essential role in the rapid diuresis

following gorging on a blood meal. The excess salt and water, derived from the plasma portion

of the blood meal, is absorbed into the haemolymph, for subsequent elimination by the MTs,

while the nutritive red blood cell-containing component is stored for eventual digestion.

Serotonin and a CRF-related peptide have also been shown to increase the cAMP levels and

increase absorption by the anterior midgut (Te Brugge et al., 2009).

It was earlier believed that the cessation of diuresis in R. prolixus was the result of decreased

titres of diuretic hormones. Studies by Quinlan et al. (1997) and Quinlan and O’Donnell (1998),

however, suggested that a unique anti-diuretic mechanism might exist in this haematophagous

insect, revealed by the physiological response to exogenously applied Manduca sexta

cardioacceleratory peptide 2b (ManseCAP2b). This peptide inhibits MTs fluid secretion

stimulated by 5-HT (Quinlan et al., 1997), with the intracellular second messenger, cGMP,

possibly playing a role (Quinlan and O’Donnell, 1998; Orchard, 2006). More recently, we

identified the endogenous CAP2b-related peptide in R. prolixus central nervous system (CNS)

that inhibits MT secretion stimulated by 5-HT (Paluzzi and Orchard, 2006; Paluzzi et al., 2008).

In addition, this peptide, RhoprCAPA-α2, also abolishes the decrease in cGMP levels in MTs

stimulated with 5-HT, suggesting that cGMP may be involved in the anti-diuretic effect observed

104

in MTs. Interestingly, RhoprCAPA-α2 also abolishes the 5-HT-stimulated increase in absorption

by the anterior midgut (Orchard and Paluzzi, 2009).

CAP2b-related peptides have also been referred to as periviscerokinins (PVKs) since they are the

most abundant peptide class in the abdominal perivisceral neurohemal system in many insects

and have myotropic effects on visceral muscle such as the heart and gut (for a review, see Predel

and Wegener, 2006). The first genes encoding CAP2b and CAP2b-related peptides, called

capability (CAPA) genes, were identified in Drosophila melanogaster (Kean et al., 2002) and

later in M. sexta (Loi and Tublitz, 2004). These genes each encode two CAP2b-related peptides

and a pyrokinin peptide. With the increase in insect genome projects completed or in progress,

homologous genes have been annotated in other genera such as several Dipteran, Lepidopteran,

and Coleopteran species. In addition, we have observed homologous CAPA genes encoding

CAP2b-related peptides in other organisms such as the human body louse, Pediculus humanus

corporis (EEB10638) and aphids, Acyrthosiphon pisum (XP_001946149) and Myzus persicae

(EE570800.1). Recently it was demonstrated that the CAP2b-related peptides in Bombyx mori

were produced by a single gene, which can undergo alternative splicing to produce an extended

pyrokinin peptide (Roller et al., 2008), although the distribution of these variant peptides within

the CNS has yet to be established.

The RhoprCAPA gene in fifth-instar R. prolixus is expressed primarily in the CNS, consistent

with previous immunological identification of cells containing CAP2b-related peptides (Paluzzi

and Orchard, 2006; Paluzzi et al., 2008), although expression was also observed in immature

male reproductive tissue (Paluzzi et al., 2008). Here, we present data demonstrating that a

second, closely related gene exists in this haematophagous insect and we characterize the

expression levels of these paralogs in fifth-instar and adult insects. In the spatial analysis, we

compare expression levels of each paralog in several different tissues and also examine the

expression level distribution within the CNS. In the temporal analysis we investigate expression

levels over a period of several hours and also over a few weeks following feeding, which we

term as a micro- and macro-temporal time-scale, respectively. Using a combined

immunohistochemical and in situ hybridization approach, we have localized neurons containing

CAP2b-related peptides, and have verified that a considerable subset of these immunopositive

neurons express one or both RhoprCAPA gene paralogs. We rename the first identified paralog

105

gene as RhoprCAPA-α, since this will avoid confusion in future comparison with the second

RhoprCAPA paralog gene, RhoprCAPA-β, identified herein.

106

Materials & Methods

Animals

Fifth-instar R. prolixus Stål were reared at high relative humidity in incubators at 25 °C and

routinely fed on rabbits’ blood. Tissues were dissected from insects under physiological saline

prepared as described previously (Paluzzi et al., 2008) in nuclease-free water.

Screening of fifth-instar CNS cDNA library

A cDNA library from the CNS of fifth-instar R. prolixus (Paluzzi et al., 2008) was screened

using a modified rapid amplification of cDNA ends (RACE) PCR approach. A series of gene-

specific primers (gsp) were designed, based on several initial clones identified during the

isolation of the RhoprCAPA-α gene, and used in combination with the pDNR-LIB plasmid

primers described previously (Paluzzi et al., 2008). These partial cDNA clones although similar,

demonstrated consistent differences from the RhoprCAPA-α gene and thus were pursued in this

study. Amplified fragments were isolated and cloned using the pGEM-T Easy Vector System

(Promega, Madison, WI). Sequencing was carried out at the Centre for Applied Genomics at the

Hospital for Sick Children (MaRS Centre, Toronto, Ontario, Canada), and sequences were

confirmed from several independent clones to ensure base accuracy and differentiate between the

previously identified RhoprCAPA-α gene.

Sequence analysis of RhoprCAPA-β prepropeptide

The deduced RhoprCAPA-β prepropeptide sequence was analyzed for potential processing in the

secretory pathway using online software for signal peptide prediction (SignalP 3.0; Bendtsen et

al., 2004). To confirm the processing and presence of the RhoprCAPA-β peptides, CNS material

was fractionated by RP-HPLC (as described previously, Paluzzi et al., 2008) and collected

fractions were analyzed by mass spectrometry at the Toronto Integrative Proteomics Lab

(Ontario Cancer Biomarker Network, Toronto, ON) and The Advanced Protein Technology

107

Centre (Hospital for Sick Children, Toronto, ON). The two RhoprCAPA prepropeptide

sequences (RhoprCAPA-α, ABS17680; RhoprCAPA-β, ACH70295) and homologs from several

insects (D. melanogaster, AAF56969; Anopheles gambiae, EAL41227; Aedes aegypti,

EAT43089; B. mori, NP_001124357 and AB362228.1; M. sexta, AAT69684; A. pisum,

XP_001946149; M. persicae, EE570800.1; P. humanus corporis, EEB10638; Tribolium

castaneum, GLEAN_08429) were compared using ClustalX (Larkin et al., 2007) and the final

figure prepared using the BOXSHADE 3.21 server

(http://www.ch.embnet.org/software/BOX_form.html). The prepropeptide sequence alignment

was used to produce a phylogenetic tree prepared in MEGA 4.02 using either the neighbor-

joining or parsimony method and bootstrapping with 1000 iterations (Tamura et al., 2007). A

putative CAPA/PVK prepropeptide consensus sequence from the Arachnid, Ixodes scapularis,

was generated from EST data (EW933575.1) and included in the analysis and imposed as the

outgroup.

Northern blot hybridization

Tissues of adult R. prolixus were dissected in nuclease-free PBS and stored at −20 °C in

RNAlater reagent (Ambion, Austin, TX). Total RNA was isolated using the SV Total RNA

Isolation System (Promega, Madison, WI). Once purified, 1 µg of total RNA from each tissue

(anterior midgut; posterior midgut; salivary gland; hindgut; dorsal vessel (DV), fat body and

diaphragm; MTs; testis; and CNS) was prepared with 2× RNA loading dye (Fermentas,

Burlington, ON) and denatured at 75 °C for 5 min and subsequently cooled on ice. The samples

were then run at 5 V/cm on a 1–2% formaldehyde-agarose gel (20 mM MOPS, 5 mM NaOAc,

10 mM EDTA, pH 7.0, 2.2 M formaldehyde) that was precast and allowed to set for at least 1 h.

Once RNA samples were appropriately separated, as determined by brief visualization under UV

transilluminator, gels were rinsed for 30–40 min in nuclease-free water to remove excess

formaldehyde. Gels were then prepared for downward capillary transfer to positively charged

nylon membranes (Roche Applied Science, Laval, QC). Transfer was carried out with 20× SSC

for 12–16 h and blots were then briefly rinsed (<10 s) in nuclease-free water to remove excess

SSC. Blots were then transferred onto dampened blotting paper for UV crosslinking at a setting

of 30 mJ/cm2 (UVP CL-1000, Upland, CA). The blots were then allowed to air-dry for 3–4 h and

108

stored at 4 °C in a sealed plastic bag until used in hybridization. Digoxigenin (DIG)-labelled

RNA anti-sense probes were prepared for each paralog following methods described previously

(Paluzzi et al., 2008). Briefly, using CNS cDNA as template, PCR was used to generate a 713 bp

RhoprCAPA-α fragment using the sense primer, CAPAalpha_GSPfor (5′-

GCATGCGACATTGTTTTTTC-3′) and a 703 bp RhoprCAPA-β fragment using the sense

primer, CAPAbeta_GSPfor (5′-GCATGCGACATTTTTGACC-3′). Both fragments utilized the

same anti-sense primer, CAPArev1 (5′-ATGAAAAGGCACATTTATTGTATGC-3′), designed

over a region with no difference in sequence between the two paralogs. For analysis of RNA

quality and quantity, a fragment specific for actin 5c (beta-actin, FJ851423.1) was generated

using the sense primer, actin_GSPfor (5′-ACTAACTGGGACGACATGG-3′) and anti-sense

primer, actin_GSPrev (5′-GTGGCCATTTCCTGTTC-3′). These products were ligated into the

pGEM-T Easy vector and the directionality of the insert was confirmed via sequencing (as

described above) in order to use the appropriate RNA polymerase (SP6/T7) for in vitro

transcription. Plasmid miniprep DNA for each clone was then linearized using a restriction

enzyme cutting the vector on the 3′ end of the anti-sense strand in order to generate anti-sense-

labeled RNA probes.

Fluorescent in situ hybridization and immunohistochemistry

Cell-specific transcript expression was localized in adult CNS as described previously for fifth-

instars (Paluzzi et al., 2008) with the following changes and adaptations. To reduce non-specific

background staining associated with endogenous peroxidase activity, tissues were incubated in a

1% H2O2 phosphate-buffered saline for 10 min at room temperature following initial tissue

fixation in 4% paraformaldehyde. Following this endogenous peroxidase quenching step, tissues

were washed five times with PBS and 0.1% Tween 20 (PBT) and subsequently incubated in 4%

Triton X-100 (Sigma–Aldrich, Oakville, Ontario, Canada) in PBT for 1 h at room temperature.

The detergent containing buffer was then removed and tissues washed for approximately 30 min

in PBT changing the wash solution every 5 min. The remainder of the in situ hybridization was

carried out as previously described. DIG-labeled RNA probes were prepared as described in the

northern hybridization methods section (see above). For control treatments, restriction enzymes

cutting on the 3′ end of the sense strand were used to generate sense-labeled RNA probe.

109

Following the in situ preparations, tissues were briefly observed under a Nikon epifluorescence

microscope in PBS and were then processed for immunohistochemical localization of CAPA-

related peptides using an antisera described previously (Paluzzi and Orchard, 2006), identifying

peptides containing the C-terminal motif, PRX-amide (where X = I, L, M or V; Žitnaň et al.,

2003). Subsequent incubations were carried out with preparations protected from light exposure

in order to minimize photo-bleaching of in situ hybridization red–orange-fluorescent Alexa

Fluor® 568 (Molecular Probes, Eugene, OR). Since tissues had already been digested for the in

situ preparation, tissues were treated directly with antisera that had been preincubated overnight

at 4 °C in PBS containing 0.4% Triton X-100, 2% bovine serum albumin and 2% normal sheep

serum. This incubation with the primary antisera (1:500) was carried out for 36–48 h at 4 °C

with gentle shaking on a flat bed shaker and tissues were then washed in PBS for a minimum of

6 h at room temperature on a rocking platform. To detect immunolocalization of PRX-amide-

related peptides, FITC-conjugated goat anti-rabbit IgG (BioCan Scientific, Mississauga, ON)

was used at a dilution of 1:200 in PBS containing 10% normal goat serum and preparations were

incubated overnight at 4 °C. The following day, tissues were washed for approximately 2 h at

room temperature changing PBS every 15 min. Tissues were then mounted onto slides in

glycerol and viewed under a laser scanning confocal microscope equipped with a helium-neon

(543 nm line) and Argon laser (488 nm line) for excitation of Alexa Fluor 568 and FITC

fluorescent molecules, respectively. Images were acquired using LSM Image browser software

(LSM 510; Zeiss, Jena, Germany).

Reverse transcriptase quantitative PCR (RT-qPCR) analysis of RhoprCAPA paralog

expression

Tissues were dissected in nuclease-free PBS and stored in RNAlater reagent (Ambion, Austin,

TX). Total RNA was extracted as described above for northern analysis and 100 ng of total RNA

was used as template for first-strand cDNA synthesis using the RevertAid™ H Minus M-MuLV

Reverse Transcriptase and supplied oligo(dT)18 primer (Fermentas, Burlington, ON). Tissues for

temporal expression analysis were staged from the end of a 15 min feeding regime on

defibrinated rabbits blood (time = zero). For the micro-temporal analysis, CNS from six insects

of either sex were dissected within 5 min of each time-point, which consisted of insects

110

immediately prior to feeding (unfed), immediately following feeding (time = 0) and 1, 2, 3, 4, 5,

6, 7 and 8 h post-feeding. For the macro-temporal analysis, CNS tissues from six insects were

dissected at each time-point (at the same time of day, approximately 09:00 ± 0:30), which

consisted of insects immediately prior to feeding (unfed), immediately following feeding

(time = 0) and 4, 7, 11, 14, 18, 21, 25, 28 and 32 days post-feeding. Insects were fed as fifth-

instars in both micro- and macro-temporal analyses; however in the latter, insects dissected at 21

days post-feeding and beyond were adult stage insects that had ecdysed at 19–20 days post-

feeding. For spatial expression quantitative analyses, tissues were dissected from fifth-instar or

adult stage insects of the same age since the last blood meal (approximately 5–6 weeks).

Quantitative PCR (qPCR) analyses were carried out on a Mx4000® Multiplex Quantitative PCR

System (Stratagene, La Jolla, CA) using the Maxima™ SYBR Green qPCR Master Mix

(Fermentas, Burlington, ON). Primers were optimized to amplify target fragments of similar size

across all experimental (RhoprCAPA paralogs) and housekeeping control genes (rp49 and actin

5c). In addition, each primer set consisted of at least one primer designed over an exon–exon

splice boundary to ensure target amplification was solely cDNA synthesized from the RNA

isolation. Primers utilized were as follows: RhoprCAPA-α, sense CAPAalpha_GSPfor (5′-

GCATGCGACATTGTTTTTTC-3′) and anti-sense CAPAalpha_qPCRrev (5′-

CGCTTGTTTTTGTCATCACC-3′); RhoprCAPA-β, sense CAPAbeta_GSPfor (5′-

GCATGCGACATTTTTGACC-3′) and anti-sense CAPAbeta_qPCRrev (5′-

TCGTTTGTATTTGTCATCACCG-3′); RhoprRP49, sense rp49_qPCRfor (5′-

GTGAAACTCAGGAGAAATTGGC-3′) and anti-sense rp49_qPCRrev (5′-

AGGACACACCATGCGCTATC-3′); RhoprACTIN-5C, sense actin_qPCRfor (5′-

AGAGAAAAGATGACGCAGATAATGT-3′) and anti-sense actin_qPCRrev (5′-

GTTCGGCTGTGGTGATGA-3′). Cycling conditions for qPCR utilized a typical three-step

protocol as follows: initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for

15 s, annealing at 60°C for 30 s and extension at 72°C for 30 s with data acquisition during the

extension step. To validate the specificity of the SYBR green detected products, a melting curve

analysis along with gel electrophoresis was performed to validate specificity of the products

generated (data not shown). The expression levels were quantified using the standard curve

method and quantities were normalized to either of the housekeeping genes (mentioned above),

with no difference in results obtained based on housekeeping gene chosen. Results are

111

representative of at least two biological replicates with each individual assay measurement

quantified in duplicate or triplicate. In every assay, a no template control was included to assess

reagent contamination or primer dimer generation, and in addition, a no reverse transcriptase

control (RNA not synthesized into cDNA) was included to ensure absence of contaminating

genomic DNA in the samples.

112

Results

Two genes encode the CAPA-related peptides in R. prolixus

We have identified a cDNA, which we refer to as RhoprCAPA-β (GenBank accession number:

EU937527), with high sequence similarity to a gene identified previously, RhoprCAPA-α

(GenBank accession number: EF989016; Paluzzi et al., 2008). In fact, at the nucleotide level, the

R. prolixus paralogs share 88.7% identity in nucleotide sequence. At the amino acid level, both

paralogs encode a prepropeptide of 157 residues sharing 85.4% similarity. The first encoded

peptide, RhoprCAPA-β1 (SPITSIGLLPFLRAA), deviates considerably from its paralog in the

RhoprCAPA-α gene, RhoprCAPA-α1 (73.3% identity, see Table 1). Interestingly, it is modified

on its C-terminus, with an additional alanine residue and lacking the glycine residue required for

amidation of the mature peptide (see Figure 1A). The second peptide is fully conserved with its

related paralog on the RhoprCAPA-α gene; however, to distinguish its location on the

RhoprCAPA-β gene, we give it a unique nomenclature, RhoprCAPA-β2 (EGGFISFPRV-NH2,

see Table 1). The third encoded peptide, RhoprCAPA-βPK-1 (IGGGGNGGGLWFGPRL-NH2),

shares near perfect identity with its paralog from the RhoprCAPA-α gene, nonetheless the N-

terminal most asparagine residue has been substituted by isoleucine (see Figure 1A and Table 1).

All peptide masses predicted by processing of the RhoprCAPA-β prepropeptide were identified

by mass spectrometry (data not shown), as were those for the RhoprCAPA-α prepropeptide (see

also Paluzzi et al., 2008). To our knowledge, this is the first report demonstrating a duplication

event, in any insect species, for the CAPA/CAP2b peptide-encoding genes.

Genomic organization of the R. prolixus CAPA genes

Preliminary genome assembly data from the ongoing R. prolixus genome sequencing project was

screened using a local BLASTN analysis revealing an initial molecular organization of each

paralog (see Figure 1B). The open reading frame of each paralog is encoded by four exons

separated by three introns. The RhoprCAPA-α exons are 153, 144, 174 and 253 bp in length and

the RhoprCAPA-β exons are identical in size with the exception of the first exon which is

113

Table 1. Sequences deduced from the RhoprCAPA genes which arise following post-

translational processing and detected by mass spectrometry (data not shown).

Gene

Peptide name Sequence [M+H]+

RhoprCAPA-α

RhoprCAPA-α1 SPISSVGLFPFLRA-NH2 1489.85

RhoprCAPA-α2 EGGFISFPRV-NH2 1107.59

RhoprCAPA-αPK1 NGGGGNGGGLWFGPRL-NH2 1514.76

RhoprCAPA-β

RhoprCAPA-β1 SPITSIGLLPFLRAA-OH 1555.92

RhoprCAPA-β2 EGGFISFPRV-NH2 1107.59

RhoprCAPA-βPK1 IGGGGNGGGLWFGPRL-NH2 1513.80

114

Figure 1. Deduced amino acid prepropeptide of the R. prolixus CAPA-β (RhoprCAPA-β) gene.

(A) Sequences are numbered on the right starting with the first nucleotide in the 5′ untranslated

region (UTR) and initial methionine start codon (capitalized), respectively. The three encoded

peptides are shown in boxes, with N-terminal dibasic and C-terminal monobasic post-

translational cleavage sites in bold. The highly predicted signal peptide required for processing in

the secretory pathway is underlined with predicted cleavage occurring between alanine24 and

aspartate25. The polyadenylation signal sequences occur within the 3′ UTR (bases 686–692 and

724–730). (B) Preliminary organization of the CAPA genes in the R. prolixus genome. Exons are

represented within boxes with sizes denoted and introns are represented by lines connecting the

exons with sizes also indicated (or predicted) beneath them.

115

A

B

116

142 bp. Although the introns are located at identical positions, they diverge greatly in size and

the RhoprCAPA-α gene spans a greater region of the genome than does the RhoprCAPA-β

paralog. However, given the current stage of the R. prolixus genome sequencing project, it was

not possible to confirm precisely the size of all of the introns (see Figure 1B for predicted intron

sizes).

Sequence and phylogenetic analysis of CAPA-precursors

The CAPA prepropeptide sequences in insects generally share sequence identity on the C-

terminus of each encoded peptide (see Figure 2A). Implementing a 75% conservation threshold

and considering all species where a prepropeptide sequence is known, the region containing the

first peptide has the consensus motif LX1X2FX3RVGR (where X1 = L, I, F, T or Y; X2 = A or P;

X3 = L or P), with some minor exceptions (such as the substitutions observed in both R. prolixus

precursors and that in T. castaneum). The conserved motif in the region producing the second

peptide is FPRVGR, again with some minor exceptions (A. pisum and T. castaneum have

isoleucine substituted for valine). The region producing the pyrokinin-related peptide contains

the conserved motif WFGPRLG, normally followed by a single or dibasic residue (with the

exception of the recently identified ‘CAPA-B’ splice variant in B. mori, which may not be

processed at this site as it lacks basic residues required for propeptide cleavage).

In comparison to other insect species, our phylogenetic analysis indicates the RhoprCAPA

prepropeptide sequences are most similar with the precursor identified in T. castaneum (see

Figure 2B), which together generate a monophyletic group having strong support (90% bootstrap

percentage). The sister group to these taxas’ sequences was one which included all other insect

sequences except the aphid taxa sequences. Interestingly, the Dipteran representatives (the

Drosophilidae and Culicidae) did not form a monophyletic group. Instead, the Culicidae formed

a sister taxa to a monophyletic group including the Drosophilidae, Lepidopteran and

Hymenopteran sequences. A second group of Hemipteran representatives (the Aphidoidea), are

placed at the basal position of all insect representatives having the greatest difference to all the

insect CAPA-precursors known.

117

Figure 2. ClustalW2 alignment and phylogenetic analysis of known and predicted insect CAPA

encoding prepropeptide sequences. (B) The phylogenetic relationship of the prepropeptide

sequences of CAPA-related peptides of R. prolixus with representatives of the insect

Coleopteran, Dipteran, Lepidopteran, Hemipteran, Phthirapteran and Hymenopteran orders as

well as a species of the arachnid order, Acari. The tree was constructed using neighbor-joining

method. Numbers at the nodes are for percent support in 1000 bootstrapping iterations. A

parsimonious tree provided a similar tree topology.

119

CAPA paralog spatial expression profile in fifth-instars

Expression of the RhoprCAPA paralogs in fifth-instar tissues was assessed by Northern blot

hybridization. A band was detected in lanes containing CNS RNA at an approximate size of 0.7-

0.8 kb after hybridization with a DIG-labelled anti-sense RNA probe generated using either the

RhoprCAPA-α (data not shown) or RhoprCAPA-β cDNA (Figure 3A). With the exception of a

faint, similarly sized, band in the testis RNA sample, no other tissues displayed presence of

RhoprCAPA paralog transcript. A probe for beta-actin (actin 5c) was used as a control to verify

the quantity and integrity of RNA samples loaded in each lane.

To corroborate these findings and more accurately measure the expression levels of each paralog,

a two-step RT-qPCR approach was utilized. Both paralogs are expressed in the CNS, while only

the RhoprCAPA-α transcript is detected in testis samples (Figure 3B). The expression of the

RhoprCAPA-α transcript in the testis represents only a marginal level compared to the total

neuronal expression levels of both paralogs, but it is interesting that only the one transcript

(RhoprCAPA-α) was detected in this non-neuronal tissue. When comparing expression levels

within the CNS however, the RhoprCAPA-β transcript shows approximately 30% higher levels.

Within the different regions of the CNS, divided as the brain and suboesophageal ganglion

(SOG), prothoracic ganglion (PRO), and mesothoracic ganglionic mass (MTGM), RhoprCAPA-

β expression is consistently higher than that of RhoprCAPA-α transcript (Figure 3C), albeit

highest levels are observed in the MTGM and lowest levels in the PRO.

CAPA paralog temporal expression profile relative to blood meal

Upon engorging a blood meal, R. prolixus undergoes a rapid diuresis whereby the excess water

and salt loads are excreted. In order to better understand the role of CAPA peptides in serving to

regulate the termination of this rapid diuresis, we investigated expression levels of the

RhoprCAPA genes following a blood meal. The analysis was carried out in both a micro (hours)

and macro (days/weeks) time-scale (see Figure 4).

The outcome of the micro-temporal analysis reveals that both genes undergo an immediate

decrease in expression levels following blood gorging. Transcript levels in CNS dissected

120

Figure 3. Expression analysis of RhoprCAPA genes in fifth-instar R. prolixus. (A) Northern blot

analysis demonstrates RhoprCAPA genes are expressed primarily in the central nervous system.

Detection of transcript size and abundance was similar in experiments using digoxigenin-labelled

anti-sense RNA probes for RhoprCAPA-α or RhoprCAPA-β. (B) Quantitative RT-PCR analysis

of transcript levels in fifth-instar tissues. (C) Transcript levels in regions of the central nervous

system were assessed to determine spatial expression profile of the two CAPA gene paralogs.

122

Figure 4. Quantitative reverse transcriptase PCR in central nervous system following a blood

meal for RhoprCAPA-α and RhoprCAPA-β. Pools of tissues dissected from 5 to 6 insects were

used for total RNA isolation and subsequent cDNA synthesis. The averages and standard

deviations of three biological replicates are shown. (A) Micro-temporal analysis of RhoprCAPA-

α and RhoprCAPA-β expression during the hours following a blood meal (t = 0). (B)

Macrotemporal analysis of RhoprCAPA-α and RhoprCAPA-β expression following a blood

meal (t = 0) during development from fifth-instar to adults. Triangles and squares denote

RhoprCAPA-α and RhoprCAPA-β expression, respectively.

124

immediately following feeding show an approximate 25% reduction in expression for both

paralogs and the levels remain lower than those prior to feeding over the next couple of hours

(Figure 4A). The RhoprCAPA-α transcript has its lowest levels at 2 h post-feeding, reaching a

level 40% lower than that prior to feeding. Subsequent to this, levels of RhoprCAPA-α begin to

increase, reaching a titer similar to the unfed state at 4 h post-feeding. However, at 5 and 6 h

after feeding, the RhoprCAPA-α levels are again 20% lower, and are then restored to near-unfed

levels at 7 h. At 8 h, the transcript level of RhoprCAPA-α is again lower by about 20% and

remains low up to 24 h post-feeding. For the most part, the RhoprCAPA-β transcript level

changes mirror those of RhoprCAPA-α, but levels are consistently higher by a range of 20–40%

at each time-point (a ratio similar to that observed in the spatial expression profile, see Figure 3).

Similar to its paralog, the RhoprCAPA-β transcript had lowest levels at 2 and 3 h after feeding,

and levels begin increasing thereafter reaching levels comparable to the unfed state at 5–7 h after

the blood meal (Figure 4A). As shown for RhoprCAPA-α, a decrease in RhoprCAPA-β

transcript level is also observed at 8 h post-feeding with a small increase occurring 24 h post-

feeding.

The macro-temporal analysis reveals that both RhoprCAPA paralogs undergo fluctuations during

the days/weeks following a blood meal (Figure 4B). As observed in the micro-temporal analysis,

expression immediately following feeding is lower relative to the levels in the unfed insect.

Transcript levels of both paralogs reach lowest levels at 12 days post-feeding and subsequently

increase, whereby they reach their highest levels at time-points subsequent to the nymph-adult

ecdysis (21, 25, 28 and 32 days post-feeding), which occurs on days 19–20 post-feeding. As

observed in other quantitative analyses of these two paralogs in CNS, the changes in expression

are generally mirrored between the two paralogs – again, the RhoprCAPA-β transcript has levels

ranging approximately 20–40% higher than the RhoprCAPA-α transcript.

CAPA paralog expression in adult R. prolixus

Investigation of the expression distribution of the two transcripts in various adult tissues (CNS,

thoracic muscle, hindgut, reproductive tissue, anterior midgut, salivary gland, dorsal vessel,

MTs, posterior midgut and a combined sample composed of fat body, diaphragm and trachea) in

125

male (Figure 5A) and female (Figure 5B) R. prolixus demonstrates that transcript expression is

confined to the CNS in both sexes. Since we found that the RhoprCAPA-α transcript was also

expressed in fifth-instar male reproductive tissues, and that expression levels of the transcripts

fluctuated during development following a blood meal, we sought to quantitate transcript levels

in tissue types that had demonstrated expression of one or both transcripts. This analysis (Figure

5C) reveals that in fifth-instars, transcript levels are similar in male and female CNS; however

outside of the CNS, male reproductive tissue (testis) also contains low levels of the RhoprCAPA-

α transcript. In adult male CNS tissues, expression levels are similar to those found in fifth-

instars (regardless of gender). Conversely, in adult female CNS, transcript levels are

approximately half those levels observed in their male counterparts. Neither paralog is detected

in adult reproductive tissues.

Immunohistochemical localization of CAPA-related peptides and CAPA gene expression in

R. prolixus adult central nervous system

We have previously determined the distribution of PRX-amide-like immunoreactivity in fifth-

instar R. prolixus and located cells expressing the RhoprCAPA-α transcript in CNS (and

presumably, given the high sequence identity between these two paralogs, the RhoprCAPA-β

transcript expression). Since we observed some differences in expression within the CNS of male

and female adults (see Figure 5C), we performed combined fluorescent in situ hybridization and

immunohistochemical assays to determine which cells might be expressing higher or lower

levels of these transcripts. A comparison of adult male and female CNS reveals no difference in

cell number or location; however, cell staining-intensity was noticeably greater in adult male

CNS. We have not observed any differences in cell distribution with regard to the paralog

(RhoprCAPA-α or RhoprCAPA-β) that was utilized as a probe.

The cells expressing RhoprCAPA transcript and those positive for PRX-amide-like

immunoreactivity are shown in Figure 6 and Figure 7. The double-labelling reveals that all cells

positive for RhoprCAPA transcript expression are also positive for PRX-amide-like

immunoreactivity. However, as might be expected for an antiserum that recognizes families of

peptides with similar C-termini, there are PRX-amide-like immunoreactive cells that are negative

126

Figure 5. Tissue expression analysis of RhoprCAPA genes in adult male (A) and female (B) R.

prolixus and comparison of expression between fifth-instar and adult neuronal and reproductive

tissues (C). Regardless the sex and stage of the insect, expression was primarily identified in the

central nervous system. Pools of tissues dissected from 5 to 6 insects were used for total RNA

isolation and subsequent cDNA synthesis. In (A) and (B) numbers denote as follows: 1, CNS; 2,

thoracic muscle; 3, hindgut; 4, reproductive tissue; 5, anterior midgut; 6, salivary gland; 7, dorsal

vessel; 8, Malpighian tubules; 9, posterior midgut; and 10, fat body, diaphragm and trachea. In

(C) numbers denote the following: 1, fifth male CNS; 2, fifth female CNS; 3, fifth male

reproductive; 4, fifth female reproductive; 5, adult male CNS; 6, adult female CNS; 7, adult male

reproductive; and 8, adult female reproductive.

128

Figure 6. RhoprCAPA-α and RhoprCAPA-β transcript expression (Alexa568/red) and PRX-

amide-like immunoreactivity (FITC/green) in the brain, suboesophageal ganglion (SOG) and

prothoracic ganglion (PRO) of adult R. prolixus. Over the dorsal surface of the brain, a pair of

lateral neurosecretory cells show PRX-amide-like immunoreactivity and RhoprCAPA transcript

expression (A–C). In addition, a number of medial neurosecretory cells show PRX-amide-like

immunoreactivity; however, they do not show any RhoprCAPA transcript expression. Over the

ventral surface of the SOG (D–F), two pairs of cells with prominent expression are observed

located medially and an additional three pairs of cells, which stained more weakly, are observed

just posterior of the oesophageal foramen. Over the ventral prothoracic ganglion (G–I), two

small pairs of cells are observed lying medially. A schematic diagram (J) summarizes the cells

within the brain, SOG and PRO which show both PRX-amide-like immunoreactivity and

RhoprCAPA transcript expression. Outlined cells are located on the ventral surface while filled

cells are located on the dorsal surface. Scale bar in A–I is 50 µm and in J is 200 µm.

130

Figure 7. RhoprCAPA-α and RhoprCAPA-β transcript expression (Alexa568/red) and PRX-

amide immunoreactivity (FITC/green) in the mesothoracic ganglionic mass (MTGM) of adult R.

prolixus. The ventral posterior segment of the MTGM (A–C) contains three bilaterally paired

RhoprCAPA gene-expressing cells within the abdominal neuromeres. In the more anterior

segment of the ventral MTGM (the meso- and metathoracic neuromeres), two additional pairs of

cells are positive for PRX-amide-like immunoreactivity but RhoprCAPA transcript expression

was not detected. In the dorsal region of the posterior MTGM, two pairs of lateral neurosecretory

cells were immunopositive for PRX-amide like peptides (D–F), however, these cells did not

show any RhoprCAPA transcript expression. A schematic diagram (G) summarizes the cells

within the MTGM on the ventral surface which show both PRX-amide-like immunoreactivity

and RhoprCAPA transcript expression. Scale bar in A–F is 50 µm and in G is 200 µm.

132

for RhoprCAPA transcript expression. These cells probably express the PBAN family or

pyrokinin family of neuropeptides which share some sequence similarity to the CAPA-related

neuropeptide family (see Rafaeli, 2009).

A bilateral pair of cells is present in the dorsal-lateral region of the brain bordering the optic lobe

(Figure 6A), which are positive for RhoprCAPA transcript and PRX-amide-like

immunoreactivity. The PRX-amide-like immunoreactivity reveals processes arising from the

cell bodies that enter the central neuropile of the brain (Figure 6B). Additional PRX-amide-like

positive cells, but lacking RhoprCAPA transcript expression, are found within the central region

of the brain, and these are consistent with being the medial neurosecretory cells identified in

fifth-instars. The colocalization of transcript expression and the peptide products within the adult

brain using merged images is shown in Figure 6C. In the SOG, two pairs of cells (Figure 6D and

F) demonstrate strong transcript abundance with the more posterior pair being approximately

twice the diameter of the anterior pair. Another group of cells displaying RhoprCAPA transcript

expression lie adjacent to the oesophageal foramen, but are less strongly stained. Both groups of

cells are PRX-amide-like immunoreactive; however a number of other immunoreactive-positive

cells do not show RhoprCAPA transcript expression (Figure 6E and F). The central region of the

PRO contains two pairs of cells on the ventral surface which exhibit RhoprCAPA transcript

expression (Figure 6G and I) and are also positive for PRX-amide-like immunoreactivity (Figure

6H and I). A schematic of cells which colocalize for RhoprCAPA transcript expression and

PRX-amide-like immunoreactivity in the adult brain, SOG and PRO is illustrated in Figure 6J.

Within the MTGM, three pairs of strongly staining cells are present within the abdominal

neuromeres on the posterior ventral surface that express RhoprCAPA transcript (Figure 7A and

C) and these same cells demonstrate PRX-amide-like immunoreactive staining (Figure 7B and

C). More anteriorly, two additional pairs of cells and one ventral unpaired median neuron lie

within the meso- and metathoracic neuromeres and contain PRX-amide-like immunoreactivity,

but these cells show no RhoprCAPA transcript expression (Figure 7B and C). No cells on the

dorsal surface of the MTGM have RhoprCAPA transcript expression (Figure 7D).

Immunoreactive processes that arise from the three pairs of strongly stained and double-labelled

133

neurosecretory cells on the ventral surface are however observed (Figure 7E and F). These

processes continue posteriorly and produce extensive neurohemal sites on abdominal nerves two,

three and four (as previously shown for fifth-instars). Two lateral pairs of cells which are PRX-

amide-like immunoreactive, but negative for RhoprCAPA transcript expression, lie on the dorsal

surface of the MTGM (Figure 7E and F). A schematic of cells which colocalize for RhoprCAPA

transcript expression and PRX-amide-like immunoreactivity in the adult MTGM is illustrated in

Figure 7G.

134

Discussion

CAPA gene peptides include the CAP2b-related/periviscerokinins and pyrokinins and are an

important family of peptides which appear to regulate central and peripheral physiological

processes in insects. In Dipteran species, the CAP2b-related peptides stimulate fluid secretion by

the MTs through increasing levels of nitric oxide and cyclic GMP, which in turn elevates

calcium levels by opening cyclic-nucleotide gated calcium channels (Pollock et al., 2004). In

contrast, while members of this family may have no effect on MTs in insects such as the

Orthopteran, Schistocerca gregaria, these peptides are known for their anti-diuretic role in R.

prolixus (Quinlan et al., 1997; Paluzzi and Orchard, 2006; Paluzzi et al., 2008), where they

inhibit tubule secretion stimulated by 5-HT. In addition, unlike the increase in cGMP over

unstimulated levels that is induced in Dipteran MTs by CAPA-related peptides (Pollock et al.,

2004), resting R. prolixus tubules do not exhibit an increase in cGMP in response to CAPA-

related peptides (Quinlan et al., 1997; Paluzzi and Orchard, 2006; Paluzzi et al., 2008).

Importantly, however, the decrease in cGMP levels that is observed when tubules are stimulated

with 5-HT, is abolished in the presence of CAPA-related peptides (Quinlan et al., 1997; Paluzzi

and Orchard, 2006; Paluzzi et al., 2008).

CAPA-related peptides have been identified in a number of insect species including Dipterans

(Kean et al., 2002; Pollock et al., 2004; Riehle et al., 2002; Predel et al., 2003a; 2003b; Nachman

et al., 2006), at least two Lepidopterans (Loi and Tublitz, 2004, Huesmann et al., 1995; Predel et

al., 2003a; 2003b), Blattarian species (Predel et al., 1998; 2000; Predel and Gade, 2005; Roth et

al., 2009), the Coleopteran, T. castaneum (Li et al., 2008), four polyphagous Hemipteran species

(Predel et al., 2006; 2008) and the haematophagous Hemipteran, R. prolixus (Paluzzi et al., 2008

and this study).

Genes encoding CAPA-related peptides have not been abundantly resolved in insects, however

they have been identified in Dipterans (Kean et al., 2002), Lepidopterans (Loi and Tublitz,

135

2004), Hemipterans (Paluzzi et al., 2008) and Coleopterans (Li et al., 2008). Genome sequencing

of the human body louse, P. humanus corporis (EEB10638), and the pea aphid, A. pisum

(XP_001946149), as well as EST data of the green peach aphid, M. persicae (EE570800.1),

reveals the presence of CAPA genes in these additional insects of medical and agricultural

importance. Interestingly, a putative CAPA gene exists in the genome of the Arachnid, I.

scapularis (EW933575.1), although the resulting prepropeptide lacks many of the conserved

motifs seen in the Insecta sequences. In support of the above gene prediction, the first

neuropeptide in ticks was identified using a combined immunocytochemical and mass

spectrometric approach where a CAPA-related peptide was sequenced from analysis of single

cells from two species, Ixodes ricinus and Boophilus microplus (Neupert et al., 2005).

In the current study, we show that R. prolixus contains a second gene, RhoprCAPA-β, encoding

CAPA-related peptides. This gene shares high sequence identity (88.7%) with the previously

identified gene, RhoprCAPA-α, and also the prepropeptides demonstrate strong similarity

(85.4%). The RhoprCAPA-β gene produces peptides that share exact or near-identical sequence

to the products of the RhoprCAPA-α paralog; however, the first encoded peptide contains the

greatest variation and lacks a glycine residue at its carboxyl terminus required for amidation. The

predicted peptides in the RhoprCAPA-β prepropeptide are flanked on their amino termini by a

dibasic cleavage site and a monobasic site on their carboxyl termini, thus providing the necessary

sites for post-translation processing into biologically active forms (Veenstra, 2000). In support of

this predicted processing, molecular masses matching these novel peptides have been confirmed

by mass spectrometry (data not shown).

Phylogenetic analysis of CAPA prepropeptide sequences and those predicted from EST

databases reveals the R. prolixus sequences share the closest similarity with the T. castaneum

precursor. Interestingly, precursors from the more evolutionary-related Aphidoidean species, are

not grouped closely with their haematophagous relatives, suggesting the CAPA genes may

undergo divergent species-specific selection. A similar phenomenon is observed between

representatives of the Dipteran order, where the Culicidea group more closely with non-Dipteran

136

insects, as opposed to the more closely related Drosophilidae. Thus, this suggests the CAPA

prepropeptides may not be a good representative for determining phylogenetic relationships

above the species level in all insects. Nonetheless, a recent phylogenetic analysis using CAPA

peptides from numerous cockroaches and the termite, Mastotermes darwiniensis, demonstrated

mature peptides from species within the Dictyopteran group may be suitable for reconstruction

of phylogenetic relationships (Roth et al., 2009).

Previously we demonstrated the expression of the RhoprCAPA-α paralog in various tissues in

fifth-instar R. prolixus as well as all post-embryonic stages using a non-quantitative RT-PCR

approach (Paluzzi et al., 2008). Using northern blot hybridization, we demonstrate strong CAPA

gene expression within the CNS of R. prolixus, regardless of which paralog was used to

synthesize the anti-sense RNA probe. In order to differentiate between the expression levels of

the two paralogs and quantify the levels identified in the CNS and testis tissues, we designed

gene-specific primers taking advantage of a 10 bp sequence (‘TGTTTTTTCT’, residue 63–72)

that was present in the RhoprCAPA-α transcript, but absent in RhoprCAPA-β. We confirmed

that both paralogs are expressed within the CNS, with the RhoprCAPA-β gene having

moderately higher levels (~30%). Expression outside of the CNS was restricted to the fifth-instar

male reproductive tissue, where only the RhoprCAPA-α transcript was detected. This is

consistent with that found previously (Paluzzi et al., 2008), albeit a level greatly lower than

expression levels found in the CNS. Within each region of the CNS, relative expression levels

between the two paralogs was consistent with that found for the CNS as a whole, where the

RhoprCAPA-β transcript was approximately 30–40% more highly expressed. Expression of both

paralogs was highest in the MTGM, followed by the brain and SOG and lowest levels were

localized to the PRO. The neuronal expression patterns corroborate well with that described for

other insects where the CAPA genes have been studied. In D. melanogaster, the CAPA gene

peptides were immunolocalized in the larval and adult CNS to three pairs of ventral

neuroendocrine cells in the abdominal neuromeres, as well as a number of cells in the SOG and

brain (Kean et al., 2002). In M. sexta, in situ hybridization identified cells expressing the CAPA

gene in similar midline cells within the abdominal ganglia; however, many additional cells were

identified in the larval brain (Loi and Tublitz, 2004) that were not found in D. melangaster (Kean

137

et al., 2002) nor in R. prolixus (Paluzzi et al., 2008). CAPA-related peptides have also been

identified via immunolocalization or mass spectrometric analyses of neuroendocrine cells in the

abdominal ganglia, or analogous regions, in other insects (Predel et al., 1998; 2003a; 2003b;

2004; 2008; Clynen et al., 2003; Verleyen et al., 2004) and two tick species (Neupert et al.,

2005). The appearance of PRX-amide-like immunoreactive neurons in R. prolixus CNS that do

not show RhoprCAPA gene expression illustrates the cross-reactivity of the anti-PRX-amide

antiserum with some other insect peptide families such as PBAN family of peptides, which

contain similar C-terminal sequences (Žitnaň et al., 2003), but are not encoded by CAPA genes.

The temporal expression profile of CAPA genes has not previously been comprehensively

studied. Given the importance of a subset of the R. prolixus CAPA peptides in regulating anti-

diuresis (Paluzzi et al., 2008), we questioned if gene expression was altered following feeding.

Interestingly, both R. prolixus CAPA paralogs show a decrease immediately following feeding,

but levels are soon recovered in the hours that follow the rapid diuresis. Thus, this suggests that

the CAPA genes may undergo transcriptional regulation associated with feeding, although

admittedly, little is known of the transcriptional control of regulators of diuresis in R. prolixus.

Previously we showed that immunoreactivity within neuroendocrine cells in abdominal

neuromeres of the MTGM, and their associated neurohemal release sites, is greatly decreased at

3–4 h post-feeding (Paluzzi and Orchard, 2006). Thus, one possible explanation for the recovery

of gene expression observed between 4 and 7 h post-feeding may be to facilitate the restocking

of these peptides that have been depleted by release into the haemolymph in order to cease

diuresis. The expression profile observed over the days following feeding and leading up to and

beyond the nymph-adult ecdysis suggest that the R. prolixus CAPA genes may also undergo

regulation beyond the rapid diuresis following engorgement. The decrease observed in the early

days that follow a blood meal (a fed state) could be indicative of the insect not requiring starved-

state amounts of anti-diuretic peptide, where the insect must ensure maintenance of water and

essential salts since the previous blood meal has been fully digested. Instead, as the insect

prepares for the nymph-adult ecdysis, our results suggest that increases in CAPA gene transcripts

may reflect the need to synthesize higher amounts of anti-diuretic peptides to ensure osmotic

balance during the nymph-adult ecdysis, where the insect is susceptible to desiccation. Naturally,

138

we must also recognize that the quantification of gene expression may not correlate directly with

levels of biologically mature peptides.

We also assessed the expression of the two paralogs in various adult tissues and determined that

expression is exclusively localized to the CNS in both female and male insects. Expression was

not localized to reproductive tissues in either male or female adults. The role of the fifth-instar

male-specific expression of the RhoprCAPA-α paralog remains unclear.

Two genes encode the CAPA-related peptides in the haematophagous Chagas’ disease vector, R.

prolixus. From our combined immunohistochemical and in situ hybridization analysis, it is

evident that the neurons in the CNS of R. prolixus synthesize at least a two-fold greater number

of CAPA-related peptides than that known in other insects. In addition, given the sequence

variation that has occurred over the first encoded peptide in each prepropeptide, it is unlikely that

the first peptide will elicit the same anti-diuretic effect as shown by RhoprCAPA-α2 (-β2).

Physiological studies utilizing these peptides clearly demonstrate that the first encoded peptides

do not inhibit serotonin-stimulated Malpighian tubule secretion nor do they abolish absorption by

the anterior midgut (data not shown). Thus, one or both of the first encoded peptides, namely

RhoprCAPA-α1 (-β1), in these paralogous genes may have a distinct role, and utilize a unique

receptor, in accordance with the theory of ligand-receptor coevolution (Park et al., 2002). Our

results suggest that expression levels of the CAPA genes in R. prolixus are modified following

gorging on a blood meal, which we suspect allows the restocking of peptide stores that are

depleted from the neuroendocrine cells (and associated neurohemal sites) during the termination

of the rapid diuresis. Finally, the RhoprCAPA genes undergo changes in expression as the fifth-

instar digests the blood meal for a period of days and weeks following feeding and prepares for

the nymph-adult ecdysis. At times when water must be conserved in R. prolixus (such as the end

of the rapid diuresis and nymph-adult ecdysis), our results indicate the CAPA genes may be

activated to ensure sufficient anti-diuretic peptide is present to meet that physiological demand.

139

References

Bendtsen, J. D., Nielsen, H., von Heijne, G. and Brunak, S. (2004). Improved prediction of

signal peptides: SignalP 3.0. Journal of Molecular Biology 340, 783-795.

Clynen, E., Huybrechts, J., De Loof, A. and Schoofs, L. (2003). Mass spectrometric analysis

of the perisympathetic organs in locusts: Identification of novel periviscerokinins

Biochem. Biophys. Res. Commun. 300, 422-428.





tobacco hawkmoth Manduca sexta. FEBS Lett. 371, 311-314.




Physiol 282, R1297-1307.


associated with feeding in the bloodsucking bug, Rhodnius prolixus. J. Insect Physiol. 35,

393-399.

Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam,

H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R. et al. (2007). Clustal W and

Clustal X Version 2.0 Bioinformatics 23, 2947-2948.



peptidomics of neuropeptides and protein hormones in the red flour beetle Tribolium

castaneum Genome Res. 18, 113-122.



140

Maddrell, S. H. P., Herman, W. S., Farndale, R. W. and Riegel, J. A. (1993). Synergism of

hormones controlling epithelial fluid transport in an insect. J. Exp. Biol. 174, 65-80.

Nachman, R. J., Russell, W. K., Coast, G. M., Russell, D. H., Miller, J. A. and Predel, R.

(2006). Identification of PVK/CAP2b neuropeptides from single neurohemal organs of

the stable fly and horn fly via MALDI-TOF/TOF tandem mass spectrometry. Peptides

27, 521-526.

Neupert, S., Predel, R., Russell, W. K., Davies, R., Pietrantonio, P. V. and Nachman, R. J.

(2005). Identification of tick periviscerokinin, the first neurohormone of Ixodidae: Single

cell analysis by means of MALDI-TOF/TOF mass spectrometry. Biochem. Biophys. Res.

Commun. 338, 1860-1864.

Orchard, I. (2006). Serotonin: A coordinator of feeding-related physiological events in the

blood-gorging bug, Rhodnius prolixus. Comparative Biochemistry and Physiology A-

Molecular & Integrative Physiology 144, 316-324.

Orchard, I. and Paluzzi, J. P. (2009). Diuretic and anti-diuretic hormones in the blood-gorging

bug Rhodnius prolixus. Ann. N. Y. Acad. Sci. 1163, 501-503.



Paluzzi, J. P., Russell, W. K., Nachman, R. J. and Orchard, I. (2008). Isolation, cloning, and

expression mapping of a gene encoding an anti-diuretic hormone and other CAPA-related

peptides in the disease vector, Rhodnius prolixus. Endocrinology 149, 4638-4646.






Biol. 207, 4135-4145.

Predel, R. and Gade, G. (2005). Peptidomics of neurohemal organs from species of the

cockroach family Blattidae: How do neuropeptides of closely related species differ?

Peptides 26, 3-9.

141

Predel, R., Herbert, Z. and Eckert, M. (2003). Neuropeptides in perisympathetic organs of

Manduca sexta: Specific composition and changes during the development. Peptides 24,

1457-1464.

Predel, R., Kellner, R., Baggerman, G., Steinmetzer, T. and Schoofs, L. (2000).

Identification of novel periviscerokinins from single neurohemal release sites in insects

MS/MS fragmentation complemented by Edman degradation. Eur. J. Biochem. 267,

3869-3873.

Predel, R., Rapus, J., Eckert, M., Holman, G. M., Nachman, R. J., Wang, Y. and Penzlin,

H. (1998). Isolation of periviscerokinin-2 from the abdominal perisympathetic organs of

the American cockroach, Periplaneta Americana. Peptides 19, 801-809.


(2006). Identification of the first neuropeptides from the CNS of Hemiptera: CAPA

peptides of the southern green stinkbug Nezara viridula (L.). Peptides 27, 2670-2677.

Predel, R., Russell, W. K., Russell, D. H., Lopez, J., Esquivel, J. and Nachman, R. J. (2008).

Comparative peptidomics of four related Hemipteran species: pyrokinins, myosuppressin,

corazonin, adipokinetic hormone, sNPF, and periviscerokinins. Peptides 29, 162-167.

Predel, R., Russell, W. K., Tichy, S. E., Russell, D. H. and Nachman, R. J. (2003). Mass

spectrometric analysis of putative capa-gene products in Musca domestica and

Neobellieria bullata. Peptides 24, 1487-1491.


63, 2477-2490.

Predel, R., Wegener, C., Russell, W. K., Tichy, S. E., Russell, D. H. and Nachman, R. J.

(2004). Peptidomics of CNS-associated neurohemal systems of adult Drosophila

melanogaster: a mass spectrometric survey of peptides from individual flies. J. Comp.

Neurol. 474, 379-392.


Rhodnius prolixus Stal: the peptide CAP2b and cyclic GMP inhibit Malpighian tubule


142


Rhodnius prolixus Stal: antagonistic actions of cAMP and cGMP and the role of organic

acid transport. Journal of Insect Physiology 44, 561-568.

Rafaeli, A. (2009). Pheromone biosynthesis activating neuropeptide (PBAN): regulatory role

and mode of action. Gen. Comp. Endocrinol. 162, 69-78.

Riehle, M. A., Garczynski, S. F., Crim, J. W., Hill, C. A. and Brown, M. R. (2002).

Neuropeptides and peptide hormones in Anopheles gambiae. Science 298, 172-175.

Roller, L., Yamanaka, N., Watanabe, K., Daubnerova, I., Žitnaň, D., Kataoka, H. and

Tanaka, Y. (2008). The unique evolution of neuropeptide genes in the silkworm Bombyx

mori. Insect Biochem. Mol. Biol. 38, 1147-1157.

Roth, S., Fromm, B., Gade, G. and Predel, R. (2009). A proteomic approach for studying

insect phylogeny: CAPA peptides of ancient insect taxa (Dictyoptera, Blattoptera) as a

test case. BMC Evol. Biol. 9, 50.

Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007). MEGA4: Molecular Evolutionary

Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596-1599.




on the anterior midgut of the blood-feeding bug, Rhodnius prolixus. Gen. Comp.

Endocrinol. 162, 105-112.


distribution of a CRF-like diuretic peptide in the blood-feeding bug Rhodnius prolixus. J.

Exp. Biol. 202, 2017-2027.

Veenstra, J. A. (2000). Mono- and dibasic proteolytic cleavage sites in insect neuroendocrine

peptide precursors. Arch. Insect Biochem. Physiol. 43, 49-63.

Verleyen, P., Huybrechts, J., Sas, F., Clynen, E., Baggerman, G., De Loof, A. and Schoofs,

L. (2004). Neuropeptidomics of the grey flesh fly, Neobellieria bullata. Biochem.


143

Žitnaň, D., Zitnanova, I., Spalovska, I., Takac, P., Park, Y. and Adams, M. E. (2003).

Conservation of ecdysis-triggering hormone signaling in insects. J. Exp. Biol. 206,

1275-1289.

144

Acknowledgments

The authors wish to thank Nikki Sarkar for assistance in the feeding experiments. This research

was made possible through an NSERC Discovery Grant to I.O. and an NSERC Canada Graduate

Scholarship to J.P.P.

145


The preceeding chapter was reproduced / adapted with permission from Elsevier.


A second gene encodes the anti-diuretic hormone in the insect, Rhodnius prolixus. Paluzzi JP, Orchard I. Mol Cell Endocrinol. . [Epub ahead of print] Nov 19, 2009 doi:10.1016/j.mce.2009.11.004

Copyright © 2010, Elsevier

146

Chapter 5:

Isolation, expression analysis and functional characterization of the first

anti-diuretic hormone receptor in insects

147

Abstract

Diuresis following blood-gorging in Rhodnius prolixus is the major process leading to the

transmission of Chagas’ disease. We have cloned the cDNA of the first receptor known to be

involved in an anti-diuretic strategy in insects; a strategy that prevents diuresis. More

specifically, this receptor belongs to the insect CAPA receptor family (known in other insects to

be activated by peptides encoded within the capability gene), and in addition, also shares

similarity to the pyrokinin-1 receptor family in insects. We characterize the expression profile

in fifth-instar R. prolixus and find expression is localized to the alimentary canal. Highest

transcript levels are found in Malpighian tubules and the anterior midgut, which are known

targets of the RhoprCAPA-α2 neurohormone. Two transcripts were identified, capa-r1 and

capa-r2; however the latter encodes an atypical GPCR lacking a region ranging between the first

and second transmembrane domain. Our heterologous expression assay revealed the expressed

capa-r1 receptor is activated by the R. prolixus anti-diuretic hormone, RhoprCAPA-α2 (EC50 =

385nM) but not by RhoprCAPA-α1. In addition, this receptor has some sensitivity to the

pyrokinin-related peptide, RhoprCAPA-αPK1, but with an efficacy approximately 40-fold less

than RhoprCAPA-α2. Structural analogs of the inactive RhoprCAPA-α1 were capable of

activating the expressed capa-r1 receptor, confirming the importance of the C-terminal

consensus sequence common to CAPA-related peptides. Other peptides belonging to the

PRXamide superfamily were inactive on the capa-r1 receptor. Taken together, the

neuroendocrinological relevance of this receptor in facilitating the anti-diuretic strategy in R.

prolixus, may make this receptor a useful target for development of agonists or antagonists that

could help influence the transmission of Chagas’ disease that occurs during diuresis in this

medically-important insect disease-vector.

148

Introduction

A major physiological process that allows insects to adopt a variety of feeding strategies and

environmental niches is their ability to regulate water and ion composition in their haemolymph.

This process involves control over primary urine production via the insect kidney equivalent, the

Malpighian (renal) tubules (MTs), and, in a number of insects, the reabsorption of essential salts

and water from the hindgut before the final excretae is voided. Insect neurohormones, including

peptides and biogenic amines, together with their cognate receptors, carry out an essential role in

these and related physiological processes and numerous neuroendocrine factors regulating fluid

and ion balance in insects have been described. These include corticotropin releasing factor-

related peptides, calcitonin-related peptides, kinin-related peptides, CAPA peptides (encoded on

the capability gene) (Kean et al., 2002; Loi and Tublitz, 2004; Paluzzi et al., 2008; Paluzzi and

Orchard, 2010) and the biogenic amine, serotonin (5-hydroxytryptamine, 5-HT) (for a review,

see Coast et al., 2002). One insect which has been used as a model for understanding the control

of this diuresis is the haematophagous bug, Rhodnius prolixus. This insect imbibes enormous

blood meals and must then rapidly eliminate large volumes of excess salts and water (see

Orchard, 2009). The parasitic protozoan, Trypanosoma cruzi, is transmitted to humans in the

urine, and so diuresis controls the transmission of Chagas’ disease. Neurohormones control

haemolymph salt and water homeostasis by acting on the anterior midgut and MTs (Ianowski et

al., 2010; Te Brugge et al., 2009).

The insect CAPA peptides, some of which are also referred to as periviscerokinins, usually

contain the consensus carboxy terminal sequence FPRV-NH2. These peptides are normally

produced within the central nervous system and are known to be released into the haemolymph

from peripheral neurohemal sites where they modify activities of visceral tissues. In Dipterans,

these peptides activate nitric oxide synthase in principal cells of the main segment of the MTs,

leading to increased fluid secretion (Davies et al., 1997; Pollock et al., 2004). Interestingly,

these peptides are not stimulatory on MTs in all insects in which these peptides have been tested.

For example, in the locust, Schistocerca gregaria, this family of peptides does not increase fluid

secretion (Davies et al., 1997; Pollock et al., 2004), nor does it increase levels of nitric oxide. In

addition, CAPA-related peptides are inhibitory on MTs in the haematophagous insect, R.

prolixus (Paluzzi and Orchard, 2006; Quinlan et al., 1997). Recently, we established that R.

149

prolixus contains two CAPA genes. Each gene codes for three peptides, two of them being

CAPA-related peptides and the third being a pyrokinin-related peptide. The second encoded

peptide in each prepropeptide, RhoprCAPA-α2(-β2), is identical in sequence in each paralog

(Paluzzi et al., 2008; Paluzzi and Orchard, 2010). RhoprCAPA-α2 has been shown to directly

inhibit 5-HT-stimulated secretion by the MTs (Paluzzi et al., 2008; Paluzzi and Orchard, 2010)

as well as absorption of water and ions by the anterior midgut (Ianowski et al., 2010; Orchard

and Paluzzi, 2009).

The availability of completed insect genomes has made the identification of receptors for these

neuroendocrine factors more feasible. The first such receptor, belonging to the G protein-

coupled receptor family (having seven transmembrane domains), was annotated in the genome

assembly of the fruit fly, Drosophila melanogaster (Adams et al., 2000), and was subsequently

deorphaned by functional characterization by two separate research groups (Iversen et al., 2002;

Park et al., 2002). This gene, annotated as CG14575, was shown by functional ligand-receptor

interaction assay to have an EC50 value of 150-230nM (Iversen et al., 2002; Park et al., 2002)

and 69-110nM (Iversen et al., 2002; Park et al., 2002) for the D. melanogaster CAPA peptides,

capa-1 and capa-2. Subsequent to these studies, a CAPA receptor was also identified in the

malaria mosquito, Anopheles gambiae (Olsen et al., 2007).

In the present study, we report the isolation, transcript expression profile and functional

interaction analysis of the CAPA receptor in R. prolixus, referred to as RhoprCAPA-r. This

receptor mRNA is localized to tissues of the alimentary canal (foregut, midgut, hindgut and

MTs), and exhibits highest transcript levels in the anterior midgut and MTs; tissues known to be

regulated by the anti-diuretic neurohormone RhoprCAPA-α2 (identical in sequence to

RhoprCAPA-β2). In addition, the upper secretory segment of the Malpighian tubules contains

the majority of the RhoprCAPA-r transcript expression compared to the lower, non-secretory

reabsorptive segment. Functional ligand-receptor interaction assays demonstrate that the

receptor has highest affinity for the anti-diuretic neurohormone, RhoprCAPA-α2, encoded by

both R. prolixus CAPA gene paralogs. In contrast to the functional assay results demonstrated

thus far in other insects (Iversen et al., 2002; Park et al., 2002), a R. prolixus pyrokinin located

on the RhoprCAPA gene, RhoprCAPA-αPK1, partially activates the receptor, albeit at peptide

concentrations 40-fold higher than RhoprCAPA-α2. To our knowledge, this is the first study to

isolate and functionally characterize an anti-diuretic hormone receptor in any insect. The

150

identification of such a receptor, and the knowledge acquired from the neuroendocrinological

effects that it mediates, holds promise for influencing the transmission of Chagas’ disease

associated with blood-feeding by this medically-important pest.

151

Materials and Methods

Animals

Fifth-instar R. prolixus Stål were reared at high relative humidity in incubators at 25°C and

routinely fed on rabbits’ blood. Insect tissues were dissected under physiological saline (Paluzzi

et al., 2008) prepared using nuclease-free water, and tissues were stored in RNAlater solution

(Qiagen, Mississauga) for subsequent RNA isolation.

Isolation of a partial coding sequence of the R. prolixus CAPA receptor gene

CAPA receptor protein sequences identified or predicted in D. melanogaster (AAS65092;

Iversen et al., 2002; Park et al., 2002), Apis mellifera (NP_001091702; Hauser et al., 2006), A.

gambiae (AAX84796; Olsen et al., 2007) and Tribolium castaneum (XP_973937; Li et al., 2008)

were aligned by ClustalW (Larkin et al., 2007) and regions of high conservation were utilized for

design of degenerate primers. A cDNA library from the upper segment of MTs was constructed

following the Creator SMART cDNA Library Synthesis kit as described previously (Paluzzi et

al., 2008). The upper MTs segment cDNA library was utilized as a template for PCR using the

CAPA receptor degenerate primers (see Appendices Table S1). Sequencing of positive

amplicons was carried out at the Centre for Applied Genomics at the Hospital for Sick Children

(MaRS Centre, Toronto, Ontario, Canada).

Rapid Amplification of cDNA Ends (RACE) PCR of the R. prolixus CAPA receptor gene

The partial sequence coding for the R. prolixus CAPA receptor gene obtained through PCR

screening of the upper MT cDNA library using degenerate primers was used to design gene-

specific primers for application in RACE PCR (see Appendices Table S2A). Total RNA from

MTs (1.5µg) was utilized for cDNA synthesis using the 5’/3’ RACE Kit according to

manufacturer instructions (Roche Applied Science, Laval, QC). The first-strand cDNA for 3’

152

RACE was synthesized using the supplied Oligo (dT) anchor primer and the 5’ RACE template

cDNA was synthesized using the gene-specific primer, capaR-5raceREV1 (see Appendices

Table S2A). A series of semi-nested PCR reactions was carried out by gene-specific primers

within the initial partial sequence to enhance the specificity and increase the yield of amplified

RACE products. After the final round of semi-nested RACE PCR, the specific products were

ligated to pGEM-T Easy vector (Promega, Madison, WI) which was used to transform bacteria

to enable downstream sequencing of individual clones. Sequencing was carried out as specified

previously (Paluzzi et al., 2008) and noted above.

Northern blot analysis

Fifth instar alimentary canals (including foregut, midgut, hindgut and MTs) were dissected and

total RNA was isolated using the SV Total RNA Isolation System (Promega, Madison, WI).

This total RNA sample was then further processed for isolation of mRNA using the PolyATtract

mRNA Isolation System III (Promega, Madison, WI). Isolated mRNA was quantified using a

NanoDrop UV Spectrophotometer and 1µg per lane was utilized for northern blot analysis as

described previously (Paluzzi and Orchard, 2010). Digoxigenin (DIG)-labeled RNA antisense

probes were synthesized by in vitro transcription as described previously (Paluzzi and Orchard,

2010) using the sense primer capaR_3raceFOR2 and antisense primer capaR_3endREV1 (see

Appendices Table S2A).

Reverse transcriptase quantitative PCR (RT-qPCR) tissue expression analysis

Fifth-instar R. prolixus fed 7-8 weeks previously as fourth-instars, were dissected under

nuclease-free PBS and tissues were transferred to RNAlater (Ambion, Austin, TX) for

subsequent RNA isolation as described above. First-strand cDNA was synthesized using 100ng

total RNA from each tissue using the iScript Select cDNA synthesis kit (Bio-Rad, Mississauga,

ON). Following cDNA synthesis, reactions were diluted five-fold using nuclease-free water and

subsequently used as template for qPCR. Primers were designed over exon-exon splice

boundaries and sense primers were designed specifically for the transcript variants of the

153

RhoprCAPA-R gene (see Appendices Table S2B) in order to differentiate expression levels

between these alternative transcripts. Quantitative PCR (qPCR) was carried out on a Mx4000

Quantitative PCR System (Stratagene, La Jolla, CA) and cycling conditions and housekeeping

control genes, rp49 and actin 5c, were used as described previously (Paluzzi and Orchard, 2010).

Primer efficiencies were determined for each target and relative expression was determined

following the delta-delta Ct method (Pfaffl, 2001) and fold-differences were normalized to either

of the housekeeping genes (noted above). Experiments were repeated for a total of three

biological replicates with two technical replicates each. Each technical replicate included a no

template control and no reverse transcriptase control to ensure absence of contaminating

template in reagents and possible genomic DNA contaminant amplification, respectively.

Preparation of mammalian expression constructs

The full-length cDNA of the two alternative transcripts of the RhoprCAPA receptor (capa-r1

and capa-r2) were amplified by primers designed at the 5’- and 3’-end (see Appendices Table

S2C) and using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Pickering, ON)

and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Migration of PCR amplified

products from individual clones during gel electrophoresis as well as sequencing of individual

clones was used to differentiate between different splice variants. These clones were

subsequently utilized as a template for a similar PCR reaction as stated above, but using primers

which spanned the complete open-reading frame and which had the 5’ non-coding sequence

modified by introducing a Kozak translation initiation sequence (see Appendices Table S2C)

required for optimal translation by eukaryotic ribosomes (Kozak, 1984; 1986; 1987). The

RhoprCAPA-R ORFs were inserted into the pcDNA 3.1+ (Invitrogen, Carlsbad, CA) for

expression in mammalian cells.

Cell line expression and functional analysis of the RhoprCAPA receptor

Transient expression of the RhoprCAPA-R gene was accomplished using a CHO-K1 cell line.

Cells were grown in complete Ham’s DMEM/F12 medium containing HEPES but no phenol red

154

(Invitrogen, Carlsbad, CA) and supplemented with 0.1% protease-free BSA, Penicillin (10

IU/mL) and Streptomycin (100µg/mL) and grown at 37ºC in 5% CO2. Each RhoprCAPA-R

transcript variant expression construct was cotransfected with a construct carrying the

cytoplasmic luminescent reporter aequorin (cyto-Aeq). Cotranfection of pcDNA3.1+- capa-r1

and pcDNA3.1+-cyto-Aeq or pcDNA3.1+- capa-r2 and pcDNA3.1+-cyto-Aeq was carried out in

serum- and antibiotic-free medium using FuGENE HD (Roche Applied Science, Indianapolis,

IN) following manufacturer guidelines and using a 3:1 DNA to transfection reagent ratio.

Approximately 36-48 hours post-transfection, cell cultures were dislodged using a PBS-EDTA

solution (137mM NaCl; 2.6mM KCl; 8.1mM Na2HPO4; 0.44mM KH2PO4; 5mM EDTA) and

were resuspended in complete Ham’s DMEM/F12 medium (~106-107 cells/mL). Prior to the

functional assay, coelenterazine h (Invitrogen, Carlsbad, CA) was added to the cell suspension at

a final concentration of 5µM and the mixture was incubated for 3-4 hours in the dark on an

automated stirrer at room temperature. Following this incubation, the mixture was diluted ten-

fold by adding additional Ham’s DMEM/F12 medium (final cell titre of 105-106 cells/mL and

0.5µM coelenterazine h) and further incubated for 45-90 minutes in the dark at room

temperature. Luminescence assays were performed in opaque 96-well microplates (Corning,

Lowell, MA) and responses were monitored using an Orion microplate luminometer complete

with an automated injector unit (Berthold Detection Systems, Huntsville, AL). Ligands at

various titers were resuspended in complete Ham’s DMEM/F12 medium (supplemented as

above) and plated in duplicate wells across the 96-well plate (see Table 1 for list of peptides used

in this study). Cells were loaded into each well using the automated injector unit and

luminescence was monitored for 20 seconds and the response normalized to the greatest positive

control response in each plate and corrected for background values obtained from wells receiving

complete Ham’s DMEM/F12 medium alone (negative control). The response for each ligand

concentration in replica wells and from at least two replica plates was averaged for analysis.

Peptides encoded by the RhoprCAPA-α gene and derived analogs were synthesized by following

methods described previously (Paluzzi et al., 2008). The source of human arginine vasopressin

(HomsaAVP) and D. melanogaster hugin γ (Dromehugγ) peptides were as described previously

(Park et al., 2002).

155

Sequence analysis of the RhoprCAPA receptor

The deduced amino acid sequence encoded by the small- and large-transcript variants of the

RhoprCAPA-R gene were analyzed for predicted membrane topology using the TMHMM Server

v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/). Using ClustalX (Larkin et al., 2007), the

sequences were compared to other known or predicted CAPA receptor sequences and pyrokinin-

1 receptors identified in other insects noted above and also including Acyrthosiphon pisum

(XP_001950333), Pediculus humanus corporis (XP_002426611), D. melanogaster (CG9918;

Cazzamali et al., 2005), A. gambiae (AY900218; Olsen et al., 2007) and Aedes aegypti

(XP_001662936). In addition, a human homologue of the insect CAPA and pyrokinin receptors,

neuromedin U receptor-2 (Q9GZQ4; Hosoya et al., 2000), was used for rooting the phylogenetic

tree derived from the multiple alignment. Using MEGA 4.02, both maximum parsimony and

neighbor joining methods were utilized, however both produced trees with highly similar

topology. The reliability of the relationships between taxa was tested using the bootstrap test

with 1000 iterations (Tamura et al., 2007).

156

Results

R. prolixus CAPA receptor

The R. prolixus capa-r gene encodes two mRNA variants, capa-r1 (GenBank accession:

GU734127) and capa-r2 (GenBank accession: GU734128), with cloned transcript sizes of

approximately 1437bp and 1344bp, respectively (Figure 1A). Northern blot hybridization

suggests the full-length transcripts may be slightly larger (Figure 1B), however this is likely an

extension of the 5’UTR since an in-frame stop signal (bases -54 to -52); Figure 1A) is present

upstream of the identified ATG translation start site. Both of these transcripts are encoded by six

exons spanning approximately 10.2kb of the genome as predicted by the R. prolixus preliminary

genome assembly (see Figure 1C). The data suggest the smaller transcript, capa-r2, is the

product of splicing of an optional intron due to cryptic splicing signals located over the second

exon sequence (see Figure 1A and 1C) that reduces the size of this exon from 282bp to 189bp

and reduces the resulting protein by 31 amino acids. The capa-r1 transcript encodes a predicted

seven transmembrane domain protein consistent with features present in G protein-coupled

receptors (GPCR) with an extracellular N-terminal sequence and intracellular C-terminal

sequence (Figure 2A). The capa-r2 transcript produces an atypical GPCR having only six

predicted hydrophobic transmembrane domains, and, in addition, both the N-terminal and C-

terminal ends are predicted to be intracellular (Figure 2B).

Sequence and phylogenetic analysis

Sequence analysis of CAPA-R1 receptor reveals features typifying the G protein-coupled

receptor super family such as seven α -helices forming transmembrane domains connecting an

extracellular N-terminus and intracellular C-terminus. In addition, the CAPA-R1 receptor

demonstrates features characteristic of the rhodopsin-like GPCRs subfamily (or family A

GPCRs). These features include a slight variation of the NSxxNPxxY motif localized to the

seventh α-helix membrane spanning domain and a D/E-R-Y/F at the border between the third

transmembrane and the second intracellular loop (Fredriksson et al., 2003). The putative atypical

157

Figure 1. Rhodnius prolixus cDNA for the CAPA receptor and deduced translation. (A)

Nucleotide and amino acid number are denoted in the left and right margins, respectively. The

predicted α-helices forming the transmembrane domains are box outlined and numbered in the

left margin adjacent to each predicted domain (TM1-7). The smaller variant (capa-r2) is

produced following alternative splicing over nucleotides 164-256 (nucleotide region underlined)

removing a portion of the second exon encoding a region spanning the first and second

transmembrane domains. (B) Northern blot showing approximate size of the RhoprCAPA-R

transcripts as determined by hybridization of alimentary canal mRNA. (C) Predicted gene

structure showing exon/intron size and location based on amplification of cDNA and comparison

with preliminary assembly of R. prolixus genome.

159

Figure 2. Predicted membrane topology of the R. prolixus CAPA receptor based on data

obtained from the TMHMM Server v. 2.0. (A) Topology probability plot for the capa-r1

receptor. Note the seven predicted transmembrane domains and the N-terminal extracellular and

C-terminal intracellular regions common of GPCRs. (B) Topology probability plot for CAPA-

R2. Note the lack of seven predicted transmembrane domains and the N-terminal and C-terminal

intracellular regions uncharacteristic of GPCRs.

161

CAPA-R2 protein lacks a region spanning between the first and second transmembrane domains,

and consequently, it does not satisfy one of the chief characteristics of the GPCR super family.

Sequence comparison of the resulting translation of capa-r1 and capa-r2 transcripts with

orthologous proteins predicted or identified in other insects revealed some interesting findings

regarding the sequence similarity among the receptors (Figure 3A). Either character-based

maximum parsimony or distance-based neighbor-joining analyses yield similar outcomes in tree

topology (neighbor-joining results are shown). A monophyletic group contains the R. prolixus

CAPA receptor sequences identified herein together with other insect CAPA receptors, while the

pyrokinin-1 receptors form a distinct clade (Figure 3B) with each having high bootstrapping

support. Interestingly, within the CAPA receptor clade, the hemimetabolous CAPA receptor

sequences are grouped within the same subclade; however, the holometabolous species

sequences do not all group together within a common subclade (Figure 3B). Instead, the CAPA

receptor sequences from A. mellifera and T. castaneum are grouped within the hemimetabolous

CAPA receptor subclade. The relationship separating the monophyletic group containing the

receptor sequences of the hemimetabolous insect representatives as well as that of A. mellifera

and T. castaneum and the group containing the Dipteran CAPA receptors is well supported with

high bootstrapping statistics. The clade consisting of the two R. prolixus receptor sequences, and

in addition, that including the D. melanogaster and A. gambiae receptor sequences, also has very

high bootstrapping support. The monophyletic group consisting of two identified pyrokinin-1

receptors from the Dipteran insects, D. melanogaster and A. gambiae as well as an unidentified

closely related receptor from A. aegypti (XP_001662936), which we classify as a pyrokinin

receptor based on sequence analysis, also has high bootstrapping support. All other relationships

among sequences were not highly supported (bootstrapping support ranging between 71-81%).

Expression pattern of CAPA receptor transcript variants

As a method to predict potential physiological targets for the R. prolixus CAPA peptides, we

investigated the spatial expression profile of the two transcript variants encoding the putative

CAPA receptor in R. prolixus. Expression of capa-r1 transcript is predominantly localized to the

alimentary canal (Figure 4A). More specifically, expression is predominantly in the MTs and the

162

Figure 3. Sequence and phylogenetic analysis of CAPA receptors in insects. (A) Protein

alignment of the insect CAPA receptors identified or predicted based on genome sequence data.

The predicted location of the seven transmembrane domains are noted above each row (TM1-

TM7). Dark gray shading denotes sequences identical in greater than 50% of that particular

column while light gray shading denotes similar residue to column-consensus residue. (B) The

phylogenetic relationship of the insect CAPA and PK-1 receptors were deduced using the

Neighbor-Joining method. Branch length units are the number of amino acid substitutions per

site. The closest human homologue to the insect CAPA receptors, the neuromedin U receptor-2,

was included in the analysis and imposed as the out group.

164

Figure 4. CAPA receptor expression profile in fifth-instar tissues. The capa-r1 transcript

expression is denoted by open columns while capa-r2 transcript expression is denoted by filled

columns. (A) Expression was detected throughout the alimentary canal. Fold difference in

expression is relative to capa-r1 expression in the hindgut. Abbreviations: central nervous

system (CNS); salivary glands (SG); male reproductive tissue (Male Repro); female reproductive

tissue (Female Repro); Posterior midgut (Post. Midgut); Anterior midgut (Ant. Midgut); trachea,

dorsal vessel, abdominal nerves, diaphragm and fat body (Tr, DV, ABN); and whole Malpighian

tubules (whole MTs). (B) Upper and lower segments of MTs were dissected and separated prior

to RNA isolation and cDNA synthesis. Fold difference in expression is shown relative to the

expression of the capa-r1 transcript in lower tubule segments.

166

anterior midgut, however, expression also exists in the oesophagus, posterior midgut and

hindgut, with the latter demonstrating lowest levels. Other tissues, such as the central nervous

system, salivary glands, reproductive tissues, trachea, fat body, dorsal vessel or abdominal

nerves, do not exhibit any detectable levels of either transcript. In all tissues where capa-r1

expression is identified, substantially lower expression of the second transcript variant, capa-r2,

is evident, with values approximately ~350-fold less relative to capa-r1 (Figure 4A and 4B). We

also were interested in analyzing the expression of the two transcript variants encoding the

putative RhoprCAPA receptor in distinct upper secretory and lower reabsorptive regions of the

MTs. The capa-r1 transcript expression is localized almost entirely to the upper lengths of the

tubules, with greater than 60-fold higher levels compared to the lower segment expression

(Figure 4B). Again, the expression of the second transcript variant, capa-r2, demonstrates

extremely low levels relative to capa-r1 (Figure 4B) consistent with the relative values identified

in other tissues where the two transcripts are expressed (see Figure 4A).

Functional ligand-receptor interaction assay

Determination of the endogenous ligand(s) for the two receptor variants was facilitated using a

calcium mobilization assay in heterologously expressed R. prolixus CAPA receptor clones in

CHO-K1 cells. Firstly, we tested the endogenously expressed peptides encoded by the

RhoprCAPA-α gene (Figure 5A). The capa-r1 clone has the greatest activity when tested with

RhoprCAPA-α2 (EC50 = 385nM). Activation of capa-r1 is also evident with the pyrokinin-

related peptide, RhoprCAPA-αPK1 (EC50 > 5µM); however at the highest dose tested, this

accounted for only a 35% activation (approximately 40-fold lower efficacy) compared to the

highest response observed with RhoprCAPA-α2. At all doses tested, the first peptide encoded in

the RhoprCAPA-α gene, RhoprCAPA-α1, did not yield any detectable activation of the capa-r1

receptor. The other receptor variant, capa-r2, was also tested against the peptides encoded by

the RhoprCAPA-α gene; however, no response can be detected against any of the three native

peptides (Figure 5B). Insect CAPA peptides normally contain the consensus C-terminal

sequence FPRV-NH2 and since the non-canonical CAPA peptide, RhoprCAPA- α1, shows no

activation of the capa-r1 receptor, we tested structural analogs (see Table 1) of this native

167

Figure 5. Heterologous expression assay of the R. prolixus CAPA receptor in CHO-K1 cells.

(A) Activity of the native RhoprCAPA-α gene products on the capa-r1 receptor variant. Dose-

response curve demonstrating activity of RhoprCAPA-α2 on the expressed capa-r1 receptor.

The pyrokinin-like peptide, RhoprCAPA-αPK1, also activates the expressed capa-r1 receptor,

but is approximately 40-fold less potent. (B) Using the same ligands on the capa-r2 receptor

variant. None of the native peptides activate capa-r2. (C) Activity of structural analogs of the

first encoded peptide of the RhoprCAPA-α gene, RhoprCAPA-α1. Activity of the RhoprCAPA-

α1∆PRV-NH2 analog closely mimics the efficacy of RhoprCAPA-α2, whereas the RhoprCAPA-

α1∆LRV-NH2 analog demonstrates an intermediate response. (D) Activity of structurally-

related non-native peptides containing the PRXamide motif. Neither human AVP nor D.

melanogaster hugγ (hugin-1) are active on the expressed capa-r1 receptor at the doses tested.

All peptides tested in (C) or (D) are inactive on the expressed capa-R2 receptor (not shown). In

each plot, vertical bars denote standard errors and all values are plotted relative to the maximum

response obtained by RhoprCAPA-α2 in cells expressing the capa-r1 receptor. For (B),

maximum response values were taken from replicate plates done in tandem but challenged with

cells expressing the capa-R1 receptor.

169

Table 1. Summary of peptides and analogs structurally related to the CAPA peptides in R.

prolixus tested in the functional expression assays.

Peptide/Analog Name Sequence EC50(M) Rhopr-

capaR1

EC50(M) Rhopr-

capaR2

RhoprCAPA-α1 SPISSVGLFPFLRA-NH2 Not active Not active

RhoprCAPA-α2 EGGFISFPRV-NH2 3.85x10-7 Not active

RhoprCAPA-αPK NGGGGNGGGLWFGPRL-

NH2

>5x10-6 Not active

RhoprCAPA-α1∆LRV-NH2 SPISSVGLFPFLRV-NH2 >5x10-6 Not active

RhoprCAPA-α1 ∆PRV-NH2 SPISSVGLFPFPRV-NH2 3.35x10-7 Not active

HomsaAVP CYFQNCPRG-NH2 Not active Not active

DromeHugin-1(hugγ) pQLQSNGEPAYRVRTPRL-

NH2

Not active Not active

170

peptide in order to identify which residues may have important roles for effective activation of

this receptor. While the native RhoprCAPA-α1 peptide is inactive on the capa-r1 receptor, the

modified analog, RhoprCAPA- α1∆LRV-NH2, with a C-terminal valine substituting the native

alanine residue, shows some activation of the capa-r1 receptor, but at the highest dose tested

(5µM), this activity is approximately 36% of the maximum response with RhoprCAPA-α2. A

second modified analog, RhoprCAPA- α1∆PRV-NH2, having the LRA-NH2 of the native

peptide substituted with the PRV-NH2 C-terminus, demonstrates complete recovery of activity

on the capa-r1 receptor (Figure 5C). In fact, at some intermediate doses (50-500nM), the

RhoprCAPA-α1∆PRV-NH2 analog has greater potency than the RhoprCAPA-α2 peptide,

although not at the highest tested concentrations (>1.25µM). Similar experiments conducted on

cell lines transfected with the capa-r2 receptor variant demonstrate that these peptides/analogs

are all inactive for calcium mobilization (data not shown). We next tested the transfected cell

line with the structurally-related peptides, human AVP (HomsaAVP) and D. melanogaster hugin

γ (Dromehugγ). Neither of these peptides were active on the capa-r1 receptor (Figure 5D), or on

the capa-r2 receptor variant (data not shown). Finally, control cells that were transfected with

empty vector showed no response when challenged with any of the peptides used in this study

(not shown), indicating that the calcium mobilization results were indeed mediated by the

transfected capa-r1 receptor and not the result of activation of any endogenous receptors in the

CHO cells.

171

Discussion

We have isolated and characterized the first anti-diuretic hormone receptor in insects. This

receptor, found in the blood-feeding Chagas’ disease vector, R. prolixus, shows high amino acid

sequence similarity to CAPA receptors identified in other insects such as D. melanogaster

(Iversen et al., 2002; Park et al., 2002), A. gambiae (Olsen et al., 2007) and T. castaneum (Li et

al., 2008) as well as putative CAPA receptors predicted or annotated in the A. pisum, P. humanus

corporis and A. mellifera genomes. The CAPA-related peptides in insects play key roles in

regulating fluid secretion by MTs. In Dipterans, these peptides are described as stimulating fluid

secretion by the principal cells of MTs (Pollock et al., 2004) by way of calcium signaling (Rosay

et al., 1997) and activation of nitric oxide synthase and soluble guanylate cyclase (Kean et al.,

2002; Pollock et al., 2004). Unlike this stimulatory effect in Dipteran MTs, the CAPA-related

peptide in R. prolixus, RhoprCAPA-α2 (-β2), acts as an inhibitor of MTs fluid secretion (Paluzzi

et al., 2008) counteracting the stimulatory effect of the diuretic hormone 5-HT, and thus is

referred to as an anti-diuretic hormone. In Dipterans, it is unknown if these peptides regulate any

other tissue in addition to the MTs. In R. prolixus, we have recently shown that the anti-diuretic

hormone, RhoprCAPA-α2 (-β2), is also a potent inhibitor of anterior midgut absorption

stimulated by 5-HT (Ianowski et al., 2010; Orchard and Paluzzi, 2009).

In this study, we show expression data for a CAPA receptor homolog in R. prolixus that

correlates with the physiological roles identified previously in the MTs (Paluzzi et al., 2008) and

anterior midgut (Ianowski et al., 2010; Orchard and Paluzzi, 2009). Interestingly, we have

identified that additional tissues that comprise the alimentary canal contain appreciable levels of

CAPA receptor expression, namely in oesophagus, posterior midgut and hindgut, suggesting

additional targets for the endogenous CAPA peptides. Future studies will investigate what

physiological roles the native CAPA peptides may facilitate at these newly identified target

tissues, but these tissues are not considered to be involved in the rapid post-prandial diuresis in

R. prolixus.

172

In previous studies where insect CAPA receptors have been identified, little data has been

presented on their spatial expression characteristics (Iversen et al., 2002; Olsen et al., 2007; Park

et al., 2002). Expression has been shown associated with the thorax and abdomen in adult D.

melanogaster (Iversen et al., 2002) and more recently, tubule-specific expression was confirmed

in A. gambiae, A. stephensi and D. melanogaster (Pollock et al., 2004). In this latter study,

attempts at amplifying an orthologous receptor from A. aegypti tubules were unsuccessful.

However, in silico attempts at identifying a CAPA receptor orthologue in the A. aegypti genome

revealed a receptor sequence sharing greatest similarity to the D. melanogaster and A. gambiae

pyrokinin receptor 1 (see Figure 3B); thus, it remains unclear if a CAPA receptor exists in this

insect. Nevertheless, CAPA receptor expression associated with tissues other than the MTs

remains elusive in insects and thus this is the first study to comprehensively examine the tissue

expression profile for this receptor type. In the MTs, we investigated whether the CAPA

receptor transcripts were differentially expressed in the upper and lower tubule segments. We

found the capa-r1 transcript level is substantially greater in the upper secretory segment of the

MTs with relatively little expression in the lower reabsorptive segment. This finding correlates

well with the profound anti-diuretic effect on upper secretory segments stimulated with 5-HT. In

the lower tubules, RhoprCAPA-α2 (-β2) does not appear to modulate reabsorption of K+ and it

remains unclear if this peptide marginally enhances reabsorption of water (Paluzzi & Ianowski,

unpublished). The reabsorption of water by the lower segment of the tubule has not been shown

by any diuretic peptides or 5-HT (Donini et al., 2008), although 5-HT does lead to K+ and Cl-

reabsorption in the lower segment (Haley and O'Donnell, 1997; Maddrell and Phillips, 1975;

O'Donnell et al., 1982). Thus, the greater than 60-fold difference in expression of capa-r1

between these functionally distinct MTs segments parallels the physiological effects previously

documented for RhoprCAPA-α2 on MTs. The effects, if any, of these peptides on the lower

segments will require further investigation. Although expression of the capa-r2 transcript was

detected in similar tissues as the capa-r1 transcript, relative expression levels are substantially

lower (approximately < 350-fold) and thus it is unclear what function, if any, the atypical GPCR

product of this transcript may hold.

173

To support the phylogenetic analysis and expression profile data suggesting the identified

receptor was a CAPA receptor homolog, we tested the receptor clones in a heterologous

expression assay. The capa-r1 expressed receptor was activated by low concentrations of

RhoprCAPA-α2; however, the first encoded peptide, RhoprCAPA-α1, does not activate the

receptor over the range of concentrations tested. This is in contrast to the result shown for

CAPA receptors in other insects where the receptors are activated more or less equally by the

first two peptides produced by the CAPA prepropeptide (Iversen et al., 2002; Olsen et al., 2007;

Park et al., 2002). However, this result is not surprising considering that the sequence of the first

peptide in each of the two R. prolixus CAPA precursors has lost the consensus CAPA peptide C-

terminal FPRV-NH2 sequence. Interestingly, the capa-r1 receptor is also activated by the native

pyrokinin-like peptide, RhoprCAPA-αPK1, although this peptide is about 40-fold less potent

than RhoprCAPA-α2. In studies on the Dipteran CAPA receptors, the pyrokinin-like peptides

encoded by their respective CAPA precursors activate distinctive pyrokinin-1 receptors and do

not activate the CAPA receptors, while the CAPA peptides have no activity on the pyrokinin-1

receptors (Cazzamali et al., 2005; Iversen et al., 2002; Olsen et al., 2007; Park et al., 2002).

Experiments testing structural analogs of the RhoprCAPA-α1 revealed that the lack of the

consensus PRV-NH2 motif is indeed responsible for the loss of activity. Structural analogs with

the consensus motif partially or fully restored demonstrate activity on the expressed capa-r1

receptor, although only the fully restored consensus analog, RhoprCAPA-α1∆PRV-NH2, had

activity closely comparable to RhoprCAPA-α2. In support of these findings, alanine-

replacement analogs of Manduca sexta CAP2b (also known as ManseCAPA-1; (Loi and Tublitz,

2004)) tested for diuretic activity in the housefly, Musca domestica, demonstrated that the C-

terminal residues are critical for biological function (Nachman and Coast, 2007). Exogenous

PRXamide peptides sharing limited structural similarity to the CAPA peptides, namely human

AVP and D. melanogaster hugin-γ peptides, did not activate the capa-r1 receptor. Similar

results regarding the specificity of the insect CAPA receptor orthologs were shown previously

with no response to mammalian AVP (Park et al., 2002) or D. melanogaster hugin-γ (Iversen et

al., 2002; Park et al., 2002). Furthurmore, the A. gambiae homolog of the hugin-γ peptide was

similarly inactive on the mosquito CAPA-receptor (Olsen et al., 2007). In contrast to the results

obtained for the R. prolixus capa-r1 receptor, all the peptides tested in this study were inactive

on the capa-r2 expressed receptor. Although such a result would be expected considering the

174

atypical predicted membrane topology of the CAPA-R2 receptor, the possibility of a functional

role for this protein cannot be dismissed. A schematic overview of the R. prolixus CAPA

neuropeptide/receptor signaling system, with emphasis of the known physiological roles for the

anti-diuretic hormone RhoprCAPA-α2, is presented (see Figure 6) based on the receptor

transcript spatial expression profile and the physiological effects previously identified (Quinlan

et al., 1997; Paluzzi and Orchard, 2006; Paluzzi et al., 2008; Ianowski et al., 2010).

The GPCR super family are very often targets of pharmaceutical research leading to treatment

for malignancies and diseases, and, it has been stated that the potential for future drug discovery

is immense considering many pharmaceuticals target only a handful of GPCRs (Fredriksson et

al., 2003). Rhodnius prolixus is a principal vector of Chagas’ disease and both sexes must gorge

on a blood meal during each nymphal stage for growth and development, and adult females

require a blood meal to increase egg production. Thus, at the level of the individual insect, the

opportunity to transmit disease can be 12 times as great compared to many mosquitoes where

only adult females will gorge on a blood meal. It has been shown that the CAPA peptide,

RhoprCAPA-α2, plays a significant role in coordinating an anti-diuretic strategy in R. prolixus

(Ianowski et al., 2010; Paluzzi et al., 2008). Potentially, the development of biologically stable

mimetic agonists or antagonists affecting the R. prolixus CAPA receptor could disrupt fluid and

salt homeostasis and overall diuresis, and thereby impede the transmission of T. cruzi infection

that occurs during the rapid post-prandial diuresis and excretion in R. prolixus.

175

Figure 6. Schematic overview of the proposed CAPA peptide/receptor signaling system in R.

prolixus. Putative target tissues and proposed in vivo roles based on CAPA receptor spatial

expression profile carried out herein and previous in vitro physiological results for RhoprCAPA-

α2 (Paluzzi and Orchard, 2006; Paluzzi et al., 2008; Ianowski et al., 2010). Adapted figure of

alimentary canal drawn by Zach McLaughlin.

177

References

Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanatides, P. G.,

Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F. et al. (2000). The Genome

sequence of Drosophila melanogaster. Science 287, 2185-2195.


(2005). The Drosophila gene CG9918 codes for a pyrokinin-1 receptor. Biochem.





N. J. and Dow, J. A. T. (1997). Neuropeptide stimulation of the nitric oxide signaling

pathway in Drosophila melanogaster Malpighian tubules. American Journal of

Physiology-Regulatory Integrative and Comparative Physiology 42, R823-R827.



Fredriksson, R., Lagerstrom, M. C., Lundin, L. G. and Schioth, H. B. (2003). The G-protein-

coupled receptors in the human genome form five main families. Phylogenetic analysis,

paralogon groups, and fingerprints. Mol. Pharmacol. 63, 1256-1272.

Haley, C. and O'Donnell, M. J. (1997). K+ reabsorption by the lower Malpighian tubule of

Rhodnius prolixus: Inhibition by Ba2+ and blockers of H+/K+-ATPases. J. Exp. Biol.

200, 139-147.

Hauser, F., Cazzamali, G., Williamson, M., Blenau, W. and Grimmelikhuijzen, C. J. (2006).

A review of neurohormone GPCRs present in the fruitfly Drosophila melanogaster and

the Honey Bee Apis mellifera. Prog. Neurobiol. 80, 1-19.

Hosoya, M., Moriya, T., Kawamata, Y., Ohkubo, S., Fujii, R., Matsui, H., Shintani, Y.,

Fukusumi, S., Habata, Y., Hinuma, S. et al. (2000). Identification and functional

178

characterization of a novel subtype of neuromedin U receptor. J. Biol. Chem. 275,

29528-29532.

Ianowski, J. P., Paluzzi, J. P., Te Brugge, V. A. and Orchard, I. (2010). The anti-diuretic

neurohormone RhoprCAPA-2 down regulates fluid transport across the anterior midgut

in the blood-feeding insect Rhodnius prolixus. Am. J. Physiol. Regul. Integr. Comp.

Physiol. 298(3), R548-57







Physiol 282, R1297-1307.

Kozak, M. (1984). Point mutations close to the AUG initiator codon affect the efficiency of

translation of rat preproinsulin in vivo. Nature 308, 241-246.

Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiator codon that

modulates translation by eukaryotic ribosomes. Cell 44, January.

Kozak, M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger

RNAs. Nucleic Acids Res. 15, 8125-8148.

Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam,

H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R. et al. (2007). Clustal W and

Clustal X Version 2.0. Bioinformatics 23, 2947-2948.



peptidomics of neuropeptides and protein hormones in the red flour beetle Tribolium

castaneum. Genome Res. 18, 113-122.



179






permeability in the Malpighian tubules of an insect, Rhodnius prolixus Stal. Proc. R.

Soc. Lond. B 216, 267-277.



Anopheles gambiae. Biochemical and biophysical research communications 362, 245-

251.

Orchard, I. (2009). Peptides and serotonin control feeding-related events in Rhodnius prolixus.






Paluzzi, J. P. and Orchard, I. (2010). A second gene encodes the anti-diuretic hormone in the

insect, Rhodnius prolixus. Mol. Cell. Endocrinol. 317, 53.







Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-

PCR. Nucleic Acids Res. 29, e45.

180



Biol. 207, 4135-4145.


Rhodnius prolixus Stal: the peptide CAP2b and cyclic GMP inhibit Malpighian tubule


Rosay, P., Davies, S. A., Yu, Y., Sozen, M. A., Kaiser, K. and Dow, J. A. (1997). Cell-type

specific calcium signaling in a Drosophila epithelium. J. Cell. Sci. 110 ( Pt 15), 1683-

1692.

Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007). MEGA4: Molecular Evolutionary

Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596-1599.


on the anterior midgut of the blood-feeding bug, Rhodnius prolixus. Gen. Comp.

Endocrinol. 162, 105-112.

181

Acknowledgments

This research was made possible through an NSERC Discovery Grant to I.O., a USDA-NRI-

CSREES 2007-35604-17759 to Y.P. and an NSERC Canada Graduate Scholarship and Michael

Smith Foreign Study Supplement to J.P.P.

182

Appendices

Table S1. Degenerate primers designed from the conserved regions of previously identified

CAPA receptors used for screening fifth instar R. prolixus upper Malpighian tubules cDNA

library.

Oligo Name Oligo Sequence (degeneracy) Amino Acid Sequence

(receptor region)

capaRfor1a1 gcnacnaaytaytayctnttytc (1024)

ATNYYLFS/NLA

(IL1-TM2 boundary)

capaRfor1a2 gcnacnaaytaytayctnttyag (1024)

capaRfor1a3 gcnacnaaytaytayctnttyaa (1024)

capaRfor1b1 gcnacnaaytaytayttrttytc (512)

capaRfor1b2 gcnacnaaytaytayttrttyag (512)

capaRfor1b3 gcnacnaaytaytayttrttyaa (512)

capaRfor2a1 ctncanathgtncgntt (768) YVSVLTIVAF

(TM3) capaRfor2a2 ttrcanathgtncgntt (384)

capaRrev1a raaraangcdatnacnacngc (768) MLS/AAVVIT/AFF

(TM6) capaRrev1b raaraantgdatnacnacngc (768)

183

Table S2. Gene-specific primers for the R. prolixus CAPA receptor. (A) Primers used for 5’ and

3’ rapid amplification of cDNA ends (RACE) of the R. prolixus CAPA-receptor. (B) Transcript-

specific primers used in quantitative reverse transcriptase PCR (RT-qPCR) to determine relative

expression of each transcript variant. (C) Primers which spanned the complete open reading

frame and which had the 5’UTR modified by introducing a Kozak translation initiation sequence

(see methods).

Oligo Name Oligo Sequence

A

5’ RACE primers:

capaRrev1 ggcaaataaagaacagtgtacagga

capaRrev2 gtagtataaattgcgaatggtgctg

capaRrev3 cctaatgatatcaaccaaagtgtgc

capaRrev4 cagaatccatgggtattgttgc

capaRrev5 ttcggcaatcctaacagtaataacac

3’ RACE primers:

capaRfor1 gcacactttggttgatatcattagg

capaRfor2 tttgcagcaccattcgc

capaRfor3 gcgccatgttgaagcag

capaRfor4 gtggaaacgtacatggagagc

capaRfor5 aatgttaatggcggtggtg

184

Table S2. (continued)

B

capa-r1 specific forward primer:

capaR1-qPCRfor tcatttctggactatttggtaatttagc

capa-r2 specific forward primer:

capaR2-qPCRfor tcatttctggactatttgtgttattactg

Common reverse primer over exon boundary:

capaR-qPCRrev gagacgtaggatgacatttctgag

C

Primers to amplify full ORF and

introduce Kozak sequence:

capaR_fullORF_for aaaagactgttaataatgaatagc

capaR_fullORF_rev aatctggtcattttaaagc

185


A modified version of the preceeding chapter was accepted for publication in Proceedings of the National Academy of Sciences (PNAS) with manuscript tracking number 2010-03666R. No permission to reproduce the paper as a part of this dissertation was required as per the PNAS author rights and permissions policy.


Isolation, expression analysis and functional characterization of the first anti-diuretic hormone receptor in insects. Paluzzi JP, Park, Y, Nachman, RJ and Orchard I. PNAS. IN PRESS (available online in the Early Edition the week of May 17, 2010)

Copyright © 2010, National Academy of Sciences, U.S.A.

186

Chapter 6:

General Discussion

187

Linking the chapters

As discussed in detail in the first chapter and throughout the subsequent chapters that comprise

this thesis, insects contain a number of neuroendocrine-derived factors that regulate the levels of

water and salts present within the haemolymph over a normal homeostatic range. This

physiologically essential mechanism allows insects to adapt to a wide array of ecological niches

and/or feeding strategies where they may be subjected to extremes in water, ion and nutrient

composition as well as intake. In many insects, the excretory system is normally composed of the

Malpighian tubules and hindgut, but in R. prolixus, the anterior midgut also plays a major role in

the rapid post-prandial diuresis (Farmer et al., 1981; Te Brugge et al., 2009). Factors that

regulate the excretory system in insects include a variety of peptide families along with biogenic

amines (Coast et al., 2002; Coast, 2009; Orchard, 2009). The focus of the research carried out

during my graduate tenure was on the isolation, characterization and physiological roles of

factors involved in the anti-diuretic strategy of the haematophagous insect, R. prolixus.

Specifically, my thesis research identified endogenous CAPA-related peptides and investigated

their role in maintenance of water and salts following the post-prandial rapid diuresis.

CAPA-related peptides have been isolated from a wide variety of insects as well as arachnids

(Predel and Wegener, 2006). Many of these peptides have been identified in great abundance

within the abdominal neurohemal organs, also known as perivisceral organs (Predel et al., 1999).

Some of these peptides have been shown to have both cardioacceleratory as well as myotropic

activity in several cockroach species (Eckert et al., 1999; Predel et al., 1995; Predel et al., 1998;

Predel et al., 2001; Wegener et al., 2001). Owing to these physiological roles and their

neurohemal release sites, these peptides have also been referred to as periviscerokinins (Eckert et

al., 1999; Predel et al., 1995; Predel et al., 1998; Predel et al., 2001; Wegener et al., 2001).

However, it is unclear if these peptides hold similar physiological roles in other insects including

R. prolixus. In addition, as I have shown in R. prolixus (Paluzzi and Orchard, 2006; Paluzzi et

al., 2008; Paluzzi and Orchard, 2010) and has been demonstrated in other insects (Kean et al.,

2002; Loi and Tublitz, 2004), these peptides are localized in other tissues in addition to the

abdominal neurohemal organs. These peptides are diuretic in Dipteran species (Pollock et al.,

188

2004), are anti-diuretic in R. prolixus (Paluzzi et al., 2008; Quinlan et al., 1997) and T. molitor

(Wiehart et al., 2002), and are without effect on diuresis in other insects. Therefore, I have

maintained the nomenclature consistent with the first CAPA-gene identification (Kean et al.,

2002; Loi and Tublitz, 2004), which confirms that these peptides are associated within the CAPA

precursor polypeptide.

Isolation and evidence of release of an anti-diuretic factor with physiogical effects similar to

ManseCAP2b

In chapter two of this dissertation (published in the Journal of Experimental Biology, 2006,

209(5): 907-15), my research identified that R. prolixus contains endogenous factors with

biological activity similar to the exogenous peptide, ManseCAP2b. This peptide was previously

demonstrated to contain potent anti-diuretic activity on R. prolixus Malpighian tubules (Paluzzi

et al., 2008; Quinlan et al., 1997). Specifically, fluid secretion by tubules stimulated with the

diuretic hormone, serotonin, were inhibited by increasing doses of ManseCAP2b (Paluzzi et al.,

2008; Quinlan et al., 1997). In addition, the intracellular second messenger cyclic GMP

(cGMP) was proposed as a putative second messenger as it also was capable of inhibiting fluid

secretion stimulated with serotonin, and in addition, was shown to increase coincident with

cessation of the rapid post-gorging diuresis (Paluzzi et al., 2008; Quinlan et al., 1997).

Malpighian tubules stimulated with serotonin had significantly decreased levels of cGMP

compared to unstimulated tubules; however, tubules receiving serotonin and ManseCAP2b did

not have cGMP levels significantly different from unstimulated tubules. Although this suggests

that cGMP may play a role in anti-diuresis in R. prolixus, the data also suggest that

ManseCAP2b may be abolishing the effect of the diuretic hormone by inactivating a cGMP-

specific phosphodiesterase (Paluzzi et al., 2008; Quinlan et al., 1997; Quinlan and O'Donnell,

1998). In my research, using a partially purified peptidergic sample from fifth instar R. prolixus

CNS, an endogenous factor, with chromatographic properties similar to ManseCAP2b, mimicked

the effects of ManseCAP2b and was capable of inhibiting fluid secretion of MTs stimulated with

serotonin and increasing levels of cGMP in MTs treated with serotonin. In addition, the results

of immunohistochemical analysis support the presence of an endogenous CAP2b-like peptide

189

since a number of cells were identified using an antibody that recognizes peptides with a carboxy

terminal PRX amide (where X = I, L, M or V)(Žitnaň et al., 2003). Importantly, control

experiments, in which the antibody was preincubated with commercially synthesized

ManseCAP2b, did not reveal any cells within the CNS (staining abolished), thus demonstrating

the specificity of the antibody. Of specific interest, three pairs of strongly staining

neurosecretory cells localized within the abdominal neuromeres along with their derived

neurohemal release sites along the proximal region of abdominal nerves 2-4, demonstrate

decreased immunohistochemical staining beginning 3-4 hours following blood meal

engorgement. This suggests that the contents of these cells are being released at a time that

coincides with the cessation of the rapid post-gorging diuresis (Maddrell, 1963; Maddrell, 1964).

Although neurosecretory axon terminals containing neurosecretory granules have been identified

associated with the MTs in R. prolixus, such a nervous supply has not been identified in other

insects (Maddrell, 1969). Immunohistochemical analyses did not detect any CAP2b-like

immunoreactivity associated with the MTs in R. prolixus, thus suggesting a neuroendocrine

regulation of this tissue by the endogenous CAP2b-related peptides. Taken together, these

results strongly suggest that the endogenous CAP2b-related peptide(s) in R. prolixus function as

potent anti-diuretic neurohormones which are released into the insect haemolymph to regulate

visceral tissues and reduce diuresis following its rapid post-gorging activation.

Identification of a gene encoding an anti-diuretic hormone in R. prolixus and analysis of cell-

specific expression in fifth instars

In chapter three of this dissertation (published in Endocrinology, 2008, 149(9): 4638-46), using a

molecular approach in conjunction with MALDI-TOF tandem mass spectrometry, my research

confirmed that R. prolixus contains a CAP2b/CAPA-related peptide, named RhoprCAPA-α2

(EGGFISFPRV-NH2), with potent anti-diuretic effects on MTs (IC50 = 4.13nM) stimulated with

serotonin. This peptide is the second encoded peptide in a transcript encoding two other

peptides. The first encoded peptide, which in other insects is also considered a CAPA peptide

due to the conserved carboxy terminal FPRV-NH2 motif (Kean et al., 2002; Loi and Tublitz,

2004), is termed RhoprCAPA-α1 (SPISSVGLFPFLRA-NH2); however, this R. prolixus peptide

190

does not contain the consensus carboxy terminus common in other CAPA peptides. The third

peptide encoded by the precursor peptide has been termed a pyrokinin in other insect CAPA

genes and generally has the consensus octapeptide carboxy terminal sequence GM/LWFGPRL-

NH2 (Kean et al., 2002; Loi and Tublitz, 2004). Therefore, this R. prolixus peptide is called

RhoprCAPA-αPK1 (NGGGGNGGGLWFGPRL-NH2). The presence of the predicted peptide

masses based on post-translation processing of the CAPA prepropeptide was confirmed by

MALDI-TOF tandem mass spectrometry of fifth instar CNS extracts semi-purified using RP-

HPLC techniques (described in Chapter 2)(Paluzzi and Orchard, 2006). Indeed, one such

peptide, RhoprCAPA-α2, was sufficiently abundant for de novo sequencing via fragmentation

and tandem mass spectrometry.

The endogenous anti-diuretic peptide, RhoprCAPA-α2, inhibits serotonin-stimulated fluid

secretion and elevates the intracellular second messenger cGMP in tubules stimulated with

serotonin; however, tubules treated with RhoprCAPA-α2 alone did not show any increase in

cGMP over saline controls, suggesting that the peptide may not directly lead to cGMP

production. Perhaps RhoprCAPAα2 abolishes the decrease in cGMP observed in tubules treated

with serotonin. Anti-diuretic peptides which do stimulate production of cGMP have been

described in T. molitor, ADF-a and ADF-b (Eigenheer et al., 2003; Eigenheer et al., 2002). Thus

it remains unclear how the anti-diuretic peptide in R. prolixus inhibits fluid secretion by MTs,

but the data suggest that cGMP is not synthesized de novo in this tissue and thus a membrane-

bound guanylate cylase / receptor is likely not involved. In T. molitor, however, a membrane

bound guanylate cyclase / receptor is suspected as the source of the cGMP elevation following

treatment with ADF-a and ADF-b (Eigenheer et al., 2003). Finally, unlike the nitric oxide (NO)

-dependent soluble guanylate cylase involved in cGMP elevation in Dipteran MTs (Pollock et

al., 2004), it has been confirmed that such a mechanism is unlikely to be involved in T. molitor

(Eigenheer et al., 2002) and R. prolixus (Quinlan et al., 1997) since data obtained with an

assortment of NO donors, NO acceptors, and NO synthase inhibitors did not modify the response

observed with these anti-diuretic peptides.

The transcript encoding this CAPA prepropeptide was detected in all post-embryonic

191

developmental stages and was predominantly localized in the CNS, and unexpectedly, albeit at

lower levels, was also detected in fifth instar testis. This latter finding suggests that this

immature male reproductive tissue may yield some or all of the peptides encoded by the R.

prolixus CAPA transcript. Although this finding was unexpected, this is not the first instance of

a peptide associated directly with male reproductive tissue. For example, in D. melanogaster, it

has been demonstrated that the male accessory gland produces and secretes a 36 amino acid

peptide, termed sex-peptide, which is transferred to females during copulation and is thought to

alter the behavior of the female (Chen et al., 1988). Such behavioural changes elicited by the

mated females include repression of sexual receptivity and stimulation of oviposition (Chen et

al., 1988). Experiments using RNAi have shown that the sex-peptide is required for the normal

magnitude and longevity of postmating behaviours by females; however, sperm transfer and

usage were normal in females mated with males having “knocked-down” sex-peptide levels

(Chapman et al., 2003). Thus, the male reproductive system in at least some insects is capable of

producing peptides which can alter the reproductive behaviour of the mated female to benefit the

reproductive success of the male. To this end, it is unclear what the role of CAPA gene

expression associated with the immature reproductive tissue may be since expression was not

detected in sexually mature adult males (see Chapter 4)(Paluzzi and Orchard, 2010). In an

attempt to identify whether fifth-instar male reproductive tissue contains biologically-active

forms of the peptides encoded by the R. prolixus CAPA gene, a crude peptidergic extract was

analyzed by mass spectrometry. Unfortunately, this approach failed to resolve any molecular

masses matching the predicted mass of peptides encoded by the R. prolixus CAPA gene;

however, future experiments could be carried out involving chromatographic purification as was

done for the CNS extracts discussed in Chapter 2 (Paluzzi and Orchard, 2006).

Using fluorescent in situ hybridization (FISH), cell-specific expression of the CAPA transcript in

R. prolixus fifth instar CNS was analyzed. This method revealed a number of cells expressing

CAPA transcript which were previously identified to contain peptides with a CAP2b-related

carboxy terminus. Interestingly, this method also clarified that not all cells having PRXamide-

like immunoreactivity were CAPA transcript expressing cells. The greatest discrepancy between

the number of cells detected for PRXamide-like immunoreactivity and CAPA transcript

192

expression was observed in the SOG. In this tissue, many more cells were detected having

PRXamide-like immunoreactivity indicating these additional cells could contain peptides

homologous to products of the D. melanogaster hugin gene (Meng et al., 2002) or the

homologous gene in Lepidopterans and other insects, which encodes the pheromone biosynthesis

activating neuropeptide (PBAN)(Bader et al., 2007a). In D. melanogaster, the hugin gene

peptides are localized to cell bodies lying in the SOG, which are involved in feeding integration

and regulation, including taste differentiation (Gerber et al., 2009; Gordon and Scott, 2009;

Morita and Shiraishi, 1985). These peptides are believed to function in modulating feeding

behavior and hugin gene expression is downregulated in starved insects (Melcher & Pankratz,

2005), whereas hugin overexpression suppresses both growth and feeding (Meng et al., 2002),

and interference of synaptic activity of hugin neurons increases feeding behavior (Melcher and

Pankratz, 2005). More recently, a cell-specific analysis in larval D. melanogaster has revealed

that the 20 cells of the hugin cluster localized to the midline of the SOG can be categorized into

four classes: eight of these neurons project to the protocerebrum, while four neurons each have

axons which project to the ventral nerve cord, ring gland, and anterior pharynx (Bader et al.,

2007b). The cells identified within the SOG in fifth instar R. prolixus that likely contain peptide

homologs of hugin/PBAN also have strongly immunoreactive axon projections. Although it is

unclear which cell each individual axon originates from (due to the very close association of

these dorsally projecting axons), projections are observed directing anteriorly into the brain,

posteriorly into the prothoracic ganglion and continuing into the MTGM where these axons

arborize in the neuropile (see Chapter 2)(Paluzzi and Orchard, 2006). This observation suggests

that a similar arrangement of cells in the SOG may coordinate feeding, growth and metabolism

in R. prolixus, as has been demonstrated in D. melanogaster (Bader et al., 2007a; Bader et al.,

2007b).

Thus, in addition to identifying a subset of cells in the R. prolixus SOG likely to contain

homologous peptides of the PBAN/hugin family in insects, I have discerned that these cells do

not contain CAPA peptides. Nonetheless, the presence of other cell bodies within the SOG,

which do express the CAPA transcript and contain CAPA peptides, suggests these peptides may

193

similarly function in modulating feeding behavior in R. prolixus, as has been shown for the hugin

peptides in D. melanogaster.

Two genes encode the anti-diuretic hormone in R. prolixus and transcripts are constitutively

expressed in the CNS during nymph-adult development

In chapter four of this dissertation (published in Molecular and Cellular Endocrinology, 2010,

317(1-2): 53-63), I describe the isolation of a second gene encoding the CAPA peptides in R.

prolixus. This CAPA gene paralog, termed RhoprCAPA-β, is predicted to encode three peptides

RhoprCAPA-β1 (SPITSIGLLPFLRAA-OH), RhoprCAPA-β2 (EGGFISFPRV-NH2), and

RhoprCAPA-βPK1 (IGGGGNGGGLWFGPRL-NH2). These peptides contain significant

structural similarity to the peptides produced by the first identified R. prolixus CAPA gene,

renamed henceforth as RhoprCAPA-α. Most highly conserved is the second encoded peptide in

each prepropeptide, which is identical in sequence, while the third encoded peptide only has a

single substitution at the amino terminal residue. Therefore, in an attempt to follow a more

intuitive nomenclature, the peptides encoded by the RhoprCAPA-α gene are now referred to as

RhoprCAPA-α1, RhoprCAPA-α2, and RhoprCAPA-αPK1 in order to distinguish their derivation

within the first gene paralog.

Insect genes encoding the CAPA peptides have been identified previously (Kean et al., 2002; Loi

and Tublitz, 2004), however the temporal expression profile has not previously been studied. In

R. prolixus, where one of the CAPA peptides, RhoprCAPA-α2(-β2), plays an integral role in

inhibiting serotonin-stimulated secretion by MTs, a hypothesis was devised to test whether the

expression of the CAPA genes may be altered by feeding. Transcript levels did not change

significantly following a blood-meal with transcript levels fluctuating within a two-fold range.

However, some interesting trends in expression revealed that the two R. prolixus CAPA paralogs

are both constitutively expressed within the CNS, with some changes that may mirror the

physiological requirements associated with fluid and ion balance. Specifically, transcript levels

appeared to have a slight decrease immediately after feeding (over the first couple of hours).

However, expression recovers thereafter and this observation may coincide with the restocking

194

of neurosecretory cells in the MTGM following release of the anti-diuretic hormone and other

CAPA peptides, which is suggested by previous temporal immunohistochemical staining

analysis (see Chapter 2)(Paluzzi and Orchard, 2006). In addition, expression analysis over a

larger time scale revealed the CAPA transcripts may be increased slightly in association with the

nymph-adult ecdysis. This change may reflect a need for the insect to ensure that sufficient

amounts of anti-diuretic peptide are available to prevent the insect from being susceptible to

desiccation during the nymph-adult ecdysis; although, admittedly, the increase/decrease in

CAPA transcripts may not coincide directly with an increase in peptide levels, since biologically-

active forms would require post-translation processing. Thus, caution must be taken in the

interpretation of these data which requires confirmatory analysis by quantification of peptide

levels in these neurosecretory cells and associated neurohemal storage sites. Perhaps a more

dramatic regulatory strategy for the R. prolixus CAPA signaling system may exist at the level of

the post-translational processing involved in biological activation of the peptides or the regulated

release from neurohemal storage sites (Paluzzi and Orchard, 2006). This latter regulatory

mechanism would be supported by the dramatic changes, over the first few hours after feeding,

in immunohistochemical staining within the abdominal neuromere neurosecretory cells and their

associated abdominal nerve neurohemal release sites. This mechanism would also ensure the

insect is always prepared with a reserve of anti-diuretic peptide in the event of an imposed stress

related to feeding, ecdysis, or extended period of starvation. In addition, considering the insect is

normally in a state of water conservation, i.e. anti-diuresis, interrupted by rapid post-gorging

diuresis, the relatively stable levels of CAPA transcripts could help satisfy the physiological

demands that the insect would face over the majority of its’ existence.

Thus, R. prolixus contains two genes which encode the CAPA-related peptides that include the

anti-diuretic peptide, RhoprCAPA-α2(-β2), which has a conserved structure in both paralogs.

This is the first report on a gene duplication within the CAPA-related peptide family in insects

and indicates that the R. prolixus CNS contains at least a greater number of CAPA-related

peptides. Based on the relatively high sequence conservation between the two R. prolixus CAPA

paralogs, and in addition, the lack of any evidence suggesting a greater cohort of CAPA-related

peptides in phytophagous Hemipteran species (Predel et al., 2006; Predel et al., 2008), this would

195

appear to be a moderately recent gene duplication event, possibly associated with a

haematophagous ancestor.

Identification of an anti-diuretic hormone receptor mediating the inhibition of fluid secretion

by MTs and fluid absorption by the anterior midgut in R. prolixus

In chapter five of this dissertation (accepted for publication in Proceedings of the National

Academy of Sciences on April 23rd, 2010), I describe the isolation, spatial expression profile and

functional characterization of the first anti-diuretic hormone receptor in insects, referred to as

RhoprCAPA-r, which is a GPCR. Two transcript variants were identified, capa-r1 and capa-r2;

however the former transcript demonstrates expression levels well over two orders of magnitude

higher than the latter. The receptor transcript was localized to tissues of the alimentary canal,

including the anterior midgut and Malpighian tubules, which are both known to be

physiologically regulated by the anti-diuretic peptide, RhoprCAPA-α2 (Ianowski et al., 2010;

Orchard and Paluzzi, 2009; Paluzzi and Orchard, 2006; Paluzzi et al., 2008). Interestingly,

however, the receptor transcript was also localized to tissues not previously known to be targets

of the anti-diuretic peptide nor to be involved in the rapid post-gorging diuresis. Thus, this

supports the suggestion that the constitutive expression of the CAPA peptide encoding genes

observed during development from fifth instar to adult stage insects (Paluzzi and Orchard, 2010)

may have a role in addition to maintenance of anti-diuresis. One could predict that the receptor

transcript expression over the numerous tissues comprising the alimentary canal may indicate the

CAPA peptides in R. prolixus may function in coordinating feeding, digestion and/or excretion.

Receptor expression associated with the MTs was investigated in greater detail to discern if the

functionally-distinct regions of the tubules, namely the upper secretory segment and lower

reabsorptive segment, elicited any differences in CAPA receptor expression. MTs were

dissected and regions were separated based on the structural morphology of the upper and lower

segments. Indeed, transcript abundance was differential between these two functionally-distinct

regions of the MTs with a greater than 60-fold level associated with the upper secretory segment

relative to the lower segment. The lower third of the lower MTs segment is the sole region

where selected ions are reabsorbed (Haley and O'Donnell, 1997; Maddrell and Phillips, 1975;

O'Donnell et al., 1982) but some defects during development may lead to the presence of isolated

196

upper segment cells sporadically localized in the lower MTs segment (Maddrell and Overton,

1985). Therefore, it remains unclear if the albeit low CAPA receptor transcript level in the lower

MTs segment is physiologically relevant or an artifact due to the occasional presence of upper

MTs segment cells localized within the lower MT segment. Nonetheless, this result supports the

major physiological role of the anti-diuretic hormone in inhibiting fluid secretion by the MTs

without playing a role in modifying the selective reabsorption of ions. This result also brings to

light the possibility that although fluid secretion by the upper MTs would be significantly

reduced (Paluzzi and Orchard, 2006; Paluzzi et al., 2008; Paluzzi and Orchard, 2010), the

absorption of KCl by the lower tubules regulated by serotonin (Haley and O'Donnell, 1997;

Maddrell and Phillips, 1975; O'Donnell et al., 1982), but not by other insect diuretic factors

(Donini et al., 2008), could continue, ensuring these essential ions are not depleted in the

haemolymph.

Phylogenetic analysis of the identified R. prolixus CAPA receptor confirms that this receptor is a

member of the CAPA receptor family in insects and the monophyletic group containing the

insect CAPA receptors is supported with high bootstrapping statistics. Importantly, the

pyrokinin-1 receptor sequences from other insects forms a sister-group to this CAPA-receptor

clade, and are known to be specifically activated by the third encoded peptide of CAPA genes in

insects (see Chapter 5), which will be of interest for future research (see below).

Functional ligand-receptor interaction analyses performed in native CHO-K1 cells demonstrate

the receptor encoded by the capa-r1 transcript has highest affinity for the anti-diuretic hormone,

RhoprCAPA-α2 (EC50 = 385nM). Surprisingly, the receptor is also activated by the pyrokinin

peptide, RhoprCAPA-αPK1; however at the highest dose tested, this led to a receptor activation

of only 35% relative to the response by an equivalent dose of RhoprCAPA-α2. As was expected,

considering the loss of the carboxy terminal consensus sequence, the first encoded peptide in the

RhoprCAPA-α gene, RhoprCAPA-α1, is not able to activate the receptor. However, structural

analogs of this peptide, which do contain the canonical CAPA carboxy terminus, are equally

potent to RhoprCAPA-α2 in activating the calcium mobilization pathway used in the

heterologous assay. Other structurally-related peptides containing a PRXamide motif were

197

tested and found not to activate the receptor for calcium mobilization. In addition, heterologous

expression of the second transcript variant capa-r2, predicted to encode an atypical GPCR, was

not activated by any of the peptides tested. In other species in which the CAPA receptors have

been identified, the first two peptides encoded by the native CAPA gene activate a single

receptor while the third encoded peptide containing a different carboxy terminal sequence,

specifically activates a unique receptor and no cross-activation of receptors has been identified.

Thus, interpretation of these heterologous assay results requires careful consideration since the

post-transcriptional processing of the receptor in the mammalian cells may not mirror that

occurring in the native insect cells. In addition, heterologous assay experiments on CHO cells

stably expressing the promiscuous G-protein (Gα16), which has a remarkable ability to couple a

wide variety of GPCRs to the calcium mobilization pathway (Offermanns and Simon, 1995), did

not facilitate any detectable calcium mobilization by any of the peptides tested. An important

point to make, however, is that heterologous expression of the R. prolixus CAPA receptor was

also attempted in HEK-293 and Drosophila S2 cells, with no detectable response with any of the

peptides tested (data not shown).

As discussed in a subsequent section and published recently (Ianowski et al., 2010), the CAPA

peptides do not appear to utilize calcium (neither intracellular, nor extracellular) in the inhibition

of fluid secretion by MTs (see below) or inhibition of fluid and ion absorption by the anterior

midgut. Therefore, the analysis of the CAPA receptor in the heterologous assay should be

investigated further, by testing in other mammalian or insect cell lines that allow the ligand-

receptor interaction to be monitored using a different reporter technology. Moreover,

physiological assays measuring the effect of RhoprCAPA-αPK1 on tissues known to be

regulated by the anti-diuretic peptide, RhoprCAPA-α2, may also help resolve the significance of

the unexpected finding involving the partial activation of an insect CAPA receptor with a

pyrokinin-related peptide.

Based on the available literature, this is the first study to isolate and functionally characterize an

endogenous anti-diuretic hormone receptor in insects. Transcript distribution throughout tissues

which comprise the alimentary canal suggest this receptor plays an important role in

198

coordinating anti-diuresis following the rapid post-gorging diuresis and may also play a broader

role in feeding, digestion and excretion. Taken together, a better understanding of the signaling

between this receptor and its’ natural ligand, RhoprCAPA-α2, may be of great importance for

interfering with Chagas’ disease transmission associated with this medically-important pest.

Integrating the whole

A model integrating the data described in this thesis with previous models on the control of

diuresis in R. prolixus is shown in Figure 1. The receptor for RhoprCAPA-α2 is expressed in the

foregut, anterior and posterior midgut, MTs and hindgut and corroborates physiological data

indicating RhoprCAPA-α2 is capable of inhibiting serotonin-stimulated fluid secretion by MTs

as well as absorption by the anterior midgut. Taken together, this data indicates that the

RhoprCAPA-α2 peptide and its cognate receptor are chiefly involved in an essential anti-diuretic

strategy ensuring the maintenance of homeostatic levels of ions and water. In addition, the

model and the thesis data also raise further questions regarding this anti-diuretic strategy which

are discussed, along with some preliminary observations, in the following section.

CAPA peptide-induced anti-diuresis in R. prolixus involves a signaling mechanism unlike that

described in D. melanogaster

As presented elsewhere in this thesis, it is obvious that the anti-diuretic peptide, RhoprCAPA-α2,

has an important role in inhibiting serotonin-stimulated fluid secretion (Paluzzi et al., 2008) by

MTs as well as absorption by the anterior midgut in fifth instar and adult R. prolixus (Ianowski et

al., 2010; Orchard and Paluzzi, 2009). However, it remains unclear how this anti-diuretic effect

is mediated since it appears to involve a mechanism that differs from that known in Dipteran

species, which involves extracellular calcium (Rosay et al., 1997), NO and cGMP (Dow et al.,

1994b). Previous studies have demonstrated that cGMP acts antagonistically to cAMP to inhibit

fluid secretion by MTs in R. prolixus (Quinlan and O'Donnell, 1998). However, although cGMP

has been suggested as a possible intracellular mediator of ManseCAP2b (Quinlan et al., 1997)

and the native anti-diuretic peptide, RhoprCAPA-α2 (Paluzzi et al., 2008), these studies have not

199

Figure 1. Schematic overview of the diuretic and anti-diuretic regulation of tissues associated

with the rapid post-prandial diuresis in R. prolixus. For the diuretic strategy (right side), known

osmotic and ionic concentrations are given as are the movements of water and ions (direction of

movement denoted by arrows) during the rapid post-prandial diuresis in R. prolixus. Data

pertaining to the diuretic regulation reviewed in Coast et al., 2002; Orchard, 2006; 2009; and

Coast, 2009. A model integrating the data discussed in this thesis is described under the anti-

diuretic strategy (left side). Adapted figure of alimentary canal drawn by Zach McLaughlin.

201

shown any evidence demonstrating cGMP synthesis above control levels. Importantly, however,

the cGMP levels of MTs in the presence of the anti-diuretic peptide and serotonin are

significantly greater than levels of MTs treated with serotonin alone. In addition, we recently

demonstrated cGMP stimulates absorption by the anterior midgut and that this absorption can be

blocked by the anti-diuretic peptide, RhoprCAPA-α2 (Ianowski et al., 2010). Thus, in the

anterior midgut, since both cAMP and cGMP are involved in the stimulation of fluid absorption,

cGMP is not involved in the inhibitory effect on absorption elicited by RhoprCAPA-α2

(Ianowski et al., 2010).

As mentioned earlier, extracellular calcium is an important component of the observed diuretic

effect of CAPA peptides in Dipteran MTs (Rosay et al., 1997). In R. prolixus, the involvement

of calcium in the anti-diuretic effect of the peptide, RhoprCAPA-α2, has not been previously

investigated. In preliminary experiments, I have assessed the ability of RhoprCAPA-α2 to

inhibit serotonin-stimulated fluid secretion by MTs in calcium-free saline and in the presence of

the calcium chelator, ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA).

The inhibitory effect of RhoprCAPA-α2 on fluid secretion of MTs stimulated with serotonin

appears to be independent of extracellular calcium.

Similarly, we have recently shown that calcium is likely not involved in the inhibitory effect of

RhoprCAPA-α2 on anterior midgut fluid absorption (Ianowski et al., 2010). Specifically, we

showed that in presence of the calcium chelators EGTA and membrane permeable BAPTA-AM,

RhoprCAPA-α2 is equally potent in evoking an inhibition of fluid absorption and ion transport.

In addition, 8-(N,N-diethylamino)octyl 3,4,5-trimethoxybenzoate hydrochloride (TMB-8), which

blocks calcium mobilization, also does not block inhibition of fluid absorption by RhoprCAPA-

α2 (Ianowski et al., 2010).

Thus, while calcium plays an integral role in facilitating the CAPA peptide-induced diuresis in

Dipteran MTs, it is evident that calcium likely does not play a role in the RhoprCAPA-α2

202

inhibition of fluid secretion by MTs and fluid absorption by the anterior midgut in R. prolixus.

However, the possible involvement of intracellular calcium in secretion inhibition by MTs needs

to be further tested.

The role of other peptides encoded by the CAPA gene in R. prolixus

Fluid secretion by the MTs and fluid absorption by the anterior midgut is inhibited by the peptide

RhoprCAPA-α2. The physiological role of the other peptides encoded by the RhoprCAPA-α

gene, RhoprCAPA-α1 and RhoprCAPA-αPK1 are less understood. It can be hypothesized that

the first encoded peptide, RhoprCAPA-α1, is likely not capable of inhibiting fluid secretion by

MTs or fluid absorption by anterior midgut since it has lost the consensus carboxy terminal

sequence required for biological activity of these peptides (Nachman and Coast, 2007). This

prediction assumes that this peptide would utilize the same receptor as it does in other insects in

which the first two peptides encoded by the CAPA gene contain the consensus carboxy terminal

sequence. However, this modified peptide may have a yet-to-be determined distinct role, and

may also utilize a unique receptor satisfying the theory of ligand-receptor coevolution (Park et

al., 2002). The same rationale stated above could be applied to the last encoded peptide,

RhoprCAPA-αPK1, since this peptide also does not contain the CAPA peptide consensus

sequence. Previous reports have confirmed that the pyrokinin-related peptides encoded by the

CAPA gene utilize distinct receptors (Iversen et al., 2002; Olsen et al., 2007; Park et al., 2002)

and likely hold different physiological roles as they are inactive in stimulating secretion in D.

melanogaster MTs (Kean et al., 2002). To address this issue in R. prolixus, serotonin-stimulated

fluid secretion needs to be measured in the presence of each of the RhoprCAPA-α gene encoded

neuropeptides. While the anti-diuretic peptide significantly decreases the serotonin-stimulated

secretion (Paluzzi et al., 2008), preliminary results show that the other RhoprCAPA-α gene

encoded peptides, RhoprCAPA-α1 and RhoprCAPA-αPK1, neither increase nor decrease the

serotonin-stimulated tubule secretion. Thus, these peptides do not appear to play a role in MTs

fluid secretion, but other potential tissue targets or physiological effects, such as a role in

modulating the ratios of secreted ions or reabsorption of ions and water by the lower MTs should

be investigated in the future. For the most part, this physiological result satisfies the observed

ligand-receptor interaction assay results obtained for the anti-diuretic hormone receptor

203

described earlier. However, at higher doses tested, the peptide RhoprCAPA-αPK1 appeared to

activate the anti-diuretic hormone receptor in the heterologous expression assay. This result

warrants a revisiting of the physiological effects mentioned earlier. Preliminary results have

indicated that, even at higher doses (5-10µM), RhoprCAPA-αPK1 has no inhibitory effect on

serotonin-stimulated MTs fluid secretion. It is unclear how RhoprCAPA-αPK1 is able to

marginally activate the anti-diuretic hormone receptor at the higher doses tested in the receptor-

ligand interaction assay. However, one could postulate the heterologous assay system allowing

the expression of this receptor does not mirror the native cellular niche and post-translational

processing of the receptor. Another possibility could be that the signaling cascade in one tissue

type may differ from another type, or that differential ligand binding could lead to different

conformational changes by the receptor leading to different cellular pathways becoming

activated. These and other possibilities may be elucidated once the other RhoprCAPA-α peptide

receptor(s) are identified and characterized in R. prolixus. In addition, future experiments could

also test the physiological role of RhoprCAPA-αPK1 (as well as RhoprCAPA-α1) on the

absorption by the anterior midgut, since this has already been shown to be an important tissue

target under the regulation of the anti-diuretic peptide, RhoprCAPA-α2. Some preliminary

experiments testing the serotonin-mediated increase in transepithelial current across the anterior

midgut suggest that the RhoprCAPA-α1 has no effect on transport of ions across this epithelium.

However, it appears RhoprCAPA-αPK1 may weakly counteract the effect of serotonin, but

additional experiments are required for confirmation. Interestingly, preliminary results suggest

that serotonin-stimulated fluid absorption by the anterior midgut is not significantly different

when RhoprCAPA-αPK1 is applied in contrast to the clear inhibitory effect elicited by

RhoprCAPA-α2 (Ianowski et al., 2010; Orchard and Paluzzi, 2009).

CAPA peptides in R. prolixus may modulate the transport machinery responsible for fluid

secretion

Finally, electrophysiological experiments are required to determine the anti-diuretic hormone

effect on the characteristic triphasic response in transepithelial potential (TEP) following

stimulation by serotonin. The characteristic triphasic response is a result of the sequential

activation of an apical Cl- channel, an apical V-type H+ ATPase and a basolateral Na+:K+:2Cl-

204

(NKCC) cotransporter (Ianowski and O'Donnell, 2001; O'Donnell and Maddrell, 1984). Data

collected thus far shows that there is a change in TEP such that the TEP is more positive in each

of the three phases in the presence of RhoprCAPA-α2, especially the third phase. This third

phase has been attributed to the effect of the basolateral NKCC which allows movement of Na+,

K+ and Cl- ions into the cells (Ianowski and O'Donnell, 2001; O'Donnell and Maddrell, 1984).

Thus, although no definitive conclusions can be drawn from this preliminary data, these results

suggest that the system involved in the transepithelial transport across the MTs may be a target

of the inhibitory pathway activated by RhoprCAPA-α2. It has been argued that the CAPA

peptide-induced signaling cascade in principal cells of D. melanogaster MTs activates an apical

vacuolar-type H+ ATPase which acidifies the tubule lumen and energizes a cation/proton

exchanger on the apical membrane (Dow et al., 1994a; Dow et al., 1994b; Dow and Davies,

2003; Wieczorek et al., 1991). Thus, it is obvious this family of peptides is capable of

modulating the transport machinery in other insects; albeit in R. prolixus, this involves different

intracellular signaling pathways and the exact targets of the transport machinery are yet to be

revealed.

Future directions

The identification of the native peptide involved in coordinating anti-diuresis in R. prolixus is an

important step in better understanding how this insect ensures that desiccation is avoided

following the rapid post-prandial diuresis and other potentially stressful events such as ecdysis.

In addition, the isolation and characterization of a receptor, which is involved in mediating the

anti-diuretic response, confirms the requirement for strict regulation of tissues in regulating the

bulk removal of excess water and salts following engorgement of a blood meal. Arising from

findings of this thesis is the potential for the anti-diuretic peptide, RhoprCAPA-α2, to modulate

the activity of other visceral tissues that are not involved in the rapid diuresis following feeding

(Coast et al., 2002; Coast, 2009). The physiological role of this peptide on the foregut, posterior

midgut and hindgut may be important at times when the blood meal is being digested and

nutrients are required for ongoing development or fulfillment of energy demands. In addition, a

myomodulatory role could help in mixing the luminal contents of the gut tissues as well as the

205

haemolymph. Thus, experiments should be carried out to investigate this potential

myomodulatory role in R. prolixus, since such an effect has been demonstrated by structurally-

related peptides in other insects (Predel and Wegener, 2006). I have shown that the second

messenger pathway triggered by the anti-diuretic peptide differs substantially from that known

for homologous peptides in Diptera (Pollock et al., 2004) which have diuretic actions; however,

the identity of the endogenous intracellular targets remains unresolved. Thus, future studies

should focus specifically on elucidating these factors within R. prolixus as this may serve as an

important model for anti-diuresis in other insects. Extensive studies on the rapid post-gorging

diuresis in R. prolixus have revealed this insect to contain at least two diuretic hormones (Aston

and White, 1974; Lange et al., 1989; Maddrell et al., 1991; Orchard, 2009; Te Brugge and

Orchard, 2002; Te Brugge et al., 2002). The biogenic amine, serotonin, has been extensively

utilized in this thesis to test against the CAPA peptides, however, the peptidergic CRF-related

peptide, RhoprDH, which has now been identified (Te Brugge & Orchard, personal

communication), has not yet been tested against the CAPA peptides. However, with the

availability of the native diuretic peptide, this experiment can be performed and will undoubtedly

be useful in further supporting the role of RhoprCAPA-α2 in coordinating anti-diuresis in R.

prolixus.

I have also commenced investigation of the physiological relevance of other CAPA gene-

encoded peptides; however, no obvious effect has been noted in fluid secretion by MTs or fluid

absorption by the anterior midgut. The pyrokinin-related RhoprCAPA-αPK1 may have a

stimulatory role on visceral muscle tissues similar to other pyrokinins (Holman et al., 1986;

Predel et al., 1997; Predel and Nachman, 2001) although much less is known regarding the

physiological effect of the pyrokinin-related peptides encoded by CAPA genes in insects.

Nonetheless, puparial contraction in the flesh fly, Sarcophaga bullata has been shown to be

accelerated by members of the CAPA gene pyrokinin-related peptides (Zdarek et al., 2004). A

subsequent study, however, suggested that the likely true pupariation factor in a related species,

Neobellieria bullata, was a pyrokinin peptide that does not share substantial sequence homology

to the CAPA gene derived pyrokinin-related peptides (Nachman et al., 2006). Instead, it is likely

represented by a peptide derived from a hugin homologous gene (Verleyen et al., 2004). Thus,

206

an important feat to be achieved is the spatial tissue-specific distribution of the endogenous

pyrokinin receptors in insects, some of which have already been identified (Cazzamali et al.,

2005; Olsen et al., 2007; Park et al., 2002; Rosenkilde et al., 2003; Watanabe et al., 2007).

Obviously, this would also be of great importance in R. prolixus as this may provide some

evidence pertaining to the physiological roles of the CAPA gene-derived pyrokinins in this

insect. Outside the scope of this thesis, I have commenced in silico screening of the preliminary

genome assembly of R. prolixus in attempts to isolate the endogenous pyrokinin receptors, and

this will be a focus of my post-doctoral research.

In addition to the anti-diuretic hormone encoded by the CAPA genes, it is of great interest to

explore the possibility of other peptides acting to regulate and maintain anti-diuresis in R.

prolixus. Such examples of non-CAPA-related peptides regulating anti-diuresis have been

established in other insects such as the ADF peptides in T. molitor (Eigenheer et al., 2003;

Eigenheer et al., 2002), and I have found in silico evidence suggesting the presence of

structurally-related peptides in R. prolixus, which I will pursue during my post-doctoral research.

One final and possibly least understood phenomenon regarding anti-diuresis in R. prolixus is its

initiation. I have demonstrated that the two genes encoding the anti-diuretic peptide in R.

prolixus are constitutively expressed, but do not undergo any major changes in transcript

abundance associated with feeding and the rapid diuresis that follows. However, my early

experiments using time-course immunohistochemical analysis revealed that the contents of the

neurosecretory cells and their associated neurohemal release sites within the MTGM are

significantly depleted at a time which coincides with the cessation of the rapid post-prandial

diuresis. Thus, this suggests that these cells receive a signal which ultimately leads to their

contents’ release into the haemolymph. Abdominal distension leading to activation of stretch

receptors are believed to be involved in activating the diuretic response in R. prolixus (Maddrell,

1964); however, such a mechanism has been argued not to be involved in triggering anti-diuresis

due to the change in properties of the cuticle associated with plasticization (Quinlan et al., 1997).

The activation of the CAPA peptide-containing cells likely involves a central neurochemical that

207

has perhaps already been identified in other insects (and possibly even R. prolixus), but has not

yet been associated with this function in R. prolixus. Thus, since the overwhelming majority of

these signaling molecules utilize receptors belonging to the seven transmembrane (GPCR) super

family, the localization of these receptors may provide clues that help identify the signaling

cascade synchronizing anti-diuresis in R. prolixus. The completion and annotation of the R.

prolixus genome should yield excellent opportunities to test candidate factors for their potential

involvement in activating anti-diuresis in this medically-important insect.

208

References

Aston, R. J. and White, A. F. (1974). Isolation and purification of the diuretic hormone from

Rhodnius prolixus. J. Insect Physiol. 20, 1673-1682.

Bader, R., Wegener, C. and Pankratz, M. J. (2007a). Comparative neuroanatomy and

genomics of hugin and pheromone biosynthesis activating neuropeptide (PBAN). Fly (Austin) 1,

228-231.

Bader, R., Colomb, J., Pankratz, B., Schröck, A., Stocker, R. F. and Pankratz, M. J.

(2007b). Genetic dissection of neural circuit anatomy underlying feeding behavior in

Drosophila: Distinct classes of hugin-expressing neurons. J. Comp. Neurol. 502, 848-856.


(2005). The Drosophila gene CG9918 codes for a pyrokinin-1 receptor. Biochem. Biophys. Res.

Commun. 335, 14-19.

Chapman, T., Bangham, J., Vinti, G., Seifried, B., Lung, O., Wolfner, M. F., Smith, H. K.

and Partridge, L. (2003). The sex peptide of Drosophila melanogaster: Female post-mating

responses analyzed by using RNA interference. Proceedings of the National Academy of

Sciences of the United States of America 100, 9923-9928.

Chen, P. S., Stumm-Zollinger, E., Aigaki, T., Balmer, J., Bienz, M. and Böhlen, P. (1988). A

male accessory gland peptide that regulates reproductive behavior of female D. melanogaster.

Cell 54, 291-298.

Coast, G. (2009). Neuroendocrine control of ionic homeostasis in blood-sucking insects. J. Exp.

Biol. 212, 378.



209



Dow, J. A., Maddrell, S. H., Grtz, A., Skaer, N. J., Brogan, S. and Kaiser, K. (1994a). The

Malpighian tubules of Drosophila melanogaster: A novel phenotype for studies of fluid secretion

and its control. J. Exp. Biol. 197, 421.

Dow, J. A., Maddrell, S. H., Davies, S. A., Skaer, N. J. and Kaiser, K. (1994b). A novel role

for the nitric oxide-cGMP signaling pathway: The control of epithelial function in Drosophila.

Am. J. Physiol. Regul. Integr. Comp. Physiol. 266, R1716-1719.

Dow, J. A. T. and Davies, S. A. (2003). Integrative physiology and functional genomics of

epithelial function in a genetic model organism. Physiol. Rev. 83, 687-729.

Eckert, M., Predel, R. and Gundel, M. (1999). Periviscerokinin-like immunoreactivity in the

nervous system of the American cockroach. Cell Tissue Res. 295, 159.


and Schooley, D. A. (2003). Isolation, identification and localization of a second beetle anti-

diuretic peptide. Peptides 24, 27-34.


potent anti-diuretic factor acting on beetle Malpighian tubules. Proceedings of the National

Academy of Sciences 99, 84-89.

Farmer, J., Maddrell, S. H. P. and Spring, J. H. (1981). Absorption of fluid by the midgut of

Rhodnius. J. Exp. Biol. 94, 301-316.

Gerber, B., Stocker, R. F., Tanimura, T. and Thum, A. S. (2009). Smelling, tasting, learning:

Drosophila as a study case. Results Probl. Cell Differ. 47, 139-185.

Gordon, M. D. and Scott, K. (2009). Motor control in a Drosophila taste circuit. Neuron 61,

373-384.

210

Haley, C. and O'Donnell, M. J. (1997). K+ reabsorption by the lower Malpighian tubule of

Rhodnius prolixus: Inhibition by Ba2+ and blockers of H+/K+-ATPases. J. Exp. Biol. 200, 139-

147.

Holman, G. M., Cook, B. J. and Nachman, R. J. (1986). Primary structure and synthesis of a

blocked myotropic neuropeptide isolated from the cockroach, Leucophaea maderae.

Comparative biochemistry and physiology.C, Comparative pharmacology and toxicology 85,

219.

Ianowski, J. P. and O'Donnell, M. J. (2001). Transepithelial potential in Malpighian tubules of

Rhodnius prolixus: Lumen-negative voltages and the triphasic response to serotonin. J. Insect

Physiol. 47, 411-421.

Ianowski, J. P., Paluzzi, J., Te Brugge, V. A. and Orchard, I. (2010). The anti-diuretic

neurohormone RhoprCAPA-2 downregulates fluid transport across the anterior midgut in the

blood-feeding insect Rhodnius prolixus. Am. J. Physiol. Regul. Integr. Comp. Physiol. 298,

R548-557.





A., Veenstra, J. A. and Dow, J. A. T. (2002). Two nitridergic peptides are encoded by the gene

capability in Drosophila melanogaster. Am J Physiol Regul Integr Comp Physiol 282, R1297-

1307.


associated with feeding in the bloodsucking bug, Rhodnius prolixus. J. Insect Physiol. 35, 393-

&.



211

Maddrell, S. H. and Overton, J. A. (1985). Maintenance of function in single epithelial cells

spatially isolated from similar cells. J. Embryol. Exp. Morphol. 90, 409.

Maddrell, S. H. (1963). Excretion in blood-sucking bug, Rhodnius prolixus Stal .1. Control of

diuresis. J. Exp. Biol. 40, 247-256.

Maddrell, S. H. (1964). Excretion in blood-sucking bug Rhodnius prolixus Stal .3. Control of

release of diuretic hormone. J. Exp. Biol. 41, 459-472.

Maddrell, S. H. (1969). Secretion by Malpighian tubules of Rhodnius . Movements of ions and

water. J. Exp. Biol. 51, 71-&.





Melcher, C. and Pankratz, M. J. (2005). Candidate gustatory interneurons modulating feeding

behavior in the Drosophila Brain. PLoS Biol 3, e305.

Meng, X., Wahlström, G., Immonen, T., Kolmer, M., Tirronen, M., Predel, R., Kalkkinen,

N., Heino, T. I., Sariola, H. and Roos, C. (2002). The Drosophila hugin gene codes for

myostimulatory and ecdysis-modifying neuropeptides. Mech. Dev. 117, 5-13.

Morita, H. and Shiraishi, A. (1985).Comprehensive Insect Physiology, Biochemistry, and

Pharmacology (ed. G. A. Kerkut and L. I. Gilbert), pp. 133-165. Oxford ; New York: Pergamon

Press.

Nachman, R. J., Strey, A., Zubrzak, P. and Zdarek, J. (2006). A comparison of the

pupariation acceleration activity of pyrokinin-like peptides native to the flesh fly: Which peptide

represents the primary pupariation factor? Peptides 27, 527-533.



212


permeability in the Malpighian tubules of an insect, Rhodnius prolixus Stal. Proc. R. Soc. Lond.

B 216, 267-277.

O'Donnell, M. J. and Maddrell, S. H. P. (1984). Secretion by the Malpighian tubules of

Rhodnius prolixus Stal - electrical events. J. Exp. Biol. 110, 275-290.

Offermanns, S. and Simon, M. I. (1995). Gα15 and Gα16 couple a wide variety of receptors to

phospholipase C. Journal of Biological Chemistry 270, 15175-15180.



Anopheles gambiae. Biochemical and biophysical research communications 362, 245-251.

Orchard, I. (2009). Peptides and serotonin control feeding-related events in Rhodnius prolixus.






Paluzzi, J. P. and Orchard, I. (2010). A second gene encodes the anti-diuretic hormone in the

insect, Rhodnius prolixus. Mol. Cell. Endocrinol. 317, 53.







213


(2004). Conservation of capa peptide-induced nitric oxide signaling in Diptera. J. Exp. Biol. 207,

4135-4145.

Predel, R., Eckert, M. and Holman, G. M. (1999). The unique neuropeptide pattern in

abdominal perisympathetic organs of insects. Ann. N. Y. Acad. Sci. 897, 282.

Predel, R., Linde, D., Rapus, J., Vettermann, S. and Penzlin, H. (1995). Periviscerokinin

(Pea-PVK): a novel myotropic neuropeptide from the perisympathetic organs of the American

cockroach. Peptides 16, 61.

Predel, R., Rapus, J., Eckert, M., Holman, G. M., Nachman, R. J., Wang, Y. and Penzlin,

H. (1998). Isolation of periviscerokinin-2 from the abdominal perisympathetic organs of the

American cockroach, Periplaneta americana. Peptides 19, 801-809.


(2006). Identification of the rirst neuropeptides from the CNS of Hemiptera: CAPA peptides of

the southern green stinkbug Nezara viridula (L.). Peptides 27, 2670-2677.

Predel, R., Russell, W. K., Russell, D. H., Lopez, J., Esquivel, J. and Nachman, R. J. (2008).

Comparative peptidomics of four related Hemipteran species: pyrokinins, myosuppressin,

corazonin, adipokinetic hormone, sNPF, and periviscerokinins. Peptides 29, 162-167.

Predel, R., Kellner, R., Kaufmann, R., Penzlin, H. and Gäde, G. (1997). Isolation and

structural elucidation of two pyrokinins from the retrocerebral complex of the American

cockroach. Peptides 18, 473-478.

Predel, R. and Nachman, R. J. (2001). Efficacy of native FXPRLamides (pyrokinins) and

synthetic analogs on visceral muscles of the American cockroach. J. Insect Physiol. 47, 187-193.

Predel, R., Nachman, R. J. and Gade, G. (2001). Myostimulatory neuropeptides in

cockroaches: Structures, distribution, pharmacological activities, and mimetic analogs. J. Insect

Physiol. 47, 311-324.

214


63, 2477-2490.


Rhodnius prolixus Stal: The peptide CAP2b and cyclic GMP inhibit Malpighian tubule fluid

secretion. J Exp Biol 200, 2363-2367.


Rhodnius prolixus Stal: Antagonistic actions of cAMP and cGMP and the role of organic acid

transport. Journal of Insect Physiology 44, 561-568.

Rosay, P., Davies, S. A., Yu, Y., Sozen, M. A., Kaiser, K. and Dow, J. A. (1997). Cell-type

specific calcium signaling in a Drosophila epithelium. J. Cell. Sci. 110 ( Pt 15), 1683-1692.

Rosenkilde, C., Cazzamali, G., Williamson, M., Hauser, F., Søndergaard, L., DeLotto, R.

and Grimmelikhuijzen, C. J. P. (2003). Molecular cloning, functional expression, and gene

silencing of two Drosophila receptors for the Drosophila neuropeptide pyrokinin-2. Biochem.





on the anterior midgut of the blood-feeding bug, Rhodnius prolixus. Gen. Comp. Endocrinol.

162, 105-112.



Verleyen, P., Clynen, E., Huybrechts, J., Van Lommel, A., Vanden Bosch, L., De Loof, A.,

Zdarek, J. and Schoofs, L. (2004). Fraenkel's pupariation factor identified at last. Dev. Biol.

273, 38-47.

215

Watanabe, K., Hull, J. J., Niimi, T., Imai, K., Matsumoto, S., Yaginuma, T. and Kataoka,

H. (2007). FXPRL-amide peptides induce ecdysteroidogenesis through a G-protein coupled

receptor expressed in the prothoracic gland of Bombyx mori. Mol. Cell. Endocrinol. 273, 51-58.

Wegener, C., Linde, D. and Eckert, M. (2001). Periviscerokinins in cockroaches: Release,

localization, and taxon-specific action on the hyperneural muscle. Gen. Comp. Endocrinol. 121,

1-12.

Wieczorek, H., Putzenlechner, M., Zeiske, W. and Klein, U. (1991). A vacuolar-type proton

pump energizes K+/H+ antiport in an animal plasma membrane. Journal of Biological

Chemistry 266, 15340-15347.

Wiehart, U. I. M., Nicolson, S. W., Eigenheer, R. A. and Schooley, D. A. (2002). Antagonistic

control of fluid secretion by the Malpighian tubules of Tenebrio molitor: Effects of diuretic and

anti-diuretic peptides and their second messengers. J Exp Biol 205, 493-501.

Zdarek, J., Verleyen, P., Mares, M., Doleckov, L. and Nachman, R. (2004). Comparison of

the effects of pyrokinins and related peptides identified from arthropods on pupariation

behaviour in flesh fly (Sarcophaga bullata) Larvae (Diptera: Sarcophagidae). J. Insect Physiol.

50, 233.

Žitnaň, D., Zitnanova, I., Spalovska, I., Takac, P., Park, Y. and Adams, M. E. (2003).

Conservation of ecdysis-triggering hormone signaling in insects. J. Exp. Biol. 206, 1275-1289.

Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii...

Documents

Transcript of Anti-diuresis in the Blood-Gorging Bug, Rhodnius prolixus the Role … · 2011-04-18 · iii...