ORIGINAL ARTICLE

Anatomical and molecular characterization of dopamine D1receptor-expressing neurons of the mouse CA1 dorsalhippocampus

Emma Puighermanal1,2,3 • Laura Cutando1,2,3 • Jihane Boubaker-Vitre1,2,3 •

Eve Honore1,2,3 • Sophie Longueville4,5,6 • Denis Herve4,5,6 • Emmanuel Valjent1,2,3

Received: 2 August 2016 /Accepted: 15 September 2016 / Published online: 27 September 2016

� The Author(s) 2016. This article is published with open access at Springerlink.com

Abstract In the hippocampus, a functional role of dopa-

mine D1 receptors (D1R) in synaptic plasticity and mem-

ory processes has been suggested by electrophysiological

and pharmacological studies. However, comprehension of

their function remains elusive due to the lack of knowledge

on the precise localization of D1R expression among the

diversity of interneuron populations. Using BAC trans-

genic mice expressing enhanced green fluorescent protein

under the control of D1R promoter, we examined the

molecular identity of D1R-containing neurons within the

CA1 subfield of the dorsal hippocampus. In agreement with

previous findings, our analysis revealed that these neurons

are essentially GABAergic interneurons, which express

several neurochemical markers, including calcium-binding

proteins, neuropeptides, and receptors among others.

Finally, by using different tools comprising cell type-

specific isolation of mRNAs bound to tagged-ribosomes,

we provide solid data indicating that D1R is present in a

large proportion of interneurons expressing dopamine D2

receptors. Altogether, our study indicates that D1Rs are

expressed by different classes of interneurons in all layers

examined and not by pyramidal cells, suggesting that CA1

D1R mostly acts via modulation of GABAergic

interneurons.

Keywords Dopamine D1 receptor � BAC transgenic mice �Interneurons � Hippocampus � RiboTag mice

Abbreviations

Cx Cortex

DG Dentate gyrus

cc Corpus callosum

s.o. Stratum oriens

s.p. Stratum pyramidale

s.r. Stratum radiatum

s.l. Stratum lucidum

s.l.-m. Stratum lacunosum-moleculare

s.m. Stratum moleculare

o-s.m. Outer two thirds of the stratum moleculare

i-s.m. Inner-third of the stratum moleculare

s.gr. Stratum granulosum

h Hilus

EGFP Enhanced green fluorescent protein

HA Hemagglutinin

CB Calbindin-D28k

CR Calretinin

PV Parvalbumin

NPY Neuropeptide Y

SOM Somatostatin

nNOS Neuronal nitric oxide synthase

RLN Reelin

VGLUT3 Vesicular glutamate transporter type 3

D1R Dopamine D1 receptor

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00429-016-1314-x) contains supplementarymaterial, which is available to authorized users.

& Emmanuel Valjent

emmanuel.valjent@igf.cnrs.fr;

emmanuel.valjent@gmail.com

1 CNRS UMR 5203, Institut de Genomique Fonctionnelle, 141

rue de la Cardonille, 34094 Montpellier Cedex 05, France

2 INSERM, U1191, Montpellier 34094, France

3 Universite de Montpellier, UMR 5203, Montpellier 34094,

France

4 Inserm, UMR-S 839, 75005 Paris, France

5 Universite Pierre et Marie Curie-Paris 6, 75005 Paris, France

6 Institut du Fer a Moulin, 75005 Paris, France

123

Brain Struct Funct (2017) 222:1897–1911

DOI 10.1007/s00429-016-1314-x

D2R Dopamine D2 receptor

CB1R Cannabinoid type 1 receptor

mGluR1a Metabotropic glutamate receptor type 1a

Introduction

Beside its crucial role in encoding reward-related events

(Schultz 2016), dopamine (DA) also processes salient/non-

rewarding signals (Bromberg-Martin et al. 2010). This

functional diversity is underlined by the molecular, elec-

trophysiological, and projection-specific heterogeneity of

midbrain DA neurons (Lammel et al. 2012; Poulin et al.

2014). For instance, the activation of DA neurons pro-

jecting to the lateral shell of the nucleus accumbens trig-

gers reward-associated behaviors while those innervating

the medial prefrontal cortex control aversion (Lammel

et al. 2012; Poulin et al. 2014). The optimal processing of

both rewarding and aversive events also relies on the

ability of properly using contextual information (Lisman

and Grace 2005). In this context, numerous evidence

indicate that midbrain DA neurons projecting to the dorsal

hippocampus are activated when animals are exposed to

novel environment (Horvitz et al., 1997; Ljungberg et al.,

1992), thereby facilitating the encoding of novel contextual

cues associated with rewards or potential threats (Brom-

berg-Martin et al. 2010).

Tract-tracing studies indicate that in the dorsal hip-

pocampus DA neurons originating from the ventral

tegmental area (VTA) preferentially innervate CA1 sub-

fields (Broussard et al. 2016; Gasbarri et al. 1997; McNa-

mara et al. 2014; Rosen et al. 2015). Within this area, DA

through the stimulation of D1-like receptors has been

shown to regulate aversive contextual learning (Broussard

et al. 2016; Furini et al. 2014; Heath et al. 2015; Rossato

et al. 2009), object-place configuration learning (Furini

et al. 2014; Lemon and Manahan-Vaughan 2006) and

strength new spatial memories (Bethus et al. 2010;

McNamara et al. 2014).

The localization of D1R in the CA1 subfield has been

for a long time elusive. Drd1a-EGFP BAC transgenic mice

represent a valuable tool to address this issue (Valjent et al.

2009). The analysis of GFP-positive cells indicates that

D1R-expressing neurons populate all CA1 layers and

express GAD67, a marker of GABAergic interneurons

(Gangarossa et al., 2012). However, the identity of D1R-

expressing CA1 GABAergic interneurons among the

thirty-seven distinct types identified remains unknown

(Wheeler et al. 2015; http://www.hippocampome.org). We

therefore conducted a careful examination of the molecular

identity of GFP-expressing neurons in the CA1 subfield of

Drd1a-EGFP mice.

Materials and methods

Mouse mutants

Male and female, 8–12-week old, Drd1a-EGFP (n = 11

C57BL/6N background, founder S118), Drd2-Cre (C57BL/

6J background, founder ER44) heterozygous mice and

RiboTag:loxP [The Jackson Laboratory, (Sanz et al.,

2009)] were used in this study. BAC Drd1a-EGFP and

Drd2-Cre mice were generated by GENSAT (Gene

Expression Nervous System Atlas) at the Rockefeller

University (New York, NY, USA) (Gong et al. 2003).

Homozygous RiboTag female mice were crossed with

heterozygous Drd2-Cre male mice to generate Drd2-

Cre::RiboTag mice (Puighermanal et al., 2015). Animals

were maintained in a 12 hour light/dark cycle, in

stable conditions of temperature and humidity, with food

and water ad libitum. All experiments were in accordance

with the guidelines of the French Agriculture and Forestry

Ministry for handling animals (authorization number/li-

cense D34-172-13).

Tissue preparation and immunofluorescence

Mice were rapidly anaesthetized with pentobarbital

(500 mg/kg, i.p., Sanofi-Aventis, France) and transcar-

dially perfused with 4 % (weight/vol.) paraformaldehyde

in 0.1 M sodium phosphate buffer (pH 7.5) (Bertran-

Gonzalez et al. 2008). Brains were post-fixed overnight in

the same solution and stored at 4 �C. Thirty-lm thick

sections were cut with a vibratome (Leica, France) and

stored at -20 �C in a solution containing 30 % (vol/vol)

ethylene glycol, 30 % (vol/vol) glycerol, and 0.1 M

sodium phosphate buffer, until they were processed for

immunofluorescence. Hippocampal sections were identi-

fied using a mouse brain atlas and sections comprised

between -1.34 and -2.06 mm from bregma were included

in the analysis (Franklin and Paxinos 2007). Sections were

processed as follows: free-floating sections were rinsed

three times 10 minutes in Tris-buffered saline (50 mM

Tris–HCL, 150 mM NaCl, pH 7.5). After 15 minutes

incubation in 0.2 % (vol/vol) Triton X-100 in TBS, sec-

tions were rinsed in TBS again and blocked for 1 hour in a

solution of 3 % BSA in TBS. Finally, they were incubated

72 hours at 4 �C in 1 % BSA, 0.15 % Triton X-100 with

the primary antibodies (Table 1). Sections were rinsed

three times for 10 minutes in TBS and incubated for

45–60 minutes with goat Cy2-, Cy3- and Cy5-coupled

(1:400, Jackson Immunoresearch) and/or goat alexafluor

488 (1:400, Life Technologies). Sections were rinsed for

10 minutes twice in TBS and twice in Tris-buffer (1 M, pH

1898 Brain Struct Funct (2017) 222:1897–1911

123

7.5) before mounting in 1,4-diazabicyclo-[2. 2. 2]-octane

(DABCO, Sigma-Aldrich).

Confocal microscopy and image analysis were carried

out at the Montpellier RIO Imaging Facility. Images

covering the entire dorsal hippocampus were single con-

focal sections acquired using sequential laser scanning

confocal microscopy (Zeiss LSM780). Double-labeled

images from each region of interest were single section

obtained using sequential laser scanning confocal micro-

scopy (Zeiss LSM780). Photomicrographs were obtained

with the following band-pass and long-pass filter setting:

alexafluor 488/Cy2 (band pass filter: 505–530), Cy3 (band

pass filter: 560–615) and Cy5 (long-pass filter 650). Fig-

ure 1, 2, 3, 4, and 5: GFP labeled neurons were pseudo-

colored cyan and markers immunoreactive neurons were

pseudocolored magenta. From the overlap of cyan and

magenta, double-labeled neurons appeared white. Fig-

ure 4: GFP- and VGLUT3-labeled neurons were pseudo-

colored cyan and magenta and CB1R-positives fibers were

pseudocolored yellow. Images used for quantification

were all single confocal sections. GFP- and markers-pos-

itive cells were manually counted in the CA1 area taking

into account the laminar location. Cells were considered

positive for a given marker only when the nucleus was

clearly visible. Adjacent serial sections were never coun-

ted for the same marker to avoid any potential double

counting of hemisected neurons. Values in the histograms

in Figures represent the co-expression as percentage of

GFP-positive cells (darkened color) and as percentage of

cells expressing the various markers tested in each laminar

location in the CA1 subfield (6–12 hemispheres, n = 3–4

mice). Total numbers of GFP- and marker-positive cells

counted are reported in Table 2.

Polyribosome immunoprecipitation

HA-tagged-ribosome immunoprecipitation was performed

as described previously (Sanz et al. 2009) with slight

modifications. The hippocampus from Drd2-Cre::RiboTag

mice was homogenized by douncing in 1-ml polysome

buffer (50 mM Tris, pH 7.4, 100 mM KCl, 12 mM MgCl2,

and 1 % NP-40 supplemented with 1 mM DTT, 1 mg/ml

heparin, 100 lg/ml cycloheximide, 200 U/ml RNAseOUT,

and protease inhibitor mixture). Samples were then cen-

trifuged at 10,0009g for 10 minutes to collect the post-

mitochondrial supernatant. Then, 100 ll of each

supernatant was transferred to a new tube serving as input

fraction for validation. Anti-HA antibody (5 ll/sample;

Covance, #MMS-101R) was added to the remaining

supernatant and incubated overnight at 4 �C with constant

gently rotation. The following day, samples were added to

protein G magnetic beads (Invitrogen, #100.04D) and

incubated overnight at 4 �C with constant gently rotation.

On the third day, magnetic beads were washed twice in a

magnetic rack for 10 minutes each in high-salt buffer

(50 mM Tris, pH 7.4, 300 mM KCl, 12 mM MgCl2,

1 %NP-40, 1 mM DTT, and 100 lg/ml cycloheximide).

After washing, 350 ll of Qiagen RLT buffer (supple-

mented with b-Mercaptoethanol) were added to the pellets

and to the input samples. RNA was extracted according to

manufacturer’s instructions using a Qiagen RNeasy Micro

kit and quantified using Nanodrop 1000 spectrophotometer.

cDNA synthesis and quantitative real-time PCR

Synthesis of cDNA was performed on input fraction (10 %

of homogenate) and pellet fraction (after HA

Table 1 List of primary

antibodiesAntigen Host Dilution Supplier Catalog no

HA Mouse 1:1000 Covance MMS-101R

GFP Chicken 1:1000 Life Technologies A10262

CR Rabbit 1:1000 Swant 7699/3H

CB Rabbit 1:1000 Swant CB382

PV Rabbit 1:1000 Swant PV25

mGluR1a Rabbit 1:500 Abnova PAB14526

NPY Rabbit 1:500 Abcam ab10980

SOM Rabbit 1:300 Millipore AB5494

nNOS Mouse 1:300 Sigma N2280

RLN Mouse 1:500 Millipore MAB5364

VGLUT3 Guinea pig 1:500 Gift from El Mestikawy

CB1R Rabbit 1:1000 Frontier Institute CB1-Rb-Af380

D2R Rabbit 1:500 Frontier Institute D2R-Rb-Af960

HA hemagglutinin, GFP green fluorescent protein, PV parvalbumin, CB calbindin-D28k, CR calretinin,

NPY neuropeptide Y, mGluR1a metabotropic glutamate receptor type 1a, SOM somatostatin, nNOS neu-

ronal nitric oxide synthase, RLN reelin, VGLUT3 vesicular glutamate transporter type 3, CB1R cannabinoid

receptor type 1, D2R dopamine D2 receptor

Brain Struct Funct (2017) 222:1897–1911 1899

123

immunoprecipitation), which were reverse transcribed to

first strand cDNA using the SuperScript� VILOTM cDNA

synthesis kit (Invitrogen). Resulting cDNA was used for

quantitative real-time PCR (qRT-PCR), using SYBR Green

PCR master mix on the LC480 Real-Time PCR System

(Roche) and the primer sequences listed in Table 3.

Analysis was performed using LightCycler� 480 Software

(Roche). Data are expressed as the fold change comparing

the pellet fraction versus the input (3 biological replicates

per set of primers). The immunoprecipitated RNA samples

(pellet) were compared to the input sample in each case.

Statistical analysis

Unpaired Student’s t-test was used to compare changes in

gene expression between inputs and pellets. Significance

threshold was set at p\ 0.05. Prism 6.0 software was used

to perform statistical analyses.

Results

Distribution of D1R-expressing cells among calcium-

binding proteins

Parvalbumin (PV). PV-positive cells are widely distributed

in the CA1 subfield (Fig. 1a). Depending on their location

in the different layers they allow the classification of var-

ious GABAergic inhibitory interneurons (Klausberger

2009; Pawelzik et al. 2002). Thus, PV-expressing cells

identified axo-axonic, basket, and bistratified interneurons

in both strata pyramidale and oriens. In this latter layer, it

Fig. 1 Parvalbumin-,

calbindin-D28k-, and calretinin-

positive neurons in the dorsal

hippocampus in Drd1a-EGFP

mice. a, c, e Single

immunofluorescence for GFP

(left panels) and double

immunofluorescence (right

panels) for GFP (cyan) and

parvalbumin (magenta, PV) (a),calbindin-D28k (magenta, CB)

(c), and calretinin (magenta,

CR) (e) in CA1 dorsal

hippocampus of Drd1a-EGFP

mice. a, c, e Yellow arrowheads

indicate GFP/markers-positive

neurons. b, d, f Histograms

showing the co-expression as

percentage of GFP-positive

cells (darkened color, GFP?)

and as percentage of cells

expressing parvalbumin

(lightened color, PV?) (b),calbindin-D28k (lightened

color, CB?) (d), and calretinin

(lightened color, CR?) (f).Numbers of GFP?, PV?, CB?

and CR? cells counted are

reported in Table 2 (4

hemispheres per mouse, 4

mice). Scale bar 50 lm

1900 Brain Struct Funct (2017) 222:1897–1911

123

also marked the horizontal axo-axonic and oriens-lacuno-

sum-moleculare (O-LM). Our analysis revealed that GFP/

PV-positive cells represented *37 and *31 % of the total

GFP labeled in strata oriens and pyramidale, respectively

(Fig. 1a, b; Table 2). Low or no co-localization was found

in strata radiatum (*2 %) and lacunosum-moleculare

(0 %) where PV-positive cells identified perforant path-

associated QuadD, quadrilaminar, and R-receiving apical

targeting interneurons (Fig. 1a, b; Table 2).

Calbindin-D28k (CB). In CA1 subfield, CB-immunore-

activity is found in both principal glutamatergic cells in

strata pyramidale and radiatum as well as in GABAergic

interneurons located in strata oriens, radiatum, and la-

cunosum-moleculare (Jinno and Kosaka 2002) (Fig. 1c). In

stratum pyramidale, we found that among the 272 GFP-

immunoreactive cells quantified, 55 co-localized with CB

(*20 % of total of GFP-positive neurons) (Fig. 1c, d;

Table 2). In stratum oriens, where CB-positive cells

identified recurrent O-LM, oriens alveus, and SO–SO cells,

*22 % of GFP-labeled neurons co-expressed CB (Fig. 1c,

d). Finally, CB immunolabeling also marked LMR-pro-

jecting, radiatum, and Schaffer collateral associated classes

of interneurons in strata radiatum and lacunosum-molec-

ulare, in which *20 and *13 % of CB/GFP-positive

neurons were detected (Fig. 1c, d; Table 2).

Calretinin (CR). CA1 CR-positive cells are distributed

in all the layers where they allow the identification of

several classes of interneurons (Wheeler et al. 2015)

(Fig. 1e). Overall, our analysis revealed a low degree of co-

localization between GFP and CR immunoreactivity

whatever the layers analyzed. The highest percentage of

co-localization was found in stratum pyramidale (*11 %)

where CR-positive cells marked interneuron specific LMO-

O, interneuron specific O-targeting QuadD, interneuron

specific R-O, and interneuron RO-O, a class of interneu-

rons specialized in the control of other interneurons

(Fig. 1e, f; Table 2). In addition to interneurons specific,

CR-positive cells were expressed in oriens-bistratified in

stratum oriens and perforant path-associated QuadD,

quadrilaminar, and Schaffer collateral receiving R-target-

ing cells in stratum radiatum. In both layers, GFP-positive

cells expressing CR was rather low, representing only

*4 % in stratum oriens and *5 % in stratum radiatum

(Fig. 1e, f; Table 2). Finally, in stratum lacunosum-

moleculare where CR cells stain Cajal–Retzius cells and

quadrilaminar interneurons, only three GFP/CR-positive

cells were detected among the 173 GFP-immunoreactive

cells (Fig. 1e, f; Table 2). These co-labeled cells which

most likely correspond to quadrilaminar interneurons rep-

resented only *2 % (Fig. 1e, f; Table 2).

Fig. 2 Neuropeptide Y- and somatostatin-expressing cells in the

dorsal hippocampus in Drd1a-EGFP mice. a, c Single immunoflu-

orescence for GFP (left panels) and double immunofluorescence

(right panels) for GFP (cyan) and neuropeptide Y (magenta, NPY)

(a) and somatostatin (magenta, SOM) (c) in dorsal hippocampus of

Drd1a-EGFP mice. a, c Yellow arrowheads indicate GFP/NPY- or

GFP/SOM-positive neurons. b, d Histograms showing the co-

expression as percentage of GFP-positive cells (darkened color,

GFP?) and as percentage of cells expressing NPY (lightened color,

NPY?) (b) and somatostatin (lightened color, SOM?) (d). Numbers

of GFP?, NPY? and SOM? cells counted are reported in Table 2 (4

hemispheres per mouse, 4 mice). Scale bars a, c, 50 lm

Brain Struct Funct (2017) 222:1897–1911 1901

123

Distribution of D1R-expressing cells

among neuropeptides

Neuropeptide Y (NPY). NPY/GFP-positive neurons were

found in all the layers of the CA1 subfield (Tricoire et al.

2011). Co-localized GFP and NPY immunoreactive cells

represented *40 % and of *38 % of GFP-positive cells

in strata oriens and pyramidale, respectively. Within these

two layers, NPY marked back-projection, O-LM, recurrent

O-LM, SO–SO interneurons as well as bistratified and ivy

cells (Fig. 2a, b; Table 2). Co-localization was also high in

strata radiatum (*31 %) and lacunosum-moleculare

(*28 %) in which ivy, LMR, perforant path-associated

QuaD, radiatum, and radial trilaminar interneurons as well

as neurogliaform interneurons are distributed (Fig. 2a, b;

Table 2).

Somatostatin (SOM). The highest percentage of GFP/

SOM-positive neurons was detected in stratum oriens

(*34 %) where SOM is expressed by several classes of

interneurons including O-LM, recurrent O-LM, O-LMR,

oriens-bistratified, oriens-bistratified projecting as well as

trilaminar (Chittajallu et al. 2013; Tricoire et al. 2011)

(Fig. 2c, d; Table 2). In stratum pyramidale, only *6 % of

GFP-positive cells co-expressed SOM, a marker of

bistratified interneurons. It should be noted that a signifi-

cant fraction (*57 %) of these neurons appeared to

express D1R. Finally, in strata radiatum where SOM-

containing cells identify LMR, perforant path-associated

QuaD, quadrilaminar and radiatum interneurons, GFP/

SOM co-expressing cells represented only *2 % of GFP-

positive cells, but 53 % of SOM-positive neurons (Fig. 2c,

d; Table 2). No co-labeling was found in stratum lacuno-

sum-moleculare (Fig. 2d; Table 2).

Fig. 3 Distribution of D1R-expressing cells among nNOS- and

Reelin-positive neurons. a, c Single immunofluorescence for GFP

(left panels) and double immunofluorescence (right panels) for GFP

(cyan) and neuronal nitric oxide synthase (magenta, nNOS) (a) andreelin (magenta, RLN) (b) in dorsal hippocampus of Drd1a-EGFP

mice. a, c Yellow arrowheads indicate GFP/nNOS- or GFP/RLN-

positive neurons. b, d Histograms showing the co-expression as

percentage of GFP-positive cells (darkened color, GFP?) and as

percentage of cells expressing nNOS (lightened color, nNOS?)

(b) and reelin (lightened color, RLN?) (d). Numbers of GFP?,

nNOS? and RLN? cells counted are reported in Table 2 (4

hemispheres per mouse, 3 mice). Scale bars a, c, 50 lm

cFig. 4 Distribution of D1R-expressing cells among mGluR1a-,CB1R, and VGLUT3-positive neurons. a GFP (cyan) and mGluR1a(magenta) immunofluorescence in the dorsal hippocampus of Drd1a-

EGFP mice. Yellow arrowheads indicate GFP/mGluR1a-positiveneurons in CA1 subfield Scale bar 50 lm. b Histograms showing the

co-expression as percentage of GFP-positive cells (darkened color)

and as percentage of cells expressing mGluR1a (lightened color).

Numbers of GFP? and mGluR1a? cells counted are reported in

Table 2 (4 hemispheres per mouse, 4 mice). c Triple immunofluo-

rescence for GFP (cyan), the vesicular glutamate transporter type 3

(magenta, VGLUT3), and the cannabinoid receptor type 1 (yellow,

CB1R) in the dorsal hippocampus of Drd1a-EGFP mice. Scale bar

400 lm. d, e High magnification images of areas delineated by the

yellow stippled squares. Red arrowheads indicate GFP/VGLUT3/

CB1R-positive neurons in the strata radiatum (d) and pyramidale

(e) in CA1 subfield. Scale bars d, e, 60 lm

1902 Brain Struct Funct (2017) 222:1897–1911

123

Distribution of D1R-expressing cells

among miscellaneous markers

Neuronal nitric oxide synthase (nNOS). nNOS-expressing

neurons represent one of the largest subclasses of

interneurons present in the CA1 subfield of the hip-

pocampus. Highly concentrated in strata oriens and la-

cunosum-moleculare, they allow the identification of

neurogliaform and ivy interneurons (Armstrong et al. 2012;

Price et al. 2005; Tricoire et al. 2010). As shown in Fig. 3,

Brain Struct Funct (2017) 222:1897–1911 1903

123

percentages of nNOS/GFP-immunoreactive cells were high

in all the CA1 layers reaching *62 and *57 % in strata

pyramidale and radiatum, and being slightly lower in

strata oriens and lacunosum-moleculare (*51 and

*47 %, respectively) (Fig. 3a, b; Table 2).

Reelin (RLN). In CA1 subfield, RLN allows the identi-

fication of both glutamatergic and GABAergic interneurons

(Wheeler et al. 2015). Our analysis revealed that GFP was

never found in small RLN-positive cells located at the

border of strata radiatum/lacunosum-moleculare, which

correspond to glutamatergic Cajal–Retzius cells. In con-

trast, a high level of co-localization was found in strata

oriens (*57 %), radiatum (*64 %), and lacunosum-

moleculare (*45 %) where RLN identified O-LM and

neurogliaform interneurons (Fig. 3c, d; Table 2). In stra-

tum pyramidale, RLN-immunoreactive cells represented

only *12 % of GFP-expressing neurons (Fig. 3d;

Table 2).

Distribution of D1R-expressing cells

among receptors/transporters

Metabotropic glutamate receptor type 1a (mGluR1a). Thelargest density of mGluR1a-positive cells was found in

stratum oriens (Tricoire et al. 2011). Within this layer,

mGluR1a marked preferentially trilaminar, recurrent

O-LM, and O-LM interneurons and co-expressed within

GFP in *42 % of the case (Fig. 4a, b; Table 2).

mGluR1a/GFP-expressing cells were also found to a lesser

extent in stratum radiatum (*14 %), where they identify

hippocampo-subicular projecting ENK? interneurons

(Fig. 4a, b; Table 2). Low (*7 %) and no co-localization

were detected in strata pyramidale and lacunosum-molec-

ulare, respectively (Fig. 4a, b; Table 2).

Cannabinoid type 1 receptor (CB1R). CA1 CB1R-ex-

pressing interneurons are preferentially found in strata

radiatum and lacunosum-moleculare identifying LMR

projecting, Schaffer collateral-associated, and trilaminar

interneurons. They also correspond to CCK-positive basket

cells distributed in strata oriens, pyramidale, and radiatum

(Freund and Buzsaki 1996) (Fig. 4c). Because CB1R are

mainly presynaptically expressed, hippocampal CB1R

immunoreactivity did not allow us to quantify the per-

centage of CB1R-positive cells among the D1R-expressing

population. However, a few scattered CB1R/GFP-positive

cells were clearly identified in stratum radiatum and at the

border of strata radiatum/lacunosum-moleculare (Fig. 4d)

as well as in stratum pyramidale (Fig. 4e).

Vesicular glutamate transporter type 3 (VGLUT3). Only

four different types of interneurons located in strata oriens,

pyramidale, and radiatum express VGLUT3 (Wheeler

et al. 2015). Among them, two classes of VGLUT3-ex-

pressing interneurons are also CB1R-positive. These

include CCK-positive basket and radial trilaminar

interneurons. The two other subtypes are negative for

CB1R and identify perforant path-associated QuaD and

horizontal basket interneurons. As shown in Fig. 4, a dense

plexus of VGLUT3-immunoreactive fibers surrounding the

stratum pyramidale was detected in the CA1 subfield.

Interestingly, most of the sparse VGLUT3/GFP-positive

cells detected in strata radiatum and pyramidale were also

positive for CB1R (Fig. 4c–e).

CA1 D1R-positive cells express dopamine D2

receptors

The present analysis of the distribution of GFP in Drd1a-

EGFP mice suggests that diverse classes of GABAergic

interneurons express D1R. Because the distribution of

D1R-expressing cells was reminiscent to the one recently

described for CA1 D2R-containing neurons (Puighermanal

et al. 2015), we analyzed whether GFP/D2R co-expressing

cells were present in the CA1 dorsal hippocampus of

Drd1a-EGFP. The analysis of endogenous D2R distribu-

tion, using anti-D2R antibody (see Table 1), revealed a

pattern of expression of D2R-positive cells that resembles

to the one recently described (Puighermanal et al. 2015).

Indeed, in the dentate gyrus most of the D2R-positive

neurons were located in the hilus identifying the hilar

mossy cells (Fig. 5a). In the CA1 subfield, D2R-labeled

cells were predominantly detected in strata oriens and

radiatum (Fig. 5a). In addition, an intense D2R

immunoreactivity was detected in stratum lacunosum-

moleculare most likely corresponding to the terminals of

O-LMs interneurons (Fig. 5a). On the other hand, they

were rarely found in stratum pyramidale (Fig. 5a). The

pattern of distribution of endogenous D2R-expressing cells

was further confirmed by analyzing the degree of co-lo-

calization between D2R and HA immunoreactivity in

Drd2-Cre::RiboTag mice. As illustrated, all HA-express-

ing cells located in strata oriens, radiatum, and at the

border of strata radiatum/lacunosum-moleculare were also

positive for D2R (Fig. 5b, yellow arrows). Only a few

neurons were D2R?/HA- suggesting that the expression of

endogenous D2R might not be fully recapitulated in Drd2-

Cre::RiboTag mice (Fig. 5b).

We next examined the degree of co-localization of GFP-

labeled cells with D2R in the dorsal CA1 hippocampus of

Drd1a-EGFP. In stratum oriens a large majority of GFP-

expressing cells were also D2R positive (*82 %). The

percentage of GFP/D2R-immunoreactive neurons was also

high in strata pyramidale and radiatum, reaching *64 and

*68 %, respectively (Fig. 5c, d; Table 2). By contrast, in

stratum lacunosum-moleculare only 15 GFP/D2R-positive

cells have been detected among the 110 GFP-immunore-

active cells (Fig. 5c, d; Table 2).

1904 Brain Struct Funct (2017) 222:1897–1911

123

To further confirm that both receptors were expressed at

least by a fraction of hippocampal cells, we took advantage

of the Drd2-Cre::RiboTag mice that express tagged-ribo-

somes selectively in D2R-containing cells (Fig. 6a). After

homogenization of the hippocampus, tagged-ribosomes

and their bound mRNAs were captured by HA immuno-

precipitation (Fig. 6a). The analysis by quantitative RT-

PCR (qRT-PCR) of purified mRNAs compared to the input

fraction revealed a de-enrichment of glial markers,

including Gfap for astrocytes, Cnp1 for oligodendrocytes,

and Iba1 for microglia as well as of glutamatergic

pyramidal cells markers such as Camk2a and Slc1a1

(EAAT3) (Fig. 6b). By contrast, the glutamatergic Cajal–

Retzius and hilar mossy cells marker Calb2 (CR) was

highly enriched in mRNAs purified following HA

immunoprecipitation (Fig. 6b). Similarly, GABAergic

markers including Gad1, Slc32a1 (VIAAT), and Sst (SOM)

were also clearly enriched (Fig. 6b) confirming our previ-

ous observations (Puighermanal et al. 2015). Finally, the

presence of Drd2 mRNA was confirmed as expected, but

also Drd1a mRNAs were isolated following HA

immunoprecipitation (Fig. 6c), in agreement with the co-

Fig. 5 Dopamine D2R-positive neurons in the CA1 dorsal hip-

pocampus of Drd1a-EGFP mice. a D2R immunofluorescence in the

dorsal hippocampus of Drd1a-EGFP mice. High magnification

images of areas delineated by the yellow stippled squares in CA1

subfield. Scale bars 400 and 20 lm. b HA (cyan) and D2R (magenta)

immunofluorescence in the dorsal hippocampus in Drd2-Cre::Ri-

boTag mice. Yellow arrowheads indicate HA/D2R-positive neurons

in the CA1 subfield. Note that all HA-expressing cells are also D2R-

positive. Scale bar 60 lm. c GFP (cyan) and D2R (magenta)

immunofluorescence in the dorsal hippocampus of Drd1a-EGFP

mice. Yellow open arrowheads indicate GFP/D2R-positive neurons,

yellow arrowheads indicate GFP-expressing cells, and white arrow-

heads indicate D2R-positive neurons. Scale bar 60 lm. d Histograms

showing the co-expression as percentage of GFP-positive cells

(darkened color) and as percentage of cells expressing D2R

(lightened color). Numbers of GFP? and D2R? cells counted are

reported in Table 2 (4 hemispheres per mouse, 3 mice)

Brain Struct Funct (2017) 222:1897–1911 1905

123

localization of GFP and D2R in Drd1a-EGFP mice

(Fig. 5). Taken together, these results indicate that in CA1

subfield a large proportion of D1R-expressing cells also

contain D2R.

Discussion

Although the mesohippocampal DA pathway has been

characterized almost three decades ago (Gasbarri et al.

1994a, b; Swanson 1982), the mechanisms by which DA

mediates its effect in the hippocampus remain largely

unknown. The precise characterization of hippocampal

cells expressing DA receptors is therefore a critical step to

understand the functional consequences of DA transmis-

sion within the hippocampus. By using BAC transgenic

mice expressing EGFP under the control of the D1R pro-

moter, the present study examined the laminar distribution

and determined the molecular identity of CA1 D1R-con-

taining cells in the dorsal hippocampus. As initially

reported, GFP-labeled neurons were found in all CA1

layers and were essentially GABAergic interneurons

(Gangarossa et al. 2012). Our analysis revealed that GFP-

positive cells were co-immunolabeled with several neuro-

chemical markers, suggesting that various classes of

GABAergic interneurons expressed D1R (Wheeler et al.

2015). Finally, we provide evidence that a large proportion

of D1R-expressing neurons located in all CA1 layers also

express D2R.

Anatomical distribution of DA projections

and expression pattern of D1R-expressing cells

An early tract-tracing study and double immunofluores-

cence analyses reported that VTA DA neurons projecting

to the hippocampus were preferentially localized in strata

oriens and pyramidale, with sparse fibers in stratum

radiatum and barely any innervation of stratum lacunosum-

moleculare (Gasbarri et al. 1994a, b; Kwon et al. 2008).

This heterogeneous laminar distribution of DA fibers

within CA1 was recently confirmed by analyzing hip-

pocampal efferents from genetically defined VTA DA

Table 2 Number of cells quantified in the dorsal CA1 mouse

hippocampus

Figures GFP/markers s.o. s.p. s.r. s.l-m

Figure 1b GFP 411 288 421 145

PV 271 400 37 5

GFP/PV 153 89 9 0

Figure 1d GFP 372 272 421 139

CB 217 ND 177 35

GFP/CB 82 55 84 18

Figure 1f GFP 428 286 476 173

CR 76 144 154 261

GFP/CR 16 31 25 3

Figure 2b GFP 469 294 564 208

NPY 297 171 223 104

GFP/NPY 188 111 174 58

Figure 2d GFP 401 216 396 138

SOM 351 21 17 0

GFP/SOM 136 12 9 0

Figure 3b GFP 214 141 244 94

nNOS 141 123 206 71

GFP/nNOS 110 88 139 44

Figure 3d GFP 212 123 137 65

RLN 229 33 235 359

GFP/RLN 120 15 87 29

Figure 4b GFP 353 229 371 68

mGluR1a 271 43 95 0

GFP/mGluR1a 149 15 52 0

Figure 5d GFP 220 108 216 110

D2R 236 143 247 34

GFP/D2R 181 69 146 15

GFP green fluorescent protein, PV parvalbumin, CB calbindin-D28k,

CR calretinin, NPY neuropeptide Y, SOM somatostatin, nNOS neu-

ronal nitric oxide synthase, RLN reelin, mGluR1a metabotropic glu-

tamate receptor type 1a, D2R dopamine D2 receptor, ND not

determined

Table 3 Sequences of PCR primers

Marker PCR primers

Gfap Sense, AGCGAGCGTGCAGAGATGA

Antisense, AGGAAGCGGACCTTCTCGAT

Cnp1 Sense, GCTGCACTGTACAACCAAATTCTG

Antisense, ACCTCCTGCTGGGCGTATT

Iba1 Sense, CCCCCAGCCAAGAAAGCTAT

Antisense, GCCCCACCGTGTGACATC

Camk2a Sense, TTTGAGGAACTGGGAAAGGG

Antisense, CATGGAGTCGGACGATATTGG

Slc1a1 Sense, AAAGATAGCAGGAAGGTAACCGAAT

Antisense, CGGTCAGTCGGTAGCTTTCAG

Calb2 Sense, TGAGAATGAACTGGACGCCCTC

Antisense, GTAGAGCTTCCCTGCCTCGG

Gad1 Sense, TTGTGCTTTGCTGTGTTTTAGAGA

Antisense, CCCCCTGCCCAAAGATAGAC

Sst Sense, CTGTCCTGCCGTCTCCAGTG

Antisense, CTCTGTCTGGTTGGGCTCGG

Slc32a1 Sense, TCACGACAAACCCAAGATCAC

Antisense, GTCTTCGTTCTCCTCGTACAG

Drd2 Sense, CTCTTTGGACTCAACAACACAGA

Antisense, AAGGGCACGTAGAACGAGAC

Drd1a Sense, TCGAACTGTATGGTGCCCTT

Antisense, TGGGGTTCAGGGAGGAATTC

1906 Brain Struct Funct (2017) 222:1897–1911

123

neurons using Cre-inducible AAV-expressing ChR2-EYFP

(Broussard et al. 2016; McNamara et al. 2014; Rosen et al.

2015). Interestingly, our analysis revealed that D1R-ex-

pressing cells are found in a large proportion in stratum

oriens and to a lesser extent in stratum pyramidale. Thus,

in these two layers DA terminals largely overlap with D1R-

containing neurons as illustrated by the presence of GFP-

labeled neurons in the vicinity of TH-positive fibers

(Supplemental Figure 1, Inset). D1R-expressing cells are

also present in strata radiatum and at the border of ra-

diatum/lacunosum-moleculare. However, despite the

detection of TH immunoreactivity (Supplemental Fig-

ure 1), VTA DA neurons do not innervate these two layers

(Broussard et al. 2016; McNamara et al. 2014; Rosen et al.

2015). In fact, strong evidence indicate that the dense

plexus of TH-labeled fibers observed within strata radia-

tum and lacunosum-moleculare corresponds to noradren-

ergic (NE) axons arising from the locus coeruleus (LC)

(Kwon et al. 2008). Of interest, a recent study showed that

these LC NE fibers co-release DA and NE, suggesting that

they constitute the only source of DA in the vicinity of

D1R-expressing neurons located in these two layers (Smith

and Greene 2012; Walling et al. 2012). Therefore,

depending on their laminar location, D1R-expressing

neurons could be controlled by DA arising from two dis-

tinct sources: the VTA for strata oriens and pyramidale

and the LC for strata radiatum and lacunosum-moleculare.

Reliability of the distribution of D1R-expressing

cells in Drd1a-EGFP mice

If the expression of D1R by the granule cells in the dentate

gyrus is well admitted and has been demonstrated by in situ

hybridization, binding, and immunofluorescence studies

(Boyson et al. 1986; Fremeau et al. 1991; Gangarossa et al.

2012; Huang et al. 1992; Mansour et al. 1990, 1991;

Fig. 6 D2R-expressing cells are enriched in Drd1 mRNA. a D2R-

expressing cells, either glutamatergic (triangles) or GABAergic

(circles), contain ribosomes tagged with the HA epitope in Drd2-

Cre::RiboTag mice. After hippocampus homogenization, 10 % of the

lysate was saved as input fraction (containing all mRNAs), while the

mRNAs bound to tagged-ribosomes were isolated through HA-

immunoprecipitation (pellet fraction). b Quantitative RT-PCR anal-

ysis of mRNAs isolated following HA immunoprecipitation from

hippocampi of Drd2-Cre::RiboTag mice. All genes were normalized

to b-actin. Data are expressed as the fold change comparing the pellet

fraction versus the input. Negative control genes, including glial

markers (Gfap, Cnp and Iba1; grey bars) and pyramidal cell markers

(Slc1a1 and Camk2a; orange bars) were de-enriched in the pellet

samples, whereas the positive control genes including GABAergic

and mossy cell markers (Gad1, Slc32a1, Sst and Calb2; cyan bars)

were enriched in the pellet compared to the input fraction. c Quan-

titative RT-PCR analysis of Drd2 and Drd1 genes after HA

immunoprecipitation from hippocampi of Drd2-Cre::RiboTag mice

(n = 6 mice). Data are analyzed by two tailed Student t test.

*p\ 0.05, **p\ 0.001 pellet vs. input

Brain Struct Funct (2017) 222:1897–1911 1907

123

Rocchetti et al. 2015; Sarinana et al. 2014), the distribu-

tion/identity of D1R-expressing cells in the CA1 subfield

remains unclear. Indeed, although the presence of D1R in

pyramidal cells has been suggested (Huang et al. 1992;

Kern et al. 2015; Ladepeche et al. 2013a, b), little or no

signal for D1R at the transcript level was detected (Fre-

meau et al. 1991; Mansour et al. 1990; Rocchetti et al.

2015; Sarinana et al. 2014). Consistent with these latter

findings, our analysis revealed a weak and sparse distri-

bution of GFP-labeled neurons in stratum pyramidale. This

finding strongly suggests that the D1R staining detected in

this layer and initially thought to label the plasma mem-

brane of CA1 pyramidal cells (Huang et al. 1992) most

likely corresponds to D1R-positive terminals arising from

another cell type, possibly GABAergic interneurons. Sup-

porting this hypothesis, D1R-expressing cells were found

in strata oriens and radiatum/lacunosum-moleculare

(Gangarossa et al. 2012; present study), three layers pop-

ulated by a large diversity of GABAergic interneurons

(Wheeler et al. 2015). The distribution of GFP-labeled cells

reported in the present study is consistent with the early

description of the D1R expression pattern. Thus, although

at low density, autoradiography studies revealed the pres-

ence of D1R binding sites in stratum oriens (Mansour et al.

1990, 1991). Moreover, cells containing D1R mRNA have

been detected in both strata oriens and radiatum (Fremeau

et al. 1991). Finally, both layers also exhibit a strong D1R

immunoreactivity (Huang et al. 1992). Combined with

previous findings, our results strongly suggest that D1R are

preferentially expressed by GABAergic interneurons and

not by pyramidal cells within the CA1 subfield.

D1R is expressed in various classes of GABAergic

interneurons in CA1

The use of different neurochemical markers including

calcium-binding proteins (parvalbumin, calbindin-D28k,

calretinin), neuropeptides (somatostatin, NPY), recep-

tors/transporters (mGluR1a, CB1R, VGLUT3) and mis-

cellaneous markers (nNOS, reelin) allowed us to evaluate

the distribution of GFP among 33 out of the 37 types of

interneurons known to be present in CA1 (Wheeler et al.

2015). Based on the laminar localization and the percent-

age of co-localization, we estimate that D1R are expressed

by at least eight distinct classes of GABAergic interneu-

rons. For instance, the high percentage of GFP/nNOS-

positive cells in all layers indicate that D1R might be

expressed by both ivy and neurogliaform cells (Armstrong

et al. 2012; Price et al. 2005; Tricoire et al. 2010). Their

presence in this latter population is further supported by the

strong percentage of GFP/NPY- and GFP/reelin-positive

neurons estimated in the stratum lacunosum-moleculare

(Fuentealba et al. 2008; Tricoire et al. 2011). In stratum

oriens, the co-expression of GFP with SOM/mGluR1asuggests that D1R are expressed by O-LMs and trilaminar

interneurons (Chittajallu et al. 2013; Klausberger 2009;

Matyas et al. 2004; Tricoire et al. 2011). The presence of

GFP/PV-expressing cells also favors the hypothesis that

axo-axonic, basket, and bistratified interneurons contain

D1R. This observation is further strengthened by the recent

demonstration of the critical role played by D1R signaling

in PV cells for the consolidation of long-term memory

(Karunakaran et al. 2016). Finally, although not quantified,

the presence of GFP/VGLUT3/CB1R-positive neurons

suggests that basket CCK? might express D1R (Wheeler

et al. 2015). Interestingly, most of the D1R-containing cells

located in the stratum pyramidale correspond to

GABAergic interneurons. Based on the combination of the

molecular marker they express, one can reasonably con-

clude they comprise axo-axonic, basket, bistratified, and

ivy cells. Finally, a small fraction of GFP-positive neurons

were co-labeled with calbindin-D28k, confirming the

scarity of pyramidal neurons expressing D1R. Our cross

analysis also allowed us to identify CA1 cell types devoid

of D1R. Thus, at least two types of interneurons, the per-

forant path-associated QuaD located in stratum radiatum

and the quadrilaminar interneurons found in both strata

radiatum and lacunosum-moleculare (Pawelzik et al. 2002;

Tricoire et al. 2011). Finally, the lack of co-localization

between GFP and calretinin/reelin-positive cells localized

in stratum lacunosum-moleculare supports the absence of

D1R in Cajal–Retzius cells (Marchionni et al. 2010; Tri-

coire et al. 2011). Further experiments using double fluo-

rescent in situ hybridization and/or cell-type specific

mRNA profiling should help to further confirm the pres-

ence of D1R transcripts in these distinct classes of

GABAergic interneurons.

Evidence for D1R and D2R co-expression in CA1

GABAergic interneurons

Although BAC transgenic mice expressing fluorescent

proteins represent a useful tool to characterize genetically

identified cell populations, caution should be taken when

analyzing the expression pattern. Indeed, during the

course of the characterization of our Drd2-Cre::RiboTag

mouse line, which express tagged-ribosomes selectively in

D2R-containing cells, we found that in the hippocampus

D2R-expressing cells displayed a much widespread pat-

tern than the one initially described in Drd2-EGFP mice

(Gangarossa et al. 2012; Puighermanal et al. 2015). The

difference was particularly evident in CA1 where HA-

positive cells of Drd2-Cre::RiboTag mice identified

diverse classes of GABAergic interneurons (Gangarossa

et al. 2012; Puighermanal et al. 2015). This observation,

together with our present analysis, led us to re-examine

1908 Brain Struct Funct (2017) 222:1897–1911

123

whether, in the CA1 subfield, D1R and D2R-expressing

cells were fully segregated, as initially thought (Gan-

garossa et al. 2012; Puighermanal et al. 2015), or could

partially overlap. The present findings argue in favor of

this last hypothesis. Thus, in strata oriens, pyramidale,

and radiatum, our double immunofluorescence analysis

revealed a high degree of co-localization between GFP

and D2R. The presence of cells co-expressing both D1R

and D2R was further confirmed by the enrichment of

Drd1 transcripts isolated from tagged-ribosomes expres-

sed in D2R-containing cells. Interestingly, the presence of

both receptors on diverse GABAergic interneurons, which

for some of them have antagonistic activity onto CA1

pyramidal cells, could account for the complexity and

variability of DA action following bath application in

hippocampal slices. Indeed, while DA bath application

does affect excitatory Schaffer collateral (SC) drive onto

CA1 pyramidal cells, a depression of the synaptic trans-

mission of temporoammonic (TA) pathway has been

reported (Ito and Schuman 2007; Otmakhova and Lisman

1999). This latter effect, which requires both D1R and

D2R, also involves local GABAergic interneurons located

at the border of strata radiatum and lacunosum-molecu-

lare (Ito and Schuman 2007; Otmakhova and Lisman

1999). However, at this synapse, following high-fre-

quency stimulation, DA facilitates excitatory drive to

CA1 pyramidal cells mainly through the decreased feed-

forward inhibition (Ito and Schuman 2007; Otmakhova

and Lisman 1999). Therefore, one can envision that the

ability of DA to gate TA synaptic transmission would not

only depend on the excitatory inputs frequency but also

depend on the dual action of DA on GABAergic

interneurons co-expressing both D1R and D2R. Because

these different types of D1R/D2R-expressing interneurons

innervate specific and distinct domains of pyramidal cells

and other interneurons, future experiments will be nec-

essary to understand whether their pattern of activity will

change depending on tonic, phasic, or ramping DA

signals.

In conclusion, our study revealed that in the CA1 sub-

field of the hippocampus, distinct classes of GABAergic

interneurons express D1R. Contrasting with the dorsal

striatum where D1R and D2R are highly segregated (Ber-

tran-Gonzalez et al. 2010; Valjent et al. 2009), a high

degree of D1R-containing neurons also express D2R.

Future studies using cell-type specific invalidation of D1R

and/or D2R are promptly required to untangle the com-

plexity of DA signals within the hippocampus.

Acknowledgments This work was supported by Inserm, Fondation

pour la Recherche Medicale (EV), and a NARSAD Young Investi-

gator Grant from the Brain and Behavior Research Foundation (EP).

EP is a recipient of Marie Curie Intra-European Fellowship

IEF327648. LC is a recipient of LABEX EpiGenMed Fellowship.

Open Access This article is distributed under the terms of the

Creative Commons Attribution 4.0 International License (http://crea

tivecommons.org/licenses/by/4.0/), which permits unrestricted use,

distribution, and reproduction in any medium, provided you give

appropriate credit to the original author(s) and the source, provide a

link to the Creative Commons license, and indicate if changes were

made.

References

Armstrong C, Krook-Magnuson E, Soltesz I (2012) Neurogliaform

and ivy cells: a major family of nNOS expressing GABAergic

neurons. Front Neural Circuits 6:23

Bertran-Gonzalez J, Bosch C, Maroteaux M, Matamales M, Herve D,

Valjent E, Girault JA (2008) Opposing patterns of signaling

activation in dopamine D1 and D2 receptor-expressing striatal

neurons in response to cocaine and haloperidol. J Neurosci

28(22):5671–5685

Bertran-Gonzalez J, Herve D, Girault JA, Valjent E (2010) What is

the degree of segregation between striatonigral and striatopal-

lidal projections? Front Neuroanat 4. doi:10.3389/fnana.2010.

00136

Bethus I, Tse D, Morris RG (2010) Dopamine and memory:

modulation of the persistence of memory for novel hippocampal

NMDA receptor-dependent paired associates. J Neurosci

30(5):1610–1618

Boyson SJ, McGonigle P, Molinoff PB (1986) Quantitative autora-

diographic localization of the D1 and D2 subtypes of dopamine

receptors in rat brain. J Neurosci 6(11):3177–3188

Bromberg-Martin ES, Matsumoto M, Hikosaka O (2010) Dopamine

in motivational control: rewarding, aversive, and alerting.

Neuron 68(5):815–834

Broussard JI, Yang K, Levine AT, Tsetsenis T, Jenson D, Cao F,

Garcia I, Arenkiel BR, Zhou FM, De Biasi M et al (2016)

Dopamine regulates aversive contextual learning and associated

in vivo synaptic plasticity in the hippocampus. Cell Rep

14(8):1930–1939

Chittajallu R, Craig MT, McFarland A, Yuan X, Gerfen S, Tricoire L,

Erkkila B, Barron SC, Lopez CM, Liang BJ et al (2013) Dual

origins of functionally distinct O-LM interneurons revealed by

differential 5-HT(3A)R expression. Nat Neurosci

16(11):1598–1607

Franklin K, Paxinos G (2007) The mouse brain in stereotaxic

coordinates, 3rd edn. Elsevier, Amsterdam

Fremeau RT Jr, Duncan GE, Fornaretto MG, Dearry A, Gingrich JA,

Breese GR, Caron MG (1991) Localization of D1 dopamine

receptor mRNA in brain supports a role in cognitive, affective,

and neuroendocrine aspects of dopaminergic neurotransmission.

Proc Natl Acad Sci USA 88(9):3772–3776

Freund TF, Buzsaki G (1996) Interneurons of the hippocampus.

Hippocampus 6(4):347–470

Fuentealba P, Begum R, Capogna M, Jinno S, Marton LF, Csicsvari J,

Thomson A, Somogyi P, Klausberger T (2008) Ivy cells: a

population of nitric-oxide-producing, slow-spiking GABAergic

neurons and their involvement in hippocampal network activity.

Neuron 57(6):917–929

Furini CR, Myskiw JC, Schmidt BE, Marcondes LA, Izquierdo I

(2014) D1 and D5 dopamine receptors participate on the

consolidation of two different memories. Behav Brain Res

271:212–217

Gangarossa G, Longueville S, De Bundel D, Perroy J, Herve D,

Girault JA, Valjent E (2012) Characterization of dopamine D1

and D2 receptor-expressing neurons in the mouse hippocampus.

Hippocampus 22(12):2199–2207

Brain Struct Funct (2017) 222:1897–1911 1909

123

Gasbarri A, Packard MG, Campana E, Pacitti C (1994a) Anterograde

and retrograde tracing of projections from the ventral tegmental

area to the hippocampal formation in the rat. Brain Res Bull

33(4):445–452

Gasbarri A, Verney C, Innocenzi R, Campana E, Pacitti C (1994b)

Mesolimbic dopaminergic neurons innervating the hippocampal

formation in the rat: a combined retrograde tracing and

immunohistochemical study. Brain Res 668(1–2):71–79

Gasbarri A, Sulli A, Packard MG (1997) The dopaminergic mesen-

cephalic projections to the hippocampal formation in the rat.

Prog Neuropsychopharmacol Biol Psychiatry 21(1):1–22

Gong S, Zheng C, Doughty ML, Losos K, Didkovsky N, Schambra

UB, Nowak NJ, Joyner A, Leblanc G, Hatten ME et al (2003) A

gene expression atlas of the central nervous system based on

bacterial artificial chromosomes. Nature 425(6961):917–925

Heath FC, Jurkus R, Bast T, Pezze MA, Lee JL, Voigt JP, Stevenson

CW (2015) Dopamine D1-like receptor signalling in the

hippocampus and amygdala modulates the acquisition of

contextual fear conditioning. Psychopharmacology

232(14):2619–2629

Horvitz JC, Stewart T, Jacobs BL (1997) Burst activity of ventral

tegmental dopamine neurons is elicited by sensory stimuli in the

awake cat. Brain Res 759(2):251–258

Huang Q, Zhou D, Chase K, Gusella JF, Aronin N, DiFiglia M (1992)

Immunohistochemical localization of the D1 dopamine receptor

in rat brain reveals its axonal transport, pre- and postsynaptic

localization, and prevalence in the basal ganglia, limbic system,

and thalamic reticular nucleus. Proc Natl Acad Sci USA

89(24):11988–11992

Ito HT, Schuman EM (2007) Frequency-dependent gating of synaptic

transmission and plasticity by dopamine. Front Neural Circuits

1:1

Jinno S, Kosaka T (2002) Patterns of expression of calcium binding

proteins and neuronal nitric oxide synthase in different popula-

tions of hippocampal GABAergic neurons in mice. J Comp

Neurol 449(1):1–25

Karunakaran S, Chowdhury A, Donato F, Quairiaux C, Michel CM,

Caroni P (2016) PV plasticity sustained through D1/5 dopamine

signaling required for long-term memory consolidation. Nat

Neurosci 19(3):454–464

Kern A, Mavrikaki M, Ullrich C, Albarran-Zeckler R, Brantley AF,

Smith RG (2015) Hippocampal dopamine/DRD1 signaling

dependent on the Ghrelin receptor. Cell 163(5):1176–1190

Klausberger T (2009) GABAergic interneurons targeting dendrites of

pyramidal cells in the CA1 area of the hippocampus. Eur J

Neurosci 30(6):947–957

Kwon OB, Paredes D, Gonzalez CM, Neddens J, Hernandez L,

Vullhorst D, Buonanno A (2008) Neuregulin-1 regulates LTP at

CA1 hippocampal synapses through activation of dopamine D4

receptors. Proc Natl Acad Sci USA 105(40):15587–15592

Ladepeche L, Dupuis JP, Bouchet D, Doudnikoff E, Yang L,

Campagne Y, Bezard E, Hosy E, Groc L (2013a) Single-

molecule imaging of the functional crosstalk between surface

NMDA and dopamine D1 receptors. Proc Natl Acad Sci USA

110(44):18005–18010

Ladepeche L, Yang L, Bouchet D, Groc L (2013b) Regulation of

dopamine D1 receptor dynamics within the postsynaptic density

of hippocampal glutamate synapses. PLoS One 8(9):e74512

Lammel S, Lim BK, Ran C, Huang KW, Betley MJ, Tye KM,

Deisseroth K, Malenka RC (2012) Input-specific control of

reward and aversion in the ventral tegmental area. Nature

491(7423):212–217

Lemon N, Manahan-Vaughan D (2006) Dopamine D1/D5 receptors

gate the acquisition of novel information through hippocampal

long-term potentiation and long-term depression. J Neurosci

26(29):7723–7729

Lisman JE, Grace AA (2005) The hippocampal-VTA loop: control-

ling the entry of information into long-term memory. Neuron

46(5):703–713

Ljungberg T, Apicella P, Schultz W (1992) Responses of monkey

dopamine neurons during learning of behavioral reactions.

J Neurophysiol 67(1):145–163

Mansour A, Meador-Woodruff JH, Bunzow JR, Civelli O, Akil H,

Watson SJ (1990) Localization of dopamine D2 receptor mRNA

and D1 and D2 receptor binding in the rat brain and pituitary: an

in situ hybridization-receptor autoradiographic analysis. J Neu-

rosci 10(8):2587–2600

Mansour A, Meador-Woodruff JH, Zhou QY, Civelli O, Akil H,

Watson SJ (1991) A comparison of D1 receptor binding and

mRNA in rat brain using receptor autoradiographic and in situ

hybridization techniques. Neuroscience 45(2):359–371

Marchionni I, Takacs VT, Nunzi MG, Mugnaini E, Miller RJ,

Maccaferri G (2010) Distinctive properties of CXC chemokine

receptor 4-expressing Cajal–Retzius cells versus GABAergic

interneurons of the postnatal hippocampus. J Physiol 588(Pt

15):2859–2878

Matyas F, Freund TF, Gulyas AI (2004) Immunocytochemically

defined interneuron populations in the hippocampus of mouse

strains used in transgenic technology. Hippocampus

14(4):460–481

McNamara CG, Tejero-Cantero A, Trouche S, Campo-Urriza N,

Dupret D (2014) Dopaminergic neurons promote hippocampal

reactivation and spatial memory persistence. Nat Neurosci

17(12):1658–1660

Otmakhova NA, Lisman JE (1999) Dopamine selectively inhibits the

direct cortical pathway to the CA1 hippocampal region. J Neu-

rosci 19(4):1437–1445

Pawelzik H, Hughes DI, Thomson AM (2002) Physiological and

morphological diversity of immunocytochemically defined par-

valbumin- and cholecystokinin-positive interneurones in CA1 of

the adult rat hippocampus. J Comp Neurol 443(4):346–367

Poulin JF, Zou J, Drouin-Ouellet J, Kim KY, Cicchetti F, Awatramani

RB (2014) Defining midbrain dopaminergic neuron diversity by

single-cell gene expression profiling. Cell Rep 9(3):930–943

Price CJ, Cauli B, Kovacs ER, Kulik A, Lambolez B, Shigemoto R,

Capogna M (2005) Neurogliaform neurons form a novel

inhibitory network in the hippocampal CA1 area. J Neurosci

25(29):6775–6786

Puighermanal E, Biever A, Espallergues J, Gangarossa G, De Bundel

D, Valjent E (2015) drd2-cre:ribotag mouse line unravels the

possible diversity of dopamine d2 receptor-expressing cells of

the dorsal mouse hippocampus. Hippocampus 25(7):858–875

Rocchetti J, Isingrini E, Dal Bo G, Sagheby S, Menegaux A, Tronche

F, Levesque D, Moquin L, Gratton A, Wong TP, Rubinstein M,

Giros B (2015) Presynaptic D2 dopamine receptors control long-

term depression expression and memory processes in the

temporal hippocampus. Biol Psychiatry 77(6):513–525

Rosen ZB, Cheung S, Siegelbaum SA (2015) Midbrain dopamine

neurons bidirectionally regulate CA3-CA1 synaptic drive. Nat

Neurosci 18(12):1763–1771

Rossato JI, Bevilaqua LR, Izquierdo I, Medina JH, Cammarota M

(2009) Dopamine controls persistence of long-term memory

storage. Science 325(5943):1017–1020

Sanz E, Yang L, Su T, Morris DR, McKnight GS, Amieux PS (2009)

Cell-type-specific isolation of ribosome-associated mRNA from

complex tissues. Proc Natl Acad Sci USA 106(33):13939–13944

Sarinana J, Kitamura T, Kunzler P, Sultzman L, Tonegawa S (2014)

Differential roles of the dopamine 1-class receptors, D1R and

D5R, in hippocampal dependent memory. Proc Natl Acad Sci

USA 111(22):8245–8250

Schultz W (2016) Dopamine reward prediction-error signalling: a

two-component response. Nat Rev Neurosci 17(3):183–195

1910 Brain Struct Funct (2017) 222:1897–1911

123

Smith CC, Greene RW (2012) CNS dopamine transmission mediated

by noradrenergic innervation. J Neurosci 32(18):6072–6080

Swanson LW (1982) The projections of the ventral tegmental area

and adjacent regions: a combined fluorescent retrograde tracer

and immunofluorescence study in the rat. Brain Res Bull

9(1–6):321–353

Tricoire L, Pelkey KA, Daw MI, Sousa VH, Miyoshi G, Jeffries B,

Cauli B, Fishell G, McBain CJ (2010) Common origins of

hippocampal Ivy and nitric oxide synthase expressing neurogli-

aform cells. J Neurosci 30(6):2165–2176

Tricoire L, Pelkey KA, Erkkila BE, Jeffries BW, Yuan X, McBain CJ

(2011) A blueprint for the spatiotemporal origins of mouse

hippocampal interneuron diversity. J Neurosci

31(30):10948–10970

Valjent E, Bertran-Gonzalez J, Herve D, Fisone G, Girault JA (2009)

Looking BAC at striatal signaling: cell-specific analysis in new

transgenic mice. Trends Neurosci 32(10):538–547

Walling SG, Brown RA, Miyasaka N, Yoshihara Y, Harley CW

(2012) Selective wheat germ agglutinin (WGA) uptake in the

hippocampus from the locus coeruleus of dopamine-beta-

hydroxylase-WGA transgenic mice. Front Behav Neurosci 6:23

Wheeler DW, White CM, Rees CL, Komendantov AO, Hamilton DJ,

Ascoli GA (2015) Hippocampome.org: a knowledge base of

neuron types in the rodent hippocampus. Elife 4. doi:10.7554/

eLife.09960

Brain Struct Funct (2017) 222:1897–1911 1911

123