Vol. 176, No. 21JOURNAL OF BACTERIOLOGY, Nov. 1994, p. 6688-66960021-9193/94/$04.00+0Copyright © 1994, American Society for Microbiology

Analysis of Promoters Controlled by the Putative Sigma FactorAlgU Regulating Conversion to Mucoidy in Pseudomonas

aeruginosa: Relationship to 0.E and Stress ResponseD. W. MARTIN, M. J. SCHURR, H. YU, AND V. DERETIC*

Department of Microbiology, University of Texas Health Science Centerat San Antonio, San Antonio, Texas 78284-7758

Received 1 June 1994/Accepted 22 August 1994

Alginate overproduction by mucoid Pseudomonas aeruginosa is a critical pathogenic determinant expressedby this organism during chronic infections in cystic fibrosis. Conversion to mucoidy and a subsequent loss ofmucoid character can occur via different mutations in the algU mucA mucB gene cluster. The algU gene encodesa 22.2-kDa putative alternative sigma factor required for expression of the critical alginate biosynthetic genealgD. In this work, algU transcription was studied by S1 nuclease protection analysis. Transcription from thepromoter proximal to the algU coding region was found to be dependent on AlgU. The -35 and -10 sequencesof this newly mapped promoter showed strong similarity to the promoters of two other critical aig genes: algDand algR. The proximal promoter ofalgR was also shown to depend on algU. Interestingly, the putative -35 and-10 regions of all three promoters displayed striking similarity to the consensus sequence of the UE-dependentpromoters in Escherichia coli and Salmonella typhimurium. This 24-kDa cr factor, controlling genes participatingin resistance to high temperatures and oxidative stress, has been previously biochemically characterized, butthe gene for cE remalned unidentified. To examine whether AlgU is related to (E, the effect ofalgU inactivationon the sensitivity ofP. aeruginosa to killing by heat and reactive oxygen intermediates was tested. Two isogenicpairs of algU+ and algU mutant strains were compared. The algU mutants, irrespective of the mucoid statusof the parental strains, displayed increased sensitivity to killing by paraquat, known to generate intracellularsuperoxide radicals, and heat. Further global homology searches revealed the presence of a previouslyunrecognized E. coli gene with the predicted gene product showing a striking 66% identity to AlgU. Thecorresponding gene from S. typhimurium was cloned and sequenced, and it displayed one amino acidsubstitution relative to its E. coli equivalent. AlgU and its close homologs in E. coli and S. typhimurium may befunctionally related.

A hallmark of Pseudomonas aeruginosa isolates from cysticfibrosis (CF) patients is that they frequently display mucoidcolony morphology. This is a result of the overproduction ofthe exopolysaccharide alginate (23) and has been considered toplay a major role in the pathogenesis of the CF lung (21).Despite the clear association of mucoidy in P. aeruginosa andCF, the exact role of alginate in the chronic infection of the CFlung is still equivocal. Among the proposed functions foralginate overproduction are (i) interference with effectiveopsonization (46) and phagocytosis (reviewed in reference 21);(ii) suppression of lymphocyte function (35); (iii) formation ofbiofilms (31) with accompanying phenomena of increasedresistance to antibiotics in aged biofilms (1), adhesion (47), andsuppression of oxidative burst in neutrophils (26); and (iv) adirect role of the exopolysaccharide polymer in scavengingreactive oxygen intermediates (ROI) such as superoxide (50)and hypochlorite (32) produced by phagocytic cells. The latterproperty of alginate has remained largely unexplored, despitethe fact that P. aeruginosa cells in the inflamed CF lung arefrequently exposed to ROI and other noxious products ofneutrophils and macrophages (2, 21).The alginate biosynthetic pathway has been partially eluci-

dated (4, 19, 39, 48), while the regulation of alginate produc-tion and the processes governing its overexpression in mucoid

* Corresponding author. Mailing address: Department of Microbi-ology, University of Texas Health Science Center at San Antonio, 7703Floyd Curl Dr., San Antonio TX 78284-7758. Phone: (210) 567-3962.Fax: (210) 567-6612. Electronic mail address: Deretic@uthscsa.edu.

cells have only now begun to be understood. Recent studiesconcerning the molecular mechanisms of conversion to mu-coidy (13, 36-38) have defined several mutations in regulatorygenes leading to the establishment of mucoid character. Not-withstanding an apparent complexity of the system described inseveral recent reviews (13, 39, 45), a limited number of pointssuffice to highlight the major relationships epitomized in theregulation of the algD promoter: (i) the algD gene (10), whichheads the cluster of alginate biosynthetic genes (5, 7), under-goes strong transcriptional activation in mucoid cells; (ii)transcription of this gene is dependent on AlgU, a putativesigma factor (36) which in turn is controlled by the products oftwo negative regulatory genes, mucA and mucB (37, 38); (iii)algU, mucA, and mucB (also known as algT, algS, and algN,respectively [22]) form a cluster of genes in which mutationscausing conversion to mucoidy or pseudoreversion to nonmu-coid phenotype can occur (38, 49); (iv) inactivation of mucA(as observed in CF isolates) (38), and mucB on the P.aeruginosa chromosome (37) or in a study carried out with aplasmid (22), can effect conversion to mucoidy; (v) second-sitesuppressor mutations in algU are epistatic to mucA mutationsand can cause a loss of the mucoid character (49); (vi)additional mutations and pathways may contribute to theconversion to mucoidy (23, 38, 51); and (vii) ancillary regula-tory elements (39), in particular the response regulator AlgR(9, 28, 29, 42, 43), further stimulate or modulate algD activity.The central role of the algU mucA mucB gene cluster in the

conversion to mucoidy, and the proposed role for AlgU as thesigma factor directing algD transcription, prompted us to

6688

on January 24, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

AlgU, CFE, AND RESISTANCE TO STRESS 6689

TABLE 1. Bacterial strains and plasmids used in this study

Strain or Relevant characteristics Reference orplasmid source

P. aeruginosaPAO1 Prototroph, Alg- 25PA06852 PAO1 algU::Tcr This workPA0568 FP2+ mucA2 (Alg+) leu-38 20PA0670 PA0568 algU::Tcr (Alg-) 36

E. coliRK4936 oxyR' btuB::TnJO met glu arg asp 6TA4112 RK4336 oxyRA3 [oxyA (oxyR-butB)3] 6K-12 Wild type G. StorzGS08 K12 oxyR::Kmr G. StorzDH5a lacZAM15 recA1 Bethesda Research

LaboratoriesPlasmidspVDX18 IncQ Apr(Cbr) mob' xylE+ 30

(promoterless)pPr2 algR promoter, -370 to +398 in This work

pVDX18Pr3 algR promoter, -80 to +398 in 12

pVDX18pDMU100 ColEl (pUC12) algU::Tcr Apr(Cbr) 36

mob+pRK2013 ColEl mob+ tra+ (RK2) Kmr 18

further analyze the expression characteristics of this clusterand to examine the roles of individual genes in this system. Bygenetically reconstituting algU-dependent algD transcription ina heterologous host, we have recently established that AlgUacts directly on algD and that its activity is counteracted byMucA and MucB (49). In the present study, we report themapping of the algU promoter and the dependence of thispromoter on AlgU. Furthermore, we show that the proximalpromoter of algR, which is activated in mucoid cells (12, 43),also depends on AlgU. All three critical alginate promoters,algD, algR, and algU, display highly conserved -35 and -10regions, which in turn closely resemble the consensus sequenceof promoters dependent on Escherichia coli orE. This sigmafactor directs transcription of the rpoH and htrA genes in E.coli (15, 33), which participate in heat shock response and are

necessary or beneficial for survival at elevated temperatures inthis organism. In the case of the htrA equivalent in Salmonellatyphimurium (27), this gene plays a role in the resistance toreactive oxygen species such as superoxide and hydroxyl radi-cals. We present data suggesting that AlgU participates in P.aeruginosa resistance to ROI and heat challenges and may beanalogous to a'.

MATERIALS AND METHODS

Bacterial strains, plasmids, and media. Bacterial strainsused in this study are described in Table 1. P. aeruginosa was

grown on Pseudomonas isolation agar (Difco) or LB supple-mented with carbenicillin (300 jig/ml) or tetracycline (300jig/ml for Pseudomonas isolation agar; 50 jig/ml for LB) whenrequired. E. coli was grown on LB. All incubations were carriedout at 37°C except in heat killing experiments.

Genetic manipulations and recombinant DNA methods.Transcriptional fusion plasmids were transferred to P. aerugi-nosa by triparental conjugations as previously described (30).PA06852, an algU::Tcr derivative of the standard geneticstrain PAO1, was generated by using previously publishedprocedures and constructs (36). DNA amplification by PCRwas carried out as previously described (38). For cloning of S.

typhimurium rpoE, the following primers were used with totalDNA from S. typhimurium c3181: IMO1 (5'GCGGCTACGCCCA1TlTGG3') and IM02 (5'CCGGCTGCGCCGCTACCG3'). DNA sequencing was carried out by one of the followingmeans. (i) For S. typhimurium rpoE, direct sequencing of PCRproducts was performed with an AmpliTaq cycle sequencingkit (Perkin-Elmer) and 32P-end-labeled primers. (ii) For se-quencing of the algU promoter region, previously generatedoverlapping deletion clones of this chromosomal locus in M13mTM010 were subjected to sequencing by the dideoxy-chaintermination method with a Sequenase version 2.0 sequencingkit (United States Biochemical) and [ot-35S]dATP (1,000 Ci/mmol; NEN, Dupont). (iii) To generate sequencing ladders forS1 nuclease protection analyses, the primers UR23 (5'CTTGTCTCCGCGCTGTAC3') and R1 (5'GGTTCGTCATCGACAA3') were used for algU and algR, respectively.

SI nuclease protection and transcriptional fusion analyses.P. aeruginosa strains were grown in LB to an A595 of 0.5, andtotal RNA was isolated through a cushion of 5.7 M CsCl asfollows. The culture was rapidly cooled in a dry ice-ethanolbath. Cells were collected by centrifugation and washed oncein cold lysis buffer (50 mM Tris-HCl [pH 7.5]). The cell pelletwas resuspended in 5 ml of lysis buffer at room temperature,and 1 ml of 20% sodium dodecyl sulfate was added. The lysiswas completed by a short incubation at 67°C followed byaddition of 4 g CsCl. After the CsCl was dissolved, another 5ml of lysis buffer was added. The precipitate formed upondissolving CsCl was removed by centrifugation at 11,000 rpm inan SM24 rotor. The clear supernatant was carefully layeredatop a 2-ml cushion of 5.7 M CsCl. RNA was collected at thebottom of the tube after centrifugation in an SW50.1 rotor at35,000 rpm and 15°C for 12 h. Single-stranded uniformlylabeled probes were generated by using algU and algR clones inM13 bacteriophages as previously described (12, 43). Theconstruct used for algU analysis was AUM7 (36), which con-tained a 3.6-kb HindlIl-EcoRI fragment cloned in mTMO10.The construct for algR analysis was A3/28, which contained a2.4-kb Hindll-EcoRI deletion derivative of the algR regioncloned in mTMO10 (9). In the case of algU, the primer UR23was used to generate single-stranded probes. In the case ofalgR, the primer R1 was used for this purpose. Followingpolymerization, the radiolabeled probes were cut with SphIand XhoI for algU and algR, respectively, gel purified, andannealed to 100 ,ug of total RNA. After incubation for 1 h at67°C, the products were digested with S1 nuclease in 280 mMNaCl-50 mM sodium acetate (pH 4.6)-4.5 mM ZnS04-20 ,ugof denatured salmon sperm DNA per ml, precipitated, andanalyzed on sequencing gels. For mapping of the 5' mRNAends, sequencing ladders were generated with the same prim-ers and M13 templates used to generate the probes. Thisprovides a means of pinpointing the initiation site when thesequencing ladder is run alongside the products of S1 nucleaseprotection reactions. This procedure is highly sensitive becauseof the use of a uniformly labeled probe of high specific activitybut also results in extra bands seen on the gels due to chainbreaks of the probe related to the radioactive decay, inaddition to the nibbling of the probe by S1 nuclease. Thisphenomenon has been previously described (12, 43). Tran-scriptional fusion analyses, catechol 2,3-dioxygenase activitydetermination, and catechol 2,3-dioxygenase unit definitionhave been previously described (30). Background activity wasmonitored by using Pr4 (12) and subtracted from the valuesdetected with PPr2 and PPr3.Heat killing assays. Heat killing assays were carried out as

follows. Bacterial cultures were grown to an A595 of 0.35 andthen incubated at 50°C for the indicated times. Appropriate

VOL. 176, 1994

on January 24, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

6690 MARTIN ET AL.

GTCCGGTTGGCCTACCCAGCGGCACAGAGCCCGGGCCCTGAGCCCGATGCAATCCATTTT 1 2 G A T C61 CGCGGGGCCCGGACACGATGICCGGGGCCGCACGTCACGAGCGAGCAAAAAACTCGTGAC

-35 -10 1121 GCATGCTTGGAGGGGAalTGCAAGAAGCCCGAGTCTTCTTGGCAAGACGATTCG

SD algU181 CTGGGACGCTCGAAGCTCCTCCAGGTTCGAAGAGGAGCTTTCATGCTAACCCAGGAA...

M L T Q E

FIG. 1. Nucleotide sequence of the region upstream of the algUstructural gene containing the proximal algU promoter. The -35 and-10 canonical sequences of the AlgU-dependent proximal promoterof algU are overlined. The arrow indicates the algU mRNA 5' end(boldface) initiating at the proximal algU promoter. SD, putativeribosomal binding site. The first five codons of the algU gene are

shown.

cell dilutions were plated on LB in triplicate, and viable cellswere scored as CFU. Survival was expressed as the percentageof input cells which retained viability. For each time point,three independent samples were used.

Susceptibility to killing with ROI. Sensitivity to paraquat orH202 was determined by measuring the diameter of the zoneof killing surrounding disks impregnated with ROI-generatingagents. Disks (6 mm; BBL) were soaked with 10 pI of 1.9%paraquat or 3% H202 and placed on 2 ml of soft agar (0.6%)layer (containing 100 RI of P. aeruginosa or E. coli overnightcultures) solidified on top of 25-ml 1.5% agar in LB. Measure-ments were done after overnight incubation.

Nucleotide sequence accession numbers. The algU structuralgene sequence has been previously reported (accession num-ber L02119). The algU promoter sequence has been submittedto GenBank (accession number U08380). The translated se-

quence of the E. coli rpoE has been submitted to the SWISS-PROT database (accession number P34086) and is encoded bythe DNA region upstream of the nadB gene (divergentlytranscribed), for which the nucleotide sequence has beenpreviously reported (44) (accession number D13169). Thesequence of the S. typhimurium rpoE gene has been submittedto GenBank (accession number U05669).

RESULTS

Mapping of the algU promoter. The complete nucleotidesequence of the algU structural gene has been previouslyreported (36). To facilitate mapping of the promoter for algU,the nucleotide sequence of the 223-bp region upstream of thealgU initiation codon was determined (Fig. 1). This region,cloned into the M13 bacteriophage vector mTM010, was usedin conjunction with the previously published methods fordetermination of the mRNA 5' end by S1 nuclease protectionanalysis using total RNA and uniformly radiolabeled single-stranded probes (11, 43). These experiments were carried outwith RNA from several mucoid PAO derivatives and CFisolates. In each case, the mRNA start site was found to be 55nucleotides upstream of the algU initiation codon (Fig. 2). Inaddition, another band of protection has been invariablyobserved, suggesting the presence of at least one other tran-scriptional initiation site(s) located significantly further up-stream (Fig. 3A).

Transcription from the proximal algU and aLgR promoters isdependent on AlgU. Next, we investigated what regulates algUtranscription and whether any of its promoters are dependenton AIgU. For this purpose, the isogenic strains PA0568(algU+) and PA0670 (algU::Tcr) were used. The results ofthese experiments (Fig. 3A) indicate that the transcript withthe 5' end at the position -55 relative to the algU initiationcodon was absent in the algU::Tcr strain PAO670. In contrast,the signal corresponding to the mRNA transcript initiating

FIG. 2. S1 nuclease protection mapping of the proximal algUpromoter. A uniformly labeled single-stranded probe generated byusing the oligonucleotide primer UR23 was annealed with RNA fromPA0568; after treatment with S1 nuclease, the products were sepa-

rated on a sequencing gel. Lane 1 contained one-third of the reactionproduct in lane 2. GATC, sequencing ladder generated by using thesame primer (UR23) employed to generate the probe. Up, 5' end ofalgU mRNA initiating at the proximal algU promoter.

further upstream was present in the algU mutant strain,although at diminished intensities (Fig. 3A). These resultswere confirmed by analyzing other isogenic pairs of strains(data not shown) and by overloading or overexposing the lanewith the reaction products, using RNA from strain PA0670(Fig. 3A). Regardless of the increased amount of the S1nuclease reaction products loaded on the gel, which intensifiedthe upper band of protection to the levels seen in PA0568, thetranscript with the 5' end at the position -55 could not bedetected in the algU::Tcr background. These findings wereconsistent with the notion that the proximal promoter of algU(mRNA 5' end at the position -55) was dependent on AlgU.Since transcription from the upstream promoter(s) was occur-ring at detectable levels in the algU mutants tested, theproximal transcript of algU could not represent a processingproduct of a longer upstream transcript.

Transcription of the algU gene strongly resembles the pre-viously reported transcription of the algR gene, which also

A.

uu

UP>

+ , + I

I I G B. G_ CRRUPP

A T C

FIG. 3. Regulation of algU and algR transcription by AlgU. S1nuclease analysis was carried out as described in the legend to Fig. 2.The algR-specific primer R1 was used to generate the probe and thesequencing ladder in panel B. RNAwas from PA0568 (algU+) or fromits algU::Tcr derivative PA0670 (algU-). (A) Analysis of algU tran-scription. Up, 5' end of the algU transcript initiating at the proximalpromoter ofialgU. UU1, band representing full protection of the probedue to transcription upstream of Up. algU*, overexposed autoradio-gram of the lane marked algU-. (B) Analysis of algR transcription. Rp,5' end of the algR transcript initiating at the proximal promoter ofalgR. Ru, band representing full protection of the probe due totranscription upstream of Rp.

1

J. BACMERIOL.

I

on January 24, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

AlgU, rE, AND RESISTANCE TO STRESS 6691

C) PA0568* PA0670

-35 -10P . a. a 1 gU GAGAACTTTTGCAAGAAGCCCGAGTCTATCTTGGCKP . a. algD CGGAACTTCCCTCGCAGAGAAAACATCCTATCACCUP . a. algR GGGCACTTTTCGGGCCTAAAGCGAGTCTCAGCGTCU

E . c. htrA CGGAACTTCAGGCTATAAAACGAATCTGAAGAACNE . c. rpoH TTGAACTTGTGGATAAAATCACGGTCTGATAAAACX

GE consensus GAACTT

pPr2 pPr3

algR-xylE

FIG. 4. Transcriptional fusion analysis of algR promoter activity inalgU+ and algU::Tcr backgrounds. Two algR promoter fusion plasmids,pPr2 and Pr3 (12), were introduced into PA0568 (mucoid, algU+)and its algU::Tcr derivative PA0670, and transcriptional activity was

determined. The fusion in PPr2 contained a DNA fragment beginningat -370 upstream and ending at +398 downstream of the algR mRNAstart site cloned into the xylE-based transcriptional fusion plasmidpVDX18. The fusion in Pr3 contained a DNA fragment beginning at-80 upstream and ending at -398 downstream of the algR mRNAstart site cloned into pVDX18. The deletion in pPr3 eliminates theupstream algR promoter(s) (12, 43). Catechol 2,3-dioxygenase (CDO;the xylE gene product) activity in sonic extracts was determined andexpressed in units per milligram of total protein. T-Bars indicatestandard errors.

plays an important role in the regulation of alginate synthesisand algD activity (9, 28, 29, 42, 43). Transcription of the algRgene is also initiated from at least two promoters (12, 41, 43).In the case of algR, the proximal promoter is activated inmucoid strains, while the transcript initiating further upstreamdoes not depend on the mucoid status of the cell (41, 43). Toinvestigate whether algR transcription depends on AlgU, an S1nuclease protection analysis was carried out with PA0568(algU+) and PA0670 (algU::Tcr). These studies are illustratedin Fig. 3B and were further confirmed by using additionalstrains (data not shown). The following conclusions regardingalgR transcription could be made: (i) like the proximal pro-moter of algU, the proximal promoter of algR was dependenton AlgU for transcription; and (ii) the upstream transcriptionwas also taking place in algU mutants. This was additionallyinvestigated by using two algR-xylE transcriptional fusions withconstructs selected from the previously reported series ofconsecutively increasing deletions at the 5' end of the algRpromoter (12). These results are illustrated in Fig. 4. ConstructPPr2 contains sequences -370 bp upstream of the algR mRNAstart site, while construct PPr3 (12) begins at position -80upstream of the algR mRNA start site and contains only theproximal algR promoter. Both fusions gave reduced activity inthe algU mutant background. Construct PPr2 maintained someactivity that could be explained by the presence of an upstreampromoter, as previously noted (41). However, construct PPr3depended fully on the proximal promoter of algR. This activitywas abrogated in the algU::Tcr background, which was inkeeping with the results of the S1 nuclease protection analyses.The AlgU-dependent promoters display a -35 and -10

consensus sequence similar to that of the rE-dependentpromoters. Another known algU-dependent promoter is algD(36). This gene is activated in mucoid cells (10), and itstranscription is abrogated in algU mutant strains (36). Whenwe compared the sequences of the proximal promoters of algU

FIG. 5. Conservation of the -35 and -10 sequences of AlgU-dependent and uE-dependent promoters. The -35 and -10 regionsare overlined, and conserved nucleotides are in boldface. A dash abovea nucleotide indicates that the 5' end of the corresponding mRNA hasbeen determined. P.a., P. aeruginosa; E.c., E. coli. The followingpromoters are included: the proximal promoters of algU (this work)and algR (12), the algD promoter (11), the promoter of the E. coli htrAgene (33), also known as degP (53), and the P3 promoter of the heatshock sigma factor (&32) gene (rpoH) (15, 54). The E. coli htrA andrpoH (P3) promoters have been shown to depend on a' (15). Alsoincluded are the -35 and -10 aE consensus sequences (15, 33).

and algR with those of the algD promoter, a striking conserva-tion of the -35 regions was observed (Fig. 5). A somewhat lesspronounced but nevertheless recognizable similarity could bedetected within the -10 region. Another somewhat surprisingobservation has been made (13) that these sequences, inparticular the -35 region, strongly resembled the previouslypublished consensus promoter sequence for the crE-dependentpromoters (16, 33).The presence of AlgU homologs in E. coli and S. typhi-

murium. Further analysis of the published literature on the aEfactor indicated that this 24-kDa polypeptide has been char-acterized only at the biochemical level (15, 16, 54) and that thecorresponding gene has not been identified. Two observationsprompted us to consider the possibility that AlgU and UE arerelated: (i% the similarity of the AlgU-dependent promotersand the cr -promoter consensus sequence reported here and(ii) the observation that there is a close homolog of AlgU in E.coli (see further). Nevertheless, the fact that the (FE gene hasnot been characterized and that the primary structure of thissigma factor was not known prevented us from being able todirectly assess the relationship.The initial studies of algU (36), which have revealed a

limited but significant similarity of AlgU to the alternativesigmfa factor u' (14), have also shown some similarities to the

° family of sigma factors (34). These similarities are notsufficient to permit a direct detection of the AlgU relationshipto sigma factors by global homology searches and can beobserved only in pairwise comparisons (36). However, sincethe publication of the algU sequence (36), the GenBank andother databases have grown considerably. Performing an ad-ditional global homology search with AlgU, we found a

previously unrecognized gene in E. coli within GenBank entryD13169, with the predicted gene product displaying an unusu-ally high similarity to AlgU. This E. coli gene is locatedimmediately downstream of the nadB gene and has the capac-ity to encode a polypeptide displaying 66% identity (91%overall similarity) with AlgU (Fig. 6).To further confirm the validity of the predicted translated

sequence of the AlgU homolog in E. coli, the correspondingchromosomal region from S. typhimurium was cloned by usingPCR and primers beginning at the position 466 bp upstream ofthe coding region and ending 438 bp downstream of this gene.A 744-bp region encompassing the expected open readingframe of S. typhimurium was sequenced (Fig. 7), and it showedseveral differences within the putative coding region (39 of 576nucleotides) relative to the corresponding E. coli gene at the

12

10

8

6

4

2

TCTGA

VOL. 176, 1994

on January 24, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

6692 MARTIN ET AL. J. BACTERIOL.

P.a. *LT *EQ_IQ .*R _KR D LK ILG IV FH DAQEAQE.C. *SE *LT _V* _ K QK N VR VAS VS Y P SG.DVP

P.a.E. c. D

S S.t.P.a. *EDDFGD HD-ES_ R ARDDI EA T-HQQQ2 T_.LE.c. IIEENESG GEISN NLESE LRQ I FREE II

P.a. FEDI IT V- Q KA A* 193E.c. *LD-E *A I-D - 7 _ N KVI R * 191FIG. 6. Alignment of the predicted amino acid sequences of AlgU from P. aeruginosa (P.a.), and its close homologs from E. coli (E.c.) and S.

typhimurium (S.t.). AlgU controls conversion to mucoidy in P. aeruginosa (36, 38). Its counterpart in E. coli is the translated sequence (accessionnumber P34086) of the previously unrecognized gene within GenBank entry D13169 (44). This gene has been designated rpoE (see Discussion).The translated sequence of S. typhimurium rpoE (accession number U05669) displays only one amino acid substitution (serine in place of alanine53) relative to its homolog in E. coli (triangle).

nucleotide level. However, the open reading frame was fullypreserved, and the putative translated product differed only inone amino acid compared with its E. coli counterpart (Fig. 6).These results suggest that AlgU in P. aeruginosa and itshomologs in E. coli and S. typhimurium are most likely closelyrelated.

Inactivation ofalgU increases P. aeruginosa susceptibility tokilling by heat. Since no sequence information is currentlyavailable on the 24-kDa polypeptide defined as the o(r of E.coli and no mutants in the corresponding gene have beenreported, alternative approaches were used to test the hypoth-esis that AlgU and or are related. The following is therationale which was applied in these studies. aE transcribeshtrA (15, 33) (also known as degP [53]), which is required forthe viability of E. coli at increased temperatures (33). The htrAgene is transcribed only by the aE-containing RNA polymeraseholoenzyme (15, 33). Thus, the phenotypic consequences ofmutations in the gene encoding aE or its analogs should

-351 GTCTACAACATGACAAACAAAAACAAATGCGTAACGGAACTTTACGA

include the results of mutations in htrA. Mutations in the htrAgene render E. coli more sensitive to heat killing (33). Ourrepeated attempts to inactivate the algU homolog in E. coli didnot result in the generation of an insertionally inactivatedmutant in this organism, presumably because such mutationsaffected cell viability. Nevertheless, we were in the position totest the sensitivity to heat killing of the existing and addition-ally generated algU mutants in P. aeruginosa. Two pairs ofisogenic algU+ and algU::Tcr strains were tested. The first pairof strains, PA0568 (algU+) and PA0670 (algU::Tcr), havebeen previously described (36). The parent strain PA0568 hasthe mucA2 mutation that renders this strain mucoid, and itsnonmucoid derivative PA0670 contains insertionally inacti-vated algU. The second pair of strains included PA01 (thestandard genetic strain of P. aeruginosa which carries thewild-type algUmucA mucB gene cluster and is nonmucoid) andits isogenic algU::Tcr mutant strain PA06852 generated forthis study. In each case, the percent survival upon exposure to

-10

kACATAGACAcTCTAAccTGTTGCTTGCTcATAGTCGGcTTATGGAGTGCGG

101 TTTCGAAAGCGCGTGGAAA7TTGGTTTGGGGAGACATTACCTCGGATGAGCGAGCAGTTAACGGACCAGGTCCTGGTTGAACGGGTCCACAAGGGAGATCM S E Q L T D Q V L V E R V Q K G D Q

201

301

401

AGAAAGCCTTTAACTTACFGGTAGTLGCGCTACCAGCATAAAGTGGGAGTCTGGTTTCCCGCTATGTGCCATCGGGCGACGTTCCCGATGTCGTACAGGAK A F N L L V V R Y Q H K V A S L V S R Y V P S G D V P D V V Q E

ATCATTTATTAASGCCTATCGCGCGCYL FATTCTTTCCRGCOGATAGTFCYTTTTATACCTGGTTGTATCGTATTGCGGTCAATACCGCGAAGAACTACS F I K A Y R A L D S F R G D S A F Y T W L Y R I A V N T A K N Y

L V A Q G R R P P S S D V D A I E A E N F E S G G A L K E I S N P E

501 AGAACTTAATGTTGTCAGAAGAACTNAGACAGATAGTTTTCCGAACTATTGAGTCCCTCCCGGAAGATLACGTATLGCAATCACCTTACGGGAGCTIGAN L M L S E E L R Q I V F R T I E S L P E D L R M A I T L R E L D

601 TGGCCTLGAGCTASGEGAGATAGCGGCTATCATGGATTGTCCGGTRGGGACGGTGCGTTCACGTATCTTCCGGGCGCGIGAAGCTATTGATAATAAAGTTG L S Y E E I A A I M D C P V G T V R S R I F R A R E A I D N K V

701 CAACCGCTTATCAGGCGTTGACGATAGCGGGATACTGGAAAAGGQ P L I R R *

FIG. 7. Nucleotide and deduced amino acid sequences of the rpoE gene of S. typhimurium (GenBank accession number U05669). The putative-35 and -10 regions resembling aE promoter consensus sequences (see Fig. 5) are overlined.

Av

CTGGTTGCGCAGGCoGCGTCGTCCGCCTTCCAGTGATGTAGACGCGATTGAAGCAGAAAACT7WAAAGCGGCGGCGCGCTGAAAGAAATTTCr-AAC!C!r-'TrI

D Ts D

on January 24, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

AlgU, uE, AND RESISTANCE TO STRESS 6693

A 100

10F

2an0

0.1 I . . . .fI . . . . . W^. . I

0 10 20 30 40 50min

B 100

10

w1 -*- PA0568> 1 -w - PAO670

:00.1

0.01

FIG. 8. Heaeruginosa PAfor the mucoiPA0670 (36).times, and suiMethods). Bapercentage of

the temperamutant straiiof the mucoand could n(prediction thP. aeruginosaq..,1 - r" we

TABLE 2. Differential sensitivity to killing by paraquatin algU+ and algUP. aeruginosa

Growth inhibition zone

Straina Phenotype" and (mean diam [mm] ± SE)CParaquat (1.9%) H202 (3%)

P. aeruginosaPAO1 NM (algU+) 17.0 ± 0.3 11.0 ± 0.2PA06852 NM (algU::Tc') 22.1 ± 0.4 11.2 ± 0.4PA0568 M (algU+) 16.3 ± 0.3 10.1 ± 0.2PA0670 NM (algU::Tc') 23.0 ± 0.6 10.1 ± 0.2

E. coliRK4936 oxyR+ 13.7 ± 0.3 17.2 ± 0.2TA4112 oxyRA3 13.9 ± 0.2 30.9 ± 0.9K-12 oxyR 13.3 ± 0.4 17.3 ± 0.2GS08 oxyR::Kmr 13.4 ± 0.1 27.3 ± 0.6

a Two pairs of isogenic P. aeruginosa algU+ and algU::Tcr strains (PA01 andPA06852; PA0568 and PA0670) were tested. As controls, two pairs of isogenicE. coli oxyR+ and oxyR mutant strains (RK4936 and TA4112; K12 and GS08)were analyzed (6).'NM, nonmucoid; M, mucoid.c Sensitivities to killing by paraquat, known to generate intracellular °2 (17),

and H202 are expressed as diameters of growth inhibition zones surroundingfilter disks impregnated with 10 ,ul of indicated solutions of ROI-generatingagents (see Materials and Methods). P values (t test) for the first and the secondpairs of isogenic algU+ and algU strains, respectively, were 2.3 X 10-8 and 1.1 X10-2 (paraquat sensitivity) and 0.692 and 1.0 (H202 sensitivity). P values for thefirst and the second pairs of isogenic oxyR+ and oxyR strains, respectively, were0.69 and 0.71 (paraquat sensitivity) and 6.9 X 10-1 and 3.0 X 10-11 (H202sensitivity).

. . . . .. . .. , .. . , . . . . . . | increase in the zone of inhibition (P < 0.01), the algU mutantstrains displayed a higher sensitivity to paraquat. As in the case

0 10 20 30 40 50 of the heat killing experiments, this effect was independent ofmin the mucoid status of the parental (algU+) strain. The same

-at killing curves for the standard genetic strain p. strains, however, did not show any differences in sensitivity to01 (algU+) and its algU::Tcr derivative PA06852 and hydrogen peroxide, suggesting the selectivity of the defectid strain PA0568 (algU+) and its algU::Tcr derivative toward superoxide radicals. As controls, two isogenic pairs ofThe strains were incubated at 50°C for the indicated E. coli strains carrying functional or defective oxyR were

rviving cells were counted as CFU (see Materials and included. The oxyR gene (6, 52) controls cellular response totrs indicate standard errors. Survival is expressed as hydroxyl radicals, and mutants which lack this activator of ainput CFU at time zero. complex H202-inducible regulon (6, 8, 17) are more suscepti-

ble to killing by H202 and organic peroxides but are notimpaired with regard to resistance to superoxide radicals. As

iture of 50'C was significantly reduced in algU expected, the oxyR mutants displayed selective sensitivity tothiso0°aefgnifcantlywaseirH202 (and cumene peroxide; data not shown) in contrast to

ns (Fig. 8). Importantly, this effect was irrespective the algU mutants, thus underscoring the specificity of algUaid or nonmucoid character of the parental strain mutations for susceptibility to killing by paraquat. Theseot be attributed to alginate production. Thus, the results, taken together with the heat sensitivity of algU mu-iat algU inactivation may affect the susceptibility of tants, are congruent with the predictions based on the func-z to heat killing, based on the hypothesis that AlgU tions of the known aE-controlled genes.%. rnZs+nfl xxzen h"r%-vltana o- may De reiaLea, was Dom1e OUt.

Effects of algU inactivation on the susceptibility of P.aeruginosa to ROI. The previously published reports indicatethat genes transcribed by the RNA polymerase holoenzymecontaining cE play a broad role in bacterial survival uponexposure to different environmental insults. For example, thehtrA gene equivalent of S. typhimurium has been found tocontribute to the resistance of this organism to agents whichgenerate reactive oxygen radicals (27). To test whether algUinactivation renders P. aeruginosa cells more susceptible toROI, we tested the same two pairs of algU+ and algU::Tcrstrains used in heat killing experiments (PAO1 and PA06852;PA0568 and PA0670) for susceptibility to killing by variousROI-generating compounds. The assays were carried out withparaquat, a superoxide-generating redox cycling compound (6,17), and hydrogen peroxide. The results of these experimentsare shown in Table 2. As judged by the statistically significant

DISCUSSIONThe significance of the findings presented in this work is

severalfold: (i) the regulatory circuitry controlling the algDpromoter has been further refined; (ii) a previously unsus-pected link between the control of mucoidy, a critical virulencefactor expressed by P. aeruginosa in CF, and the globalregulation involved in heat shock (24) and oxidative stress (8,17) response in bacteria has been investigated; and (iii) highlyconserved factors homologous to AlgU in other bacteria havebeen found.The experiments described in this study provide the follow-

ing new information regarding the alginate system in P.aeruginosa: (i) the proximal promoter of algU has beenmapped, (ii) the dependence of the proximal algU promoter onthe putative sigma factor AlgU has been shown, and (iii) the

VOL. 176, 1994

on January 24, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

6694 MARTIN ET AL.

FIG. 9. Regulatory circuitry controlling algD transcription andexpression of mucoid phenotype. At the top of the regulatory cascadecontrolling algD expression is the algU mucA mucB gene clustercontrolling conversion to mucoidy in P. aeruginosa. At least twopromoters, U. (distal) and Up (proximal), control expression of algU.The transcription of algR occurs from RU (distal) and Rp (proximal)promoters. The algD gene appears to be transcribed from a singlepromoter, PD. Expression of algD is absolutely dependent upon twofactors: AlgU, the putative sigma factor initiating transcription at PD(36), and AlgR, a response regulator which binds to the three sitesRB1, RB2, and RB3 (42) upstream of PD and further augmentsexpression of algD (43). MucA and MucB act to suppress AlgU activity(37), and mutations in these genes (37, 38) can cause conversion tomucoidy by relieving AlgU from negative regulation. This is associatedwith increased transcription of alginate regulatory genes which up-

regulate the critical algD promoter. Activation of algD may also affectexpression of the large cluster of alginate biosynthetic genes locateddownstream of algD (5, 7). The relationship of algUto rpoE and its rolein resistance to oxidative stress mediators and elevated temperaturesindicate that this circuitry, in the absence of muc mutations, may beresponsive to environmental stress and related to up-regulation ofbroader defense mechanisms in P. aeruginosa.

dependence of the previously mapped proximal algR promoteron AlgU has been demonstrated. Taken together, these resultsfurther define the regulatory elements controlling transcriptionof the critical alginate biosynthetic gene algD (Fig. 9). Inwild-type nonmucoid cells (e.g., the standard genetic strainPAO1) and in the absence of appropriate exogenous stimuli,transcription of algU and algR from the AlgU-independentupstream promoters (Fig. 9) most likely provides a baselineexpression of these two critical regulatory factors. In mucoidmutants (37, 38), and presumably in the wild-type cells underinducing conditions which remain to be defined, transcriptionof algU and algR is further stimulated as a result of theactivation of their respective AlgU-dependent promoters.This, in turn, supplies adequate levels of the alternative sigmafactor AlgU and the response regulator AlgR to activate thealgD promoter.The low-level expression of algU is additionally controlled by

the accessory elements mucA and mucB (Fig. 9), most likely atthe posttranslational level. Mutations in mucA or mucB, suchas those described for mucoid P. aeruginosa strains (37, 38),cause activation of the AlgU-dependent systems. Frameshiftand nonsense mutations in the mucA gene have been detectedin a significant number of CF isolates (38), and gene replace-

ments with such mutant alleles have provided conclusiveevidence that these mutations cause conversion to mucoidy(38). Likewise, insertional inactivation of mucB (algN) on thechromosome of previously nonmucoid strains can lead toalginate overproduction and mucoid colony morphology (37).Plasmids carrying deletions of this gene have also been re-ported to induce alginate production (22). Recently, the role ofmucA and mucB has been reproduced in a genetically recon-stituted heterologous system (49). However, not all mucoidstrains display mutations within the algU mucA mucB cluster(38), suggesting that alternative mechanisms may be contrib-uting to the conversion process. It is possible that otherparticipants exist (36, 51) which affect the functional state orstability of AlgU or its negative regulators. In support of thisnotion are the observations that a plasmid-borne wild-typecluster, expressing intact mucA and mucB genes, can suppressmucoidy even in some strains in which mutations in mucA havenot been detected (36, 38).

It is reasonable to assume that the complex system control-ling alginate synthesis has evolved to permit its physiologicalinduction. Thus, the emergence of mucoid mutants in CF,where these strains appear to have selective advantage, mayrepresent only one extreme state of the system. Moreover, theanalyses presented in this work suggest that the alginate systemmay be a part of a broader bacterial stress response. Specifi-cally, the observation that algU mutants display decreasedresistance to heat killing and intracellularly generated super-oxide radicals, irrespective of the mucoid or nonmucoid back-ground of the parent strain, suggests that the controlled algpromoters represent only a subset of targets regulated byAlgU. This putative sigma factor is likely to contribute to amore comprehensive defense against environmental stress.What seems to be of particular significance is that such stressfactors are likely to operate in the CF lung; ROI released byphagocytic cells, which abound in the lumen of the respiratorytract of CF patients, could be a major contributing factor to theinduction of appropriate systems in P. aeruginosa in thisenvironment. Consistent with this notion are the earlier re-ports that alginate can act as a scavenger of superoxide radicalsand hypochlorite (32, 50).

In further support of a more general role for AlgU is theanalysis of the conserved sequences within the known AlgU-dependent promoters. The promoters of algD, algR, and algUdisplay a strong conservation of the -35 and -10 regions andshare a high level similarity with the consensus sequence (15,33) for promoters transcribed by the CuE RNA polymeraseholoenzyme. While AlgU displays only a marginal homologywith the members of the u70 family of sigma factors (34), theglobal homology search reported here has revealed the pres-ence of a previously unrecognized gene in E. coli displaying66% identity (91% overall similarity) of its translated geneproduct with AlgU. We have proposed to name this gene rpoE(SWISS-PROT accession number P34086). While this workwas in preparation, several groups have independently con-curred with this designation or proposed similar nomenclatureas cumulatively presented in the annotation for the SWISS-PROT entry under accession number P34086. Furthermore,preliminary results (55) suggest that algU and rpoE are func-tionally interchangeable. On the basis of such observations andadditional studies (see below), we postulate that rpoE and algUencode crE in E. coli and its equivalent in P. aeruginosa,respectively.The auE holoenzyme is known to direct transcription of two

genes: (i) htrA, a gene essential for E. coli survival at temper-atures above 420C (15, 33), and (ii) rpoH, the heat shock sigmafactor gene, from one of its multiple promoters (15, 54). The

J. BACTERIOL.

on January 24, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

AlgU, oE, AND RESISTANCE TO STRESS 6695

htrA gene is exclusively dependent on a' for transcription andthus can serve as a reference to assay for this sigma factor (15,54). We have preliminarily examined the effects of algUinactivation on htrA expression. This has been possible on thebasis of an independent line of investigation of another P.aeruginosa locus, termed algW (3, 36). This locus has beenisolated on the basis of its ability to suppress alginate produc-tion when present on a plasmid in mucoid strains (36). Analysisof this region has revealed that it contains a gene which showsa high degree of homology with htrA (3). These independentobservations further support the hypothesis that algU encodesthe uE equivalent in P. aeruginosa.

In this work, a previously unsuspected link between thecontrol of mucoidy in P. aeruginosa, a critical virulence factorexpressed by this organism in CF, and the global regulationinvolved in heat shock (24) and oxidative stress (8, 17, 27)responses in bacteria has been reported. The observation thatAlgU is required for resistance to a specific ROI challengesuggests that in addition to the known regulators of oxidativestress, oxyR and soxRS (6, 8), which activate distinct regulonsupon exposure to hydrogen peroxide or superoxide, AlgU andby extension uE may represent the next tier of global regulatorsparticipating in oxidative stress response in some bacteria.However, a is likely to be involved in response to diverseenvironmental insults, as it has been shown that the systems itregulates protect bacterial cells from heat killing. Furthermore,it has been reported that alterations affecting outer membraneproteins, which are normally regulated by osmolarity changes,may affect uE function in E. coli (40). It is also worth notingthat while algU activity is controlled by two downstreamaccessory genes, mucA and mucB (algN) (22, 37), we haveobserved the presence of a mucA homolog in E. coli down-stream of rpoE (56). This finding suggests that the regulatorymechanisms participating in the recognition of stress media-tors or their effects are also conserved.The new insight regarding AlgU function and its possible

role in stress response may help explain certain aspects ofmicrobial pathogenesis in CF. Since P. aeruginosa in the CFlung is constantly exposed to large numbers of macrophagesand neutrophils (2, 21), it is likely that ROI released byphagocytic cells induce the stress response in this bacterium.This process, along with the selection of mucoid mutants whichcan emerge via inactivation of mucA, a negative regulator ofAlgU activity (38), not only may contribute to alginate over-production but perhaps also can induce other factors andantigens (e.g., HtrA). Since inflammation is the main cause ofirreversible tissue damage in CF, it will be important toinvestigate whether and which P. aeruginosa stress proteinscontribute to the immunopathology of the CF lung.

ACKNOWLEDGMENTS

We thank J. Galan for the S. typhimunum c3181 DNA and G. Storzfor E. coli oxyR mutants.

This work was supported by grant AI31139 from the NationalInstitute of Allergy and Infectious Diseases, grant G229 from theCystic Fibrosis Foundation, and a grant from Texas Higher EducationCoordinating Board. D. W. Martin was a Cystic Fibrosis Foundationpredoctoral fellow. M. J. Schurr was a Cystic Fibrosis Foundationpostdoctoral fellow.

REFERENCES1. Anwar, H., J. L. Strap, and J. W. Costerton. 1992. Establishment

of aging biofilms: possible mechanism of bacterial resistance toantimicrobial therapy. Antimicrob. Agents Chemother. 36:1347-1351.

2. Boat, T. F., A. L. Beadet, and M. J. Welsh. 1989. Cystic fibrosis, p.

2649-1680. In J. Stanbury et al. (ed.), The metabolic basis ofinherited disease. McGraw-Hill, New York.

3. Boucher, J. C., and V. Deretic. Unpublished data.4. Chitnis, C. E., and D. E. Ohman. 1990. Cloning of Pseudomonas

aeruginosa algG, which controls alginate structure. J. Bacteriol.172:2894-2900.

5. Chitnis, C. E., and D. E. Ohman. 1993. Genetic analysis of thealginate biosynthetic gene cluster of Pseudomonas aeruginosashows evidence for an operonic structure. Mol. Microbiol. 8:563-590.

6. Christman, M. F., R. W. Morgan, F. S. Jacobson, and B. N. Ames.1985. Positive control of a regulon for defenses against oxidativestress and some heat-shock proteins in Salmonella typhimurium.Cell 41:753-762.

7. Darzins, A., S. K. Wang, R I. Wanags, and A. M. Chakrabarty.1985. Clustering of mutations affecting alginic acid biosynthesis inmucoid Pseudomonas aeruginosa. J. Bacteriol. 164:516-524.

8. Demple, B., and C. F. Amabile-Vuevas. 1991. Redox redux: thecontrol of oxidative stress responses. Cell 67:837-839.

9. Deretic, V., R. Diksit, W. M. Konyecsni, T. Misra, A. M.Chakrabarty, and T. K. Misra. 1989. The algR gene, whichregulates mucoidy in Pseudomonas aeruginosa, belongs to a classof environmentally responsive genes. J. Bacteriol. 171:1278-1283.

10. Deretic, V., J. F. Gill, and A. M. Chakrabarty. 1987. Gene algDcoding for GDP mannose dehydrogenase is transcriptionally acti-vated in mucoid Pseudomonas aeruginosa. J. Bacteriol. 169:351-358.

11. Deretic, V., J. F. Gill, and A. M. Chakrabarty. 1987. Pseudomonasaeruginosa infection in cystic fibrosis: nucleotide sequence andtranscriptional regulation of the algD gene. Nucleic Acids Res.15:4567-4581.

12. Deretic, V., and W. M. Konyecsni. 1989. Control of mucoidy inPseudomonas aeruginosa: transcriptional regulation of algR andidentification of the second regulatory gene, algQ. J. Bacteriol.171:3680-3688.

13. Deretic, V., M. J. Schurr, J. C. Boucher, and D. W. Martin. 1994.Conversion of Pseudomonas aeruginosa to mucoidy in cystic fibro-sis: environmental stress and regulation of bacterial virulence byalternative sigma factors. J. Bacteriol. 176:2773-2780.

14. Dubnau, E., J. Weir, G. Nair, L. Carter III, C. Moran, Jr., and I.Smith. 1988. Bacillus sporulation gene spoOH codes for c30 (UH).J. Bacteriol. 170:1054-1062.

15. Erickson, J. W., and C. A. Gross. 1989. Identification of thesubunit of Escherichia coli RNA polymerase: a second alternatefactor involved in high-temperature gene expression. Genes Dev.3:1462-1471.

16. Erickson, J. W., V. Vaughn, W. A. Walter, F. C. Neidhardt, andC. A. Gross. 1987. Regulation of the promoters and transcripts ofrpoH, the Escherichia coli heat shock regulatory gene. Genes Dev.1:419-432.

17. Farr, S., and T. Kogoma. 1991. Oxidative stress responses inEscherichia coli and Salmonella typhimurium. Microbiol. Rev.55:561-585.

18. Figurski, D. H., and D. R. Helinski. 1979. Replication of anorigin-containing derivative of plasmid RK2 dependent on aplasmid function provided in trans. Proc. Natl. Acad. Sci. USA76:1648-1658.

19. Franklin, M. J., and D. E. Ohman. 1993. Identification of algF inthe alginate biosynthetic gene cluster of Pseudomonas aeruginosawhich is required for alginate acetylation. J. Bacteriol. 175:5057-5065.

20. Fyfe, J. A. M., and J. R. W. Govan. 1980. Alginate synthesis inmucoid Pseudomonas aeruginosa: a chromosomal locus involved incontrol. J. Gen. Microbiol. 119:443-450.

21. Gilligan, P. H. 1991. Microbiology of airway disease in patientswith cystic fibrosis. Clin. Microbiol. Rev. 4:35-51.

22. Goldberg, J. B., W. L. Gorman, J. L. Flynn, and D. E. Ohman.1993. A mutation in algN permits trans activation of alginateproduction by algT in Pseudomonas species. J. Bacteriol. 175:1303-1308.

23. Govan, J. R. W. 1988. Alginate biosynthesis and other unusualcharacteristics associated with the pathogenesis of Pseudomonasaeruginosa in cystic fibrosis, p. 67-96. In E. Griffiths, W. Donachie,

VOL. 176, 1994

on January 24, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

6696 MARTIN ET AL.

and J. Stephen (ed.), Bacterial infections of respiratory and gastro-intestinal mucosae. IRL Press, Oxford.

24. Grossman, A. D., J. W. Erickson, and C. A. Gross. 1984. The htpRgene product of E. coli is a sigma factor for heat-shock promoters.Cell 38:383-390.

25. Holloway, B. W. 1955. Genetic recombination in Pseudomonasaeruginosa. J. Gen. Microbiol. 13:572-581.

26. Jensen, E. T., A. Kharazmi, K. Lam, J. W. Costerton, and N.Hoiby. 1990. Human polymorphonuclear leukocyte response toPseudomonas aeruginosa grown in biofilms. Infect. Immun. 58:2383-2385.

27. Johnson, K, I. Charles, G. Dougan, D. Pickard, P. O'Gaora, G.Costa, T. Ali, I. Miller, and C. Hormaeche. 1991. The role ofstress-response protein in Salmonella typhimunum virulence. Mol.Microbiol. 5:401-407.

28. Kato, J., and A. M. Chakrabarty. 1991. Purification of theregulatory protein AlgR1 and its binding in the far upstreamregion of the algD promoter in Pseudomonas aeruginosa. Proc.Natl. Acad. Sci. USA 88:1760-1764.

29. Kimbara, K., and A. M. Chakrabarty. 1989. Control of alginatesynthesis in Pseudomonas aeruginosa: regulation of the aigRi gene.Biochem. Biophys. Res. Commun. 164:601-608.

30. Konyecsni, W. M., and V. Deretic. 1988. Broad-host-range plasmidand M13 bacteriophage-derived vectors for promoter analysis inEscherichia coli and Pseudomonas aeruginosa. Gene 74:375-386.

31. Lam, J., R Chan, K. Lam, and J. W. Costerton. 1980. Productionof mucoid microcolonies by Pseudomonas aeruginosa within in-fected lungs in cystic fibrosis. Infect. Immun. 28:546-556.

32. Learn, D. B., E. P. Brestel, and S. Seetharama. 1987. Hypochloritescavenging by Pseudomonas aeruginosa alginate. Infect. Immun.55:1813-1818.

33. Lipinska, B., S. Sharma, and C. Georgopoulos. 1988. Sequenceanalysis and regulation of the htrA gene of Eschernchia coli: aU32-independent mechanisms of heat-inducible transcription. Nu-cleic Acids Res. 16:10053-10067.

34. Lonetto, M., M. Gribskov, and C. A. Gross. 1992. The U70 family:sequence conservation and evolutionary relationship. J. Bacteriol.174:3843-3849.

35. Mai, G. T., W. K. Seow, G. B. Pier, J. G. McCormack, and Y. H.Thong. 1993. Suppression of lymphocyte and neutrophil functionsby Pseudomonas aeruginosa mucoid exopolysaccharide (alginate):reversal by physiochemical, alginase, and specific monoclonalantibody treatments. Infect. Immun. 61:559-564.

36. Martin, D. W., B. W. Holloway, and V. Deretic. 1993. Character-ization of a locus determining the mucoid status of Pseudomonasaeruginosa: AlgU shows sequence similarities with a Bacillus sigmafactor. J. Bacteriol. 175:1153-1164.

37. Martin, D. W., M. J. Schurr, M. H. Mudd, and V. Deretic. 1993.Differentiation of Pseudomonas aeruginosa into the alginate-pro-ducing form: inactivation of mucB causes conversion to mucoidy.Mol. Microbiol. 9:495-506.

38. Martin, D. W., M. J. Schurr, M. H. Mudd, J. R W. Govan, B. W.Holloway, and V. Deretic. 1993. Mechanism of conversion tomucoidy in Pseudomonas aeruginosa infecting cystic fibrosis pa-tients. Proc. Natl. Acad. Sci. USA 90:8377-8381.

39. May, T. B., D. Shinabarger, R Maharaj, J. Kato, L. Chu, J. D.DeVault, S. Roychoudhury, N. Zielinski, A. Berry, R K. Rothmel,T. K. Mistra, and A. M. Chakrabarty. 1991. Alginate synthesis byPseudomonas aeruginosa: a key pathogenic factor in chronic

pulmonary infections of cystic fibrosis patients. Clin. Microbiol.Rev. 4:191-206.

40. Mecsas, J., P. E. Rouviere, J. W. Erickson, T. J. Donohue, andC. A. Gross. 1993. The activity of UE, and Eschenichia coli heatinducible a-factor, is modulated by expression of outer membraneproteins. Genes Dev. 7:2618-2628.

41. Mohr, C. D., and V. Deretic. 1990. Gene-scrambling mutagenesis:generation of insertional mutations in the alginate regulatoryregion of Pseudomonas aeruginosa. J. Bacteriol. 172:6252-6260.

42. Mohr, C. D., J. H. J. Leveau, D. P. Krieg, N. S. Hibler, and V.Deretic. 1992. AlgR-binding sites within the algD promoter makeup a set of inverted repeats separated by a large interveningsegment of DNA. J. Bacteriol. 174:6624-6633.

43. Mohr, C. D., D. W. Martin, W. M. Konyecsni, J. R W. Govan, S.Lory, and V. Deretic. 1990. Role of the far-upstream sites of thealgD promoter and the algR and rpoN genes in environmentalmodulation of mucoidy in Pseudomonas aeruginosa. J. Bacteriol.172:6576-6580.

44. Nashimoto, H., and H. Uchida. In press.45. Ohman, D. E., J. B. Goldberg, and J. L. Flynn. 1990. Molecular

analysis of the genetic switch activating alginate production, p.28-35. In A. M. Chakrabarty, B. Iglewski, S. Kaplan, and S. Silver(ed.), Pseudomonas: biotransformations, pathogenesis, and evolv-ing biotechnology. American Society for Microbiology, Washing-ton, D.C.

46. Pier, G. B., G. J. Small, and H. B. Warren. 1990. Protection againstmucoid Pseudomonas aeruginosa in rodent models of endobron-chial infections. Science 249:537-540.

47. Ramphal, R., and G. B. Pier. 1985. Role of Pseudomonas aerugi-nosa mucoid exopolysaccharide in adherence to tracheal epithelialcells. Infect. Immun. 61:559-564.

48. Schiller, N. L., S. R Monday, C. M. Boyd, N. T. Keen, and D. E.Ohman. 1993. Characterization of the Pseudomonas aeruginosaalginate lyase gene (algL): cloning, sequencing, and expression inEscherichia coli. J. Bacteriol. 175:4780-4789.

49. Schurr, M. J., D. W. Martin, M. H. Mudd, and V. Deretic. 1994.Gene cluster controlling conversion to alginate-overproducingphenotype in Pseudomonas aeruginosa: functional analysis in aheterologous host and role in the instability of mucoidy. J.Bacteriol. 176:3375-3382.

50. Simpson, J. A., S. E. Smith, and R T. Dean. 1989. Scavenging byalginate of free radicals released by macrophages. Free RadicalBiol. Med. 6:347-353.

51. Sokol, P. A., M. Z. Luan, D. G. Storey, and P. Thirukkumaran.1994. Genetic rearrangement associated with in vivo mucoidconversion of Pseudomonas aeruginosa PAO is due to insertionelements. J. Bacteriol. 176:553-562.

52. Storz, G., L A. Tartaglia, and B. N. Ames. 1990. Transcriptionalregulator of oxidative stress-inducible genes: direct activation byoxidation. Science 248:189-194.

53. Strauch, K., and J. Beckwith. 1988. An Escherichia coli mutationpreventing degradation of abnormal periplasmic proteins. Proc.Natl. Acad. Sci. USA 85:1576-1580.

54. Wang, Q., and J. M. Kaguni. 1989. A novel sigma factor is involvedin expression of the rpoH gene of Escherichia coli. J. Bacteriol.171:4248-4253.

55. Yu, H., and V. Deretic. Unpublished data.56. Yu, H., M. J. Schurr, D. W. Martin, and V. Deretic. Unpublished

data.

J. BACTERIOL.

on January 24, 2021 by guesthttp://jb.asm

.org/D

ownloaded from