Analysis of Liver X Receptor target gene expression across ...4198... · Analysis of Liver X...
Transcript of Analysis of Liver X Receptor target gene expression across ...4198... · Analysis of Liver X...
Analysis of Liver X Receptor target gene expression across species
A Thesis
Submitted to the Faculty
of
Drexel University
by
Paul Bart Noto
in partial fulfillment of the
requirements for the degree
of
Doctor of Philosophy
May 2013
ii
DEDICATIONS
This thesis is dedicated with great affection to my family, loving parents and wife and, above all, my daughter Elena.
iii
ACKNOWLEDGMENTS
I’d like to acknowledge the many people who helped me in obtaining my degree.
I’m very grateful to Dr. Joe Bentz for giving me the opportunity to work on the
doctoral program at Drexel University. His support and mentorship were essential
to get through in this long process.
Enormous gratitude to Dr. Deepak Lala and Dr. Yuri Bukhtiyarov for their
constant effort in helping me throughout my research project. Their endless
mentorship not only allowed me to complete my studies but also greatly
contributed to my scientific growth and forma mentis.
I would also like to thank all my committee members, Dr. Brian McKeever, Dr.
Daniel Marenda, Dr. Felice Elephant and Dr. Nianli Sang for their generous
commitment to my research progress over the past few years.
I also want to thank Vitae Pharmaceuticals for allowing me to continue my
education by giving me the opportunity to work on my research project while
pursuing other discovery programs.
I’d like to thank Dr. Gerard McGeenan and Dr. Colin Tice for their valuable
scientific inputs, support and contributions to my research.
I also appreciate all the help provided by Susan Cole, by assisting and supporting
me through all the steps of the process.
Last, but not least, I’d like to acknowledge everyone in my family for their
endless support and understanding during difficult moments, alleviated by the
loving hugs of my little princess Elena.
Thank you all!
iv
TABLE OF CONTENTS LIST OF TABLES ...............................................................................................vii
LIST OF ILLUSTRATIONS ............................................................................ viii
ABSTRACT ............................................................................................................ x
1: INTRODUCTION .......................................................................................... 12
1.1 Liver X Receptors (LXRs) – Structure and general mechanism of action. . 12
1.2 LXR isoforms and their expression across tissues ....................................... 13
1.3 Physiological aspects of LXR target gene expression ................................. 14
1.3.1. Cholesterol and lipid metabolism ........................................................ 14
1.3.2. Inflammation ........................................................................................ 17
1.3.3. Alzheimer’s disease (AD) ..................................................................... 19
1.4 Pharmacological modulation of LXRs......................................................... 20
1.4.1. Therapeutic applications ..................................................................... 21
1.4.2. Drug Discovery: strategies, animal models and challenges ............... 22
1.5 Implications of differential LXR target gene expression across species ..... 26
2: REGULATION OF SPHINGOMYELIN PHOSPHODIESTERASE,
ACID-LIKE 3A GENE (SMPDL3A) BY LIVER X RECEPTORS ................ 28
Abstract .............................................................................................................. 29
2.1 Introduction .................................................................................................. 30
2.2 Material and Methods .................................................................................. 33
2.2.1. Cell Culture and Transfection ............................................................. 33
2.2.2. Gene expression microarray analysis. ................................................. 34
2.2.3. Analysis of the SMDPL3A expression in cells and tissues. ................. 35
2.2.4. Animal studies ...................................................................................... 36
2.2.5. SMPDL3A protein analysis.................................................................. 36
2.2.6. Gel Mobility Shift Assays. .................................................................... 37
2.2.7. Chromatin Immunoprecipitation Assays.............................................. 38
2.3 Results ......................................................................................................... 39
v
2.3.1 Genome Wide Gene Expression Analysis and validation by real time-
PCR (RT-PCR) ............................................................................................... 39
2.3.2 Expression of SMPDL3A is induced by LXR agonists. ......................... 40
2.3.3. Knockdown of LXRs in THP-1-derived macrophages reduces the
expression of the SMPDL3A gene.................................................................. 41
2.3.4. Both Retinoid X Receptor (RXR) and LXR ligands induce SMPDL3A
gene expression. ............................................................................................. 42
2.3.5 LXR directly interacts with LXR response element in SMPDL3A
promoter region. ............................................................................................ 43
2.3.6. LXRs regulate the SMPDL3A gene in a cell type-specific fashion in
human cells. ................................................................................................... 43
2.3.7. SMPDL3A is not induced by LXRs in mice. ......................................... 44
2.4 Discussion .................................................................................................... 45
2.5 References .................................................................................................... 48
2.6. Figure Legends............................................................................................ 51
3: LXR TRANSCRIPTOME IN CYNOMOLGUS MONKEY BRAIN ......... 70
Abstract .............................................................................................................. 71
3.1 Introduction .................................................................................................. 72
3.2 Material and Methods .................................................................................. 75
3.2.1. Cell Culture and treatment of CCF-STTG1 cells ................................ 75
3.2.2. ApoE protein analysis in human CCF-astrocytes. ............................... 75
3.2.3. Experimental protocol for monkey studies .......................................... 76
3.2.4. Gene expression analysis in cells and tissues. ..................................... 77
3.2.5. ABCA1, ApoE and Apo-AI protein analysis in monkey cerebrum. ...... 77
3.2.6. Analysis of Aβ peptides levels in monkey cerebra and hippocampi. ... 78
3.2.7. RNA-sequencing of monkey cerebra. ................................................... 79
3.3 Results .......................................................................................................... 81
3.3.1 VTP-5 is a potent, LXRβ selective modulator. ...................................... 81
3.3.2 VTP-5 increases expression of ABCA1 and ApoE in human astrocytes.
........................................................................................................................ 81
3.3.3. VTP-5 significantly increases expression of ABCA1 and ApoE in
cerebral cortex in primates. ........................................................................... 82
vi
3.3.4. VTP-5 lowers Aβ1-42 in primate hippocampus in a dose-dependent
manner. .......................................................................................................... 82
3.3.5 LXRα and LXRβ are expressed at different levels in Cynomolgus brain
and liver tissues.............................................................................................. 83
3.3.6. RNA-sequencing of monkey cerebrum confirms the induction of several
known LXR target genes by treatment with VTP-5. ....................................... 84
3.3.7. VTP-5 promotes Aβ clearance without affecting key genes involved in
Aβ synthesis/degradation ............................................................................... 85
3.3.8. VTP-5 induces mRNA expression of Apo-AI and PLAT genes. ........... 85
3.3.9. VTP-5 increases the Apo-AI protein levels in Cynomolgus cerebrums.
........................................................................................................................ 86
3.3.10.KEGG pathway analysis reveals a possible involvement of LXRs in
neurotransmission. ......................................................................................... 86
3.4 Discussion .................................................................................................... 87
3.5 References .................................................................................................... 91
3.6. Figure Legends............................................................................................ 95
3.7 Table Legends .............................................................................................. 97
CONCLUSIONS AND FUTURE DIRECTIONS ........................................... 111
LIST OF REFERENCES .................................................................................. 115
APPENDIX A ..................................................................................................... 124
VITA.................................................................................................................... 127
vii
LIST OF TABLES Chapter 3: Table 1 ………………………………………………………………………… 98 Table 2 ………………………………………………………………………… 99 Table 3 ……………………………………………………………………….. 100
viii
LIST OF ILLUSTRATIONS Chapter 2: Figure 1A .………………………………………………………………………. 55 Figure 1B .………………………………………………………………………. 56 Figure 1C ……………………………………………………………………….. 57 Figure 2A ……………………………………………………………………….. 58 Figure 2B .………………………………………………………………………. 59 Figure 2C ……………………………………………………………………...... 60 Figure 2D ……………………………………………………………………...... 61 Figure 3A ……………………………………………………………………...... 62 Figure 3B ……………………………………………………………………...... 63 Figure 4A ……………………………………………………………………...... 64 Figure 4B ……………………………………………………………………...... 65 Figure 5A ……………………………………………………………………...... 66 Figure 5C ……………………………………………………………………...... 67 Figure 6A ……………………………………………………………………...... 68 Figure 6B ……………………………………………………………………...... 69 Chapter 3: Figure 1A .……………………………………………………………………... 101 Figure 1B .……………………………………………………………………... 102 Figure 2A .……………………………………………………………………... 103 Figure 2B ……………………………………………………………………… 104 Figure 3 ....……………………………………………………………………... 105 Figure 4A ……………………………………………………………………… 106
ix
Figure 4B ……………………………………………………………………… 107 Figure 5A ……………………………………………………………………… 108 Figure 5B ……………………………………………………………………… 109 Figure 6 ...………………………………………………………………………..110
x
ABSTRACT Analysis of Liver X Receptor target gene expression across species
Paul Bart Noto
Deepak Lala, Supervisor, Ph.D.
Joe Bentz, Supervisor, Ph.D.
Liver X Receptors (LXRs) are nuclear hormone receptors that regulate key genes
involved in cholesterol and lipid metabolism. As transcription factors, LXRs turn
on the gene expression of ATP-binding cassette transporters (ABCs) which
mediate cholesterol efflux from cells, such as macrophage foam cells. In addition,
LXRs have the ability to down regulate pro-inflammatory genes. Therefore, LXRs
have been extensively investigated as potential therapeutic targets for the
treatment of conditions that result from altered cholesterol and lipid homeostasis
as well as increased inflammation, such as atherosclerosis and Alzheimer’s
disease (AD). This latter is a neurodegenerative disorder that is associated with
the deposition of brain amyloid plaques, constituted by insoluble Aβ peptides.
LXR activation has been shown to promote Aβ clearance from the brain via the
ABCA1-apolipoprotein E pathway and improve cognitive functions in rodent
models of AD. The ability of LXRs to promote reverse cholesterol transport
(RCT) and suppress inflammation has been characterized in both human and
murine in vitro systems, but mostly in rodent in vivo systems. Although the LXR
signaling pathway is mostly conserved across species, LXRs can also regulate
their target genes in a species-, tissue- and isoform-specific fashion. Therefore the
purpose of this work is to investigate the regulation of target genes by LXRs
across species and identify, if any, differences that could aid us in understanding
xi
the role of LXR modulation in higher species, such as non-human primates. In the
context of inflammation, the LXR genome landscape had only been investigated
in murine macrophages. Therefore, we performed a genome-wide screen in human
THP-1 macrophages. This led us to the identification of a novel LXR target gene,
Sphingomyelin Phosphodiesterase Acid-Like 3A Gene (SMPDL3A), which is
regulated in a species- and tissue-specific fashion, being restricted to human blood
cells, with no induction by LXRs in mouse cellular systems. Next, we confirmed
the LXR-mediated upregulation of ABCA1 and ApoE genes in Cynomolgus
monkey brains, as this had never been investigated in higher species. In addition,
we also characterized the LXR transcriptome in Cynomolgus brain by RNA-
sequencing in order to identify potential novel LXR target genes.
For the first time in higher species, we show Apolipoprotein AI upregulation in
the brain of Cynomolgus monkey upon treatment with a synthetic LXR
modulator.
12
CHAPTER 1: INTRODUCTION
1.1 Liver X Receptors (LXRs) – Structure and general mechanism of action.
LXRs are members of the superfamily of nuclear hormone receptors. These share
one common scaffold, comprising two major structural elements: a DNA binding
domain (DBD), which is generally highly conserved and that contains two zinc
fingers which bind to specific hormone response elements (HREs) within target
genes; and a ligand binding domain (LBD), which is moderately conserved in
sequence and highly conserved in structure between the different nuclear
receptors. Along with the DBD, the LBD contributes to the dimerization interface
of the receptor and in addition, binds co-activator and co-repressor proteins
(Mangelsdorf et al., 1995; Kumar and Thompson, 1999).
Although all nuclear receptors have the same structural features, they have been
classified in several different ways according to their mode of action, functioning
either as monomers or homo-/hetero dimers (Novac and Heinzel, 2004).
LXRs regulate the expression of their target genes as heterodimers and require
retinoid X receptors (RXRs) as obligate heterodimer partners to bind to their
cognate response elements, which can be activated by both RXR and LXR ligands
(Willy et al., 1995). Indeed, the RXR/LXR heterodimer is characterized by dual
ligand permissivity since it can be activated by a rexinoid (RXR agonist), an LXR
agonist, or both agonists in a synergistic fashion (Shulman et al., 2004). The
mechanism by which LXRs activate gene transcription is known as
transactivation. This consists in the direct binding of the receptors to LXR
13
response elements (LXREs) present within the promoters of the target genes. In
particular, LXREs typically consist of an (A/G)GGTCA direct repeat motif spaced
by 4 nucleotides (DR4). In the absence of LXR ligands, the LXR/RXR
heterodimer is associated with co-repressors, such as nuclear co-repressor 1
(NCoR1) or silent mediator of retinoic acid receptor and thyroid receptor
(SMRT), and constitutively bound to the promoter of LXR target genes (Chen and
Evans, 1995; Horlein et al., 1995; Hu et al., 2003). This is known as basal gene
repression. The presence of ligands causes dissociation of NCoR1 from the
promoters of LXR target genes and induces recruitment of co-activators by LXRs
(Hu et al., 2003; Wagner et al., 2003) and the subsequent initiation of gene
transcription.
An alternative mechanism of gene regulation by LXRs, which is not LXRE-
dependent, is transrepression. This relies upon the ligand-dependent, ubiquitin-
like modifications of the lysine residues in the LBDs of LXRs with small
ubiquitin related modifier (SUMO) proteins (Ghisletti et al., 2007). The
SUMOylated LXRs are recruited to the promoter regions of certain constitutively
repressed genes preventing the clearance of the co-repressor (NCoR1) complex in
response to transcriptional stimuli.
1.2 LXR isoforms and their expression across tissues
Two isoforms are known, LXRα (NR1H3) and LXRβ (NR1H2). LXRα is
primarily expressed in liver, macrophages, intestine and adrenals while LXRβ is
ubiquitously expressed across all tissues (Song et al., 1994; Whitney et al., 2002)
with particularly high levels in the developing brain (Fan et al., 2008). The
homology between human LXRα and LXRβ is significant, with approximately 76
14
and 78 % amino acid identity in their DBD and LBD, respectively. LXRs are also
highly conserved between rodents and humans. Human and murine LXRα/LXRβ
paralogs are almost identical, given the 99% homology in amino acid sequence in
both their DBD and LBD (Lee et al. 2008).
1.3 Physiological aspects of LXR target gene expression
LXRs act as sensors of oxysterols (OHCs), which are metabolites of cholesterol,
across several metabolically active tissues, such as liver, kidney and brain. Known
natural ligands for LXRs are 22(R)-hydroxycholesterol, 24(S)-
hydroxycholesterol, 27-hydroxycholesterol and 24(S),25-epoxycholesterol, with
this latter being the most potent agonist (Janowski et al., 1999). Therefore,
whenever intracellular cholesterol reaches high levels, oxysterol-activated LXRs
turn on the expression of key genes involved in cholesterol metabolism. In
addition, LXRs activate the transcription of several genes that lead to fatty acid
synthesis and lipogenesis, leading to hypertriglyceridemia and hepatosteatosis.
1.3.1. Cholesterol and lipid metabolism
Elevated concentrations of intracellular cholesterol and OHCs lead to activation of
LXRs, which turn on the expression of ABC transporters in multiple tissues, such
as ABCA1/G1 in macrophages (Venkateswaran et al., 2000; Kennedy et al., 2001)
and ABCG5/G8 in liver and intestine (Repa et al., 2002). ABCA1 mediates the
transport of phospholipids and cholesterol to poorly-lipidated apolipoproteins,
such as Apo-AI (Chambenoit et al., 2001), contributing to stabilization of high-
density lipoproteins (HDL) and therefore setting the first step of RCT. On the
contrary, ABCG1 promotes cholesterol efflux to phospholipid-containing
15
acceptors, such as HDL particles previously lipidated by ABCA1 (Gelissen et al.,
2006). ABCG5/G8 transporters play a crucial role in the secretion of hepatic
cholesterol into bile, as mice lacking either transporter show increased and
reduced levels of cholesterol in the liver and bile acids, respectively (Yu et al.,
2002). Also, mutations in either ABCG5 or ABCG8 human genes result into
sitosterolemia, an autosomal recessive disorder associated with elevated levels of
phytosterols in plasma and an increased risk of developing atherosclerosis (Lee et
al., 2001). An additional LXR target gene is the phospholipid transfer protein
(PLTP) (Lafitte et al., 2003). This mediates the transfer of phospholipids and
cholesterol from triglyceride (TG)-rich lipoproteins (TRL) into HDL, contributing
to the formation of β-HDL particles, which are very efficient acceptors of
cholesterol from peripheral cells (Lee at al., 2003). Indeed, as PLTP knockout
mice manifest the lack of phospholipid transfer from TRL to HDL (Jiang et al.,
1999), transgenic mice over-expressing human PLTP show increased plasma β-
HDL plasma levels along with reduced accumulation of cholesterol in
macrophages, when compared to wild-type mice (van Haperen et al., 2000). In
liver, LXRs have been also shown to upregulate CYP7Α1, a rate-limiting enzyme
involved into the synthesis of bile acids from cholesterol, in rodents but not in
humans (Menke et al., 2002).
The role of LXRs in cholesterol uptake is less clear. A 2006 study showed the
presence of an LXRE within the promoter of the low-density lipoprotein receptor
(LDLR) gene, as activation of LXRs with an agonist led to the induction of the
gene in human hepatoblastoma cells (Ishimoto et al., 2006). On the contrary, in
mice, others have shown the LXR-mediated upregulation of the inducible
degrader of the LDLR (IDOL), an E3 ubiquitin ligase that mediates the
16
ubiquitination of LDLR, thus targeting it for degradation (Zelcher et al., 2009).
An additional role of LXRs in cholesterol homeostasis is at the intestinal level.
LXR activation has been shown to reduce the expression levels of the Niemann–
Pick C1 like 1 (NPC1L1) gene in both human colon carcinoma cells (CaCo-2) and
mouse intestine (Duval et al., 2006). NPC1L1 is required for intestinal cholesterol
absorption and it is primarily expressed in the brush border membrane of
enterocytes in the small intestine (Altmann et al. 2004).
Additionally, LXRs positively regulate the expression of cholesterylester transfer
protein (CETP), which mediates a bidirectional exchange of cholesteryl esters and
triglycerides between lipoproteins, such as HDL and LDL (Luo and Tall, 2000;
Barter et al., 2003). Importantly, plasma CETP activity is restricted to higher
species, as rodents do not express the CETP gene. The implications of this
species-specific difference will be discussed in the context of pharmacological
LXR modulation.
In liver, upon ligand binding, LXRs are also responsible for the upregulation of
the sterol regulatory element-binding protein-1c (SREBP1c) gene (Repa et al.,
2000) and several other genes involved in lipogenesis, such as fatty acid synthase
(FAS) (Joseph et al., 2002) and stearoyl-CoA desaturase (SCD) (Sun et al., 2003).
Oral administration of a synthetic LXR agonist, T0901317, to mice and hamsters
leads to increased plasma and hepatic triglyceride levels (Schultz et al., 2000).
Control of lipogenesis in not restricted to plasma and liver only, as LXR
activation has also been shown to promote lipid accumulation in human mature
adipocytes as well (Juvet et al., 2003).
17
1.3.2. Inflammation
Treatment of macrophages with lipopolysaccharide (LPS) leads to activation of
the Toll-like receptor-4 (TLR-4) (Takeuchi et al., 1999) and subsequent induction
of cytokines involved in innate immunity and inflammatory response (Akira et al.,
2001). LXRs have been shown to act as negative regulators of key inflammatory
genes, such as tumor-necrosis factor alpha (TNFα), interleukins (IL-1β, IL-6),
cyclooxigenase 2 (COX-2), inducible nitric oxide synthase (iNOS) and necrosis
factor kB (NFkB) in murine macrophages simulated with LPS (Joseph et al.,
2003). Additionally, in murine peritoneal macrophages, ligand-activated LXRs
can counteract the LPS-induced effects on the expression of matrix
metalloproteinase 9 (MMP-9), which is involved in degradation of extracellular
matrix (ECM) components during normal and pathogenic tissue remodeling
(Castrillo et al., 2003).
The mechanism by which LXRs exert anti-inflammatory properties relies on the
association with co-repressor complexes that prevent the recruitment of the
transcription machinery onto the promoters of several pro-inflammatory genes,
such as iNOS, IL-1β and TNFα, in mouse primary macrophages (Ghisletti et al.,
2007). As mentioned earlier, this is known as transrepression.
LXRs may also play a significant role in innate immunity. In response to
intracellular bacteria, induction of LXRα expression in murine macrophages leads
to increased survival, as well as decreased apoptosis, and LXR-mediated gene
upregulation of the Scavenger Receptor Cystine-Rich Repeat Protein (Spα)
(Joseph et al., 2004), which appears to have a critical role in the clearance of
bacterial pathogens (Terpstra et al., 2000; Glass and Witztum, 2001).
18
Consistent with this, LXR activation has been shown to potentiate the LPS
response in human macrophages, by inducing the expression of the TLR-4 gene
(Fontaine et al., 2007). This might suggest a biphasic role for LXRs, as they
initially prepare macrophages to elicit an antibacterial response, and then, once the
inflammatory stimulus is present, exert anti-inflammatory actions to restore
normal cell conditions. Nonetheless, regulation of TLR-4 is known to be species-
specific, since LXRs do not induce this gene in mice. Although the mouse and
human TRL-4 genes are highly conserved (Roger et al., 2005), differences in the
LXREs within the TRL-4 promoters may account for the differential gene
regulation by LXRs across human and mouse species.
The anti-inflammatory effects of LXRs are not just limited to macrophages.
For instance, LXRs can also suppress the hepatic expression of the C-reactive
protein (CRP), a typical human acute phase protein. This has been demonstrated
in human hepatocytes, showing that LXRs can maintain the CRP gene in a
repressed state by preventing the cytokine-induced clearance of nuclear
receptor/co-repressor complexes (Blaschke et al., 2006).
Furthermore, LXR activation with both natural and synthetic ligands, such as
oxysterols and GW3965, has led to the reduction of inflammation in mouse
models of irritant and allergic contact dermatitis. As topical application of 12-
myristate-13-acetate (PMA) to the ear surface of CD1 mice led to dermatitis and
increased ear thickness, treatment with the LXR agonists was shown to reduce the
levels of PMA-induced pro-inflammatory cytokines, such as IL-1α and TNFα, as
well as a reduction in ear weight and thickness (Fowler et al., 2003).
Nonetheless, controversial results have been also reported. For instance, while
some authors demonstrated that LXR activation exacerbates inflammation in a
19
murine model of collagen-induced arthritis (CIA) (Asquith et al, 2009), others
have shown that LXRs can suppress inflammation and joint destruction in CIA
mice (Park et al., 2010).
1.3.3. Alzheimer’s disease (AD)
AD is a neurodegenerative disorder resulting from the deposition of β-amyloid
(Aβ) peptides in the extracellular space of the brain parenchyma (Selkoe, 1993).
The Aβ peptides are generated by proteolytic degradation of a larger molecule, the
Aβ precursor protein (APP) (Masters et al., 1985), and aggregate into insoluble
fibrillar plaques (Shoji et al., 1992), which cause toxicity and ultimately lead to
neuronal death (Hardy and Allsop, 1991).
This process results into loss of cognitive functions and memory, well-known
hallmarks of dementia that characterize AD.
ApoE is a plasma lipoprotein primarily synthesized in liver and brain
(Elshourbagy et al., 1985). In particular, ApoE is produced and secreted by
astrocytes in the central nervous system (CNS) and has been shown to be involved
in both cholesterol transport and neuronal regeneration (Ignatius et al., 1986;
Boyles et al., 1989). ApoE is known to have high affinity for Aβ peptides and has
been found associated to amyloid plaques in brains of AD patients (Strittmatter et
al., 1993b). Three isoforms of ApoE are known: ε2, ε3 and ε4. The higher
frequency of the ε4 allele has been widely associated with late-onset and familial
AD (Strittmatter et al., 1993), as this isoform has been shown to be less effective
than the ε2, ε3 isoforms in mediating the removal of Aβ peptides from the brain
(DeMattos et al., 2004).
20
Several studies have demonstrated that activation of LXRs results in increased
ApoE levels in murine and human macrophages (Mak et al., 2002; Jiang et al.,
2003) and in rat brain, in which higher levels of lipidated ApoE positively
correlate with amyloid Aβ clearance (Suon et al., 2010). The clearance process
requires the transfer of intracellular cholesterol via ABCA1 onto interstitial ApoE
(Wharle et al., 2004; Hirsch-Reinshagen et al., 2005) to form HDL-like particles
(Fagan et al., 1999). Importantly, lipidation of ApoE appears to be required in
order to enhance both degradation and efflux of the neurotoxic amyloid peptides,
Aβ40 and Aβ42 (Tokuda et al., 2000; Morikawa et al., 2005; Bell et al., 2007). In
particular, Aβ42 is believed to be the major component of cerebrovascular
amyloid deposits, with respect to the more soluble Aβ40 peptide (Roher et al.,
1993). Treatment with LXR modulators has been proven beneficial in several
rodent models of AD, by improving cognitive functions and reducing the amyloid
load in brain (Jiang et al., 2008; Fitz et al., 2010). This latter has also been proven
to result from the uptake of Aβ-bound lipidated-ApoE particles by murine
microglial cells, where the soluble Aβ peptides are processed and degraded by
proteolytic enzymes, such as neprilysin (NEP), in the lysosomal compartment
(Jiang et al., 2008).
1.4 Pharmacological modulation of LXRs.
The ability of LXRs to regulate cholesterol and lipid homeostasis while reducing
inflammation has generated a large interest in targeting these receptors for the
treatment of disorders such as atherosclerosis, atopic dermatitis, asthma and AD.
21
1.4.1. Therapeutic applications
The primary pharmacological intervention for atherosclerosis relies on statins
(Endo, 1992), which inhibit HMG-CoA-reductase, the rate-limiting enzyme in
cholesterol synthesis. Although statins effectively lower blood-circulating
cholesterol and therefore ameliorate the conditions of people with cardiovascular
disorders, new drugs that actually promote cholesterol efflux from overloaded
macrophages are needed in order to reduce existing atherosclerotic plaques and
therefore lower chances of thrombotic events.
As discussed so far, the ability of LXRs to promote RCT via direct gene
upregulation of several ABC transporters in macrophages and intestine, while
limiting absorption of cholesterol in the small intestine, makes them an attractive
therapeutic target for the treatment of atherosclerosis. Pharmacological
modulation of LXRs has also been proposed for the treatment of skin disorders,
such as atopic dermatitis. In mouse skin, not only LXR activation results in
reduced expression of pro-inflammatory cytokines but also prevents keratinocyte
differentiation while promoting epidermal development, by increasing lipid
production and thereby improving barrier function (Fowler et al., 2003; Hatano
et al., 2010). Treatment of human airway smooth muscle cells (hASM) with the
synthetic agonist T0901317 was shown to reduce a series of cytokines and pro-
inflammatory factors that would suggest an additional application for LXR
modulation in the context of airway inflammatory diseases, such as asthma and
chronic obstructive pulmonary disease (COPD) (Delvecchio et al., 2007).
LXRs may also play a potential therapeutic role in stroke. In rodent models of
experimental stroke, treatment with two synthetic agonists, T090 and GW3965,
diminished the levels of several ischemia-related inflammatory markers, such as
22
iNOS, MMP-9, COX-2 and TNFα (Morales et al., 2008). Therefore, in cases of
cerebral ischemia LXR modulators may indeed offer neuroprotection by
reducing brain inflammation and neurological deficits (Sironi et al., 2008).
Finally, the ability of LXRs to drive the ABCA1-ApoE mediated clearance of β-
amyloid plaques from the brain in rodents has generated quite some interest in
the context of AD. Currently, no therapy exists to block and reverse the
progression of such debilitating neurological disease. Several small molecule
drugs that specifically inhibit the activity of the beta-site APP cleaving enzyme 1
(BACE1), which leads to the generation of amyloid peptides, are currently being
investigated in clinical trials. Nonetheless, taken together with the anti-
inflammatory properties of LXRs in brain, development of CNS-penetrant LXR
modulators would prove beneficial in the setting of neurological disorders, such
as AD and Parkinson’s disease (PD) either alone or in combination with other
agents. In facts, LXRβ has been shown to protect dopaminergic neurons in a
mouse model of PD by modulating the microglia-mediated neuronal toxicity
(Dai et al., 2012).
1.4.2. Drug Discovery: strategies, animal models and challenges
Despite LXRs’ ability to promote cholesterol efflux upon activation via ligand
binding of both natural and synthetic agonists, a compelling undesired side effect
is the parallel activation of SREBP1c and other genes involved in fatty acid
synthesis, such as FAS, SCD and acetyl-CoA carboxylase (ACC), leading to
lipogenesis (Liang et al., 2002). Elevation of plasma and liver triglycerides in
mice has been observed upon treatment with the LXR full agonist, T0901317
(Schultz et al., 2000). Since the early characterization of these ligands, great
23
efforts have been dedicated to identifying a ligand capable of modulating LXRs
in turning on ABC transporter genes as well as reducing inflammation, without
affecting SREBP1c gene levels. Given the higher expression of LXRα in liver,
with respect to LXRβ (Su et al., 2004), several pharmaceutical companies have
opted for the development of LXRβ-selective modulators, avoiding, where
possible, activation of LXRα, which seems to play a more significant role in
liver in terms of SREBP1c gene regulation. This rationale is supported by the
evidence that despite the more severe atherosclerotic profile of a double
knockout mice for LXRα and apoE (Lxrα–/–apoE–/–), with respect to the apoE–/–
phenotype, treatment with a potent synthetic LXR agonist leads to anti-
atherogenic effects, as the result of reduced aortic lesion areas and improved
cholesterol and lipid profiles (Bradley et al., 2007).
Although synthetic steroidal LXR modulators have the potential to achieve such
goal with low impact on hepatic lipogenesis, their pharmacokinetic properties,
such as poor bioavailability, makes them less attractive. For instance, DMHCA
(N,N-dimethyl-3β-hydroxy-cholenamide) is an oxysterol derivative that has been
shown to be effective in both human cells and C57BL/6 mice. Treatment with the
steroid led to activation of ABCA1 gene expression in both human THP-1
derived-macrophages and murine peritoneal macrophages without induction of
SREBP1c in either human HepG2 hepatocytes or mouse liver, where no lipid
accumulation could be observed (Quinet et al., 2004).
Additionally, long-term administration of DMHCA in apoE-deficient (apoE-/-)
mice was shown to reduce the formation of atherosclerotic lesions without causing
hepatosteatosis and elevation of triglycerides in plasma (Kratzer et al., 2009).
24
Similarly, a recent synthetic steroidal LXRα-selective agonist, ATI-829,
marginally induced SREBP1c expression in HepG2 cells, while robustly inducing
ABCA1 expression in THP1 cells. The efficacy of the compound was also
assessed in a different model of atherosclerosis, LDLR-deficient mice (Ldlr-/-),
showing reduction in the size of aortic lesions without affecting either cholesterol
or triglycerides levels in plasma and liver (Peng et al., 2008), contrary to the
results that may have been expected for an LXRα-selective ligand. Indeed, LXR
knockout experiments in atherosclerosis murine models (Ldlr-/-) show the
requirement of LXRα in macrophages in order to achieve robust reduction of
atherosclerotic plaques (Bischoff et al., 2010). Consistent with this, increased
expression of LXRα in the intestine of Ldlr-/- mice, obtained via knock in of a
VP16-LXRα construct, led to improved RCT and decreased severity of aortic
lesions (Lo Sasso et al., 2010).
As anticipated earlier, CETP is an LXR target gene (Luo and Tall, 2000).
Induction of CETP in higher species represents a major liability in the
pharmacological activation of LXRs, as increased CETP activity is associated
with an enhanced atherogenic lipoprotein profile (Zhong et al., 1996).
Indeed, two synthetic non-steroidal LXR agonists were administered to CETP-
containing species, such as hamsters and Cynomolgus monkeys, causing a
significant increase of both VLDL and LDL cholesterol levels in plasma (Groot et
al., 2005), therefore questioning the overall therapeutic value of LXR modulation
by isoform non-selective agonists. Nonetheless, another synthetic non-steroidal
compound with higher affinity for the LXRβ isoform, WAY-252623, was later
shown to reduce plasma LDL cholesterol in non-human primates without
affecting the lipoprotein profile in hamsters (Quinet et al., 2009). Treatment with
25
WAY-623 also caused accumulation of lipids in liver, where triglyceride levels
were reported to be five times higher with respect to the control animals.
Nonetheless, in 2006 Wyeth initiated a phase I clinical trial for WAY-252623.
Activation of the LXR target genes (ABCA1 and ABCG1) was observed upon
treatment with the compound in ex vivo whole blood analyses during the single
ascending-dose phase of the trial. However, the occurrence of CNS-related side
effects was also observed. While it was not clear whether these effects were
compound or target related, the trial was terminated along with no further
development of the drug (Ratni and Wright, 2010).
Nonetheless, LXR modulation has been shown to ameliorate the neurological
conditions of animal models of AD. The role of LXRs in the reduction of the
amyloid burden brain has been characterized by generating triple transgenic mice
lacking either LXRα or LXRβ with a knock in of APP and presenilin 1 (PS1)
genes, that carry mutations which cause increased formation of amyloid plaques
(Zelcher et al., 2007). In this study it was shown that both Lxrα–/– Lxrβ–/– mice
exhibit increased levels of Aβ40 and Aβ42 peptides, suggesting the beneficial role
of LXRs in the APP/S1 transgenic animals. Additionally, the authors also
demonstrated the anti-inflammatory effects of LXR activation in LPS-treated
primary astrocytic and microglial cells isolated from mouse brains.
Similar immuno-modulatory effects have also been observed in a different mouse
model of AD, APP23 transgenic mice (Fitz et al., 2010). In this model, LXR
activation with T090 also reversed the negative effects of high fat (HF) diet by
improving spatial learning and memory retention, with a concomitant
upregulation of both abca1 and apoE genes and reduction of Aβ peptides.
26
A common animal model of AD used to study the effects of small molecule
inhibitors of secretase enzymes, such as BACE1, is the transgenic mouse Tg2576.
These express the human APP gene carrying the Swedish mutation, which confers
a large extent of amyloid deposition in brain. In this model, T090 was able to
reduce the levels of Aβ42, but not Aβ40, in hippocampi only along with the
reversal of contextual memory deficits associated with these animals (Riddell et
al., 2007). Finally, the effects of LXR ligands on amyloid reduction have also
been assessed in rats, with the specific purpose of analyzing Aβ composition in
cerebro-spinal fluid (CSF), which is easier to obtain with respect to mice.
Not only the LXR compound upregulated both abca1 and apoE in rat brain, but
also led to increased levels of Aβ peptides in the CSF, suggesting a clearance
mechanism at the basis of apoE-mediated Aβ reduction (Suon et al., 2010).
Although an experimental approach was attempted in 2010 (Li et al.), currently,
there is no availability of non-human primate models of AD that would allow
assessing the effects of LXR modulators on disease progression and cognitive
functions.
1.5 Implications of differential LXR target gene expression across species
Although the LXR signaling pathway is mostly conserved across species, LXRs
can also regulate their target genes in a species- and isoform-specific fashion.
Examples of genes differentially regulated across species include CYP7A1, the
rate-limiting enzyme in bile acid synthesis, which is activated by LXRs in mouse
but not in human (Goodwin et al., 2003). This represents a crucial difference in
the control of cholesterol homeostasis by LXRs, suggesting distinct species-
specific mechanisms for the elimination of excessive cholesterol. In addition, as
27
CETP is a known LXR target gene, one must also consider assessing the efficacy
of experimental LXR modulators in CETP-containing species, such as non-human
primates, that are more predictive of the response to LXR activation in humans.
When addressing the role of LXR modulation in immune cells, it is critical to
consider the species-specific regulation of TLR-4, which mediates the response to
LPS and is up-regulated by LXR agonists in human but not mouse macrophages
(Fontaine et al., 2007). Another example is the SMPDL3A (Sphingomyelin
Phosphodiesterase Acid-Like 3A) gene, which is regulated by LXRs in humans,
but not rodents, in a tissue-specific fashion (Noto et al., 2012). Although the exact
function of SMDPL3A is not yet known, it is intriguing to see that its regulation
by LXRs appears to be restricted to blood cells only.
Similarly, in human macrophages LXRα, but not LXRβ positively controls its
own expression upon activation with known LXR ligands and this effect has not
been observed in murine macrophages (Li et al., 2002). An additional example of
isoform-specific regulation is the AIM gene (also known as Spα), which is
induced by LXRα, but not LXRβ, in murine macrophages (Joseph et al., 2004).
28
CHAPTER 2: REGULATION OF SPHINGOMYELIN PHOSPHODIESTERASE, ACID-LIKE 3A GENE (SMPDL3A) BY LIVER X RECEPTORS Paul B. Noto, Yuri Bukhtiyarov, Meng Shi, Brian M. McKeever, Gerard M.
McGeehan and Deepak S. Lala.
Discovery Biology, Vitae Pharmaceuticals, Inc, Fort Washington, Pennsylvania
(PBN, YB, MS, BMM, GMM, DSL)
Department of Biology, Drexel University, Philadelphia, Pennsylvania (PBN)
29
Abstract Liver X receptors alpha (LXRα) and beta (LXRβ) function as physiological
sensors of cholesterol metabolites (oxysterols), regulating key genes involved in
cholesterol and lipid metabolism. LXRs have been extensively studied in both
human and rodent cell systems, revealing their potential therapeutic value in the
contexts of atherosclerosis and inflammatory diseases. The LXR genome
landscape has been investigated in murine macrophages but not in human THP-1
cells, which represent one of the frequently employed monocyte/macrophage cell
systems to study immune responses. We used a whole genome screen to detect
direct LXR target genes in THP-1 cells treated with two widely used LXR ligands
(T0901317 and GW3965). This screen identified the sphingomyelin
phosphodiesterase acid-like 3A (SMPDL3A) gene as a novel LXR regulated gene,
with an LXR response element (LXRE) within its promoter. We investigated the
regulation of SMPDL3A gene expression by LXRs across several human and
mouse cell types. These studies indicate that the induction of SMDPL3A is LXR-
dependent and is restricted to human blood cells with no induction observed in
mouse cellular systems.
30
2.1 Introduction Liver X receptors (LXRs) are nuclear hormone receptors that act as oxysterol
sensors, regulating genes involved in cholesterol and lipid metabolism (Janowski
et al., 1999). Elevated cholesterol levels can lead to enhanced oxysterol
production and the activation of LXRs, which increase the gene expression
(transactivation) of a number of target genes. The capacity of LXRs to promote
reverse cholesterol transport (RCT) via direct gene upregulation of several ATP-
binding cassette (ABC) transporters in macrophages and intestine (e.g.,
ABCA1/G1/G5/G8) makes them an attractive therapeutic target for the treatment
of atherosclerosis (Calkin and Tontonoz, 2010). Activation of LXRs in liver also
leads to induction of genes directly involved in lipid synthesis, such as sterol
regulatory element-binding protein-1c (SREBP1c), fatty acid synthase (FAS) and
stearoyl CoA desaturase (SCD) (Repa et al., 2000). Chronic LXR activation in
liver can cause hypertriglyceridemia and hepatosteatosis. LXRs have also been
shown to exert anti-inflammatory properties by suppressing genes involved in
inflammation, such as tumor necrosis factor alpha (TNFα), interleukins (IL-1β,
IL-6), cyclooxygenase 2 (COX-2), inducible nitric oxide synthase (iNOS) and
nuclear factor kappa B (NFκB) in murine macrophages (Joseph et al., 2003). The
immunomodulatory effects of LXRs rely on the association of LXRs with
corepressor complexes bound to transcription factors, such as NFκB, that
modulate the expression of inflammatory genes (transrepression) (Ghisletti et al.,
2007). An additional therapeutic indication for LXRs is in Alzheimer’s disease
(AD). LXR activation has been shown to increase the levels of the Apolipoprotein
E (ApoE) in murine and human macrophages (Mak et al., 2002) and in rat brain,
31
where increased ApoE has been positively associated with amyloid Aβ clearance
in AD models (Suon et al., 2010).
Although many metabolic pathways are conserved across species, LXRs can
regulate their target genes in a species-specific fashion. For instance, the CYP7A1
gene, the rate-limiting enzyme in bile acid synthesis, is activated by LXRs in
mouse, but not in human (Goodwin et al., 2003). Additionally, in human
macrophages, LXRα, but not LXRβ, has been shown to be involved in an
autoregulatory loop upon activation with known LXR ligands. Such an effect has
not been observed in murine macrophages (Li et al., 2002). Additionally, the Toll-
like Receptor 4 (TLR4), which is upregulated by LXR agonists in human but not
mouse macrophages (Fontaine et al., 2007).
The LXR genome landscape has been extensively studied in murine systems, but
has not been fully investigated in human THP-1 macrophages. THP-1 cells
represent one of the most frequently employed cell systems for studying the role
of LXRs in human macrophage biology. In this study we investigated LXR gene
regulation at the genome wide level in THP-1-derived macrophages in the
presence or absence of lipopolysaccharide (LPS). This survey led to the
identification of a novel LXR-regulated gene and an LXRE within its promoter.
LXRs activate the expression of the SMDPL3A gene, either in the presence or the
absence of LPS. This study focuses on the regulation of SMPDL3A by LXRs
across various cell types and tissues in human and rodent species. The SMPDL3A
gene was originally identified based on its sequence similarities with acid
Sphingomyelinase and its function has not been characterized so far other than its
increased expression and association with DBCCR1 (deleted in bladder cancer
chromosome region 1) in bladder cancer (Wright et al., 2002). Given the
32
biological importance of acid sphingomyelinases in activated macrophages
(Truman et al., 2011), we decided to further investigate the SMPDL3A gene
regulation by LXRs.
33
2.2 Material and Methods
The LXR ligands GW3965 and TO901317 were purchased from Tocris (catalog #
2474 and 2373). The RXR ligand LG100268 was purchased from Toronto
Research Chemicals, Inc. catalog # L397650.
2.2.1. Cell Culture and Transfection
THP-1 cells were maintained in RPMI 1640 medium with Glutamax (Invitrogen,
catalog # 61870127) supplemented with 10% fetal bovine serum (Hyclone,
catalog # SH30531), 50 μM β-Mercaptoethanol and antibiotics [penicillin (50
U/ml)-streptomycin (50 μg/ml), Invitrogen, catalog # 15070063] at 37°C under
5% CO2. Twenty-four hours before treatment, THP-1 cells were plated in 96-well
plates at a density of 5 x 104 cells/well in presence of 200 nM phorbol 12-
myristate 13-acetate (PMA, Sigma catalog # 79346). Cell were then incubated
with LXR ligands in RPMI 1640 medium with Glutamax supplemented with 10%
delipidated-fetal bovine serum (Hyclone, catalog # SH3085502HI) and
antibiotics.
HepG2 cells were maintained and routinely propagated in minimal essential
medium (Invitrogen, catalog # 0820234DJ) supplemented with 10% fetal bovine
serum and antibiotics at 37°C under 5% CO2.
CCD 1112 foreskin fibroblasts were maintained and routinely propagated in
Iscove's Modified Dulbecco's Medium (Invitrogen, catalog # 12440046)
supplemented with 10% fetal bovine serum and antibiotics at 37°C under 5%
CO2.
H4, HEK293 and RAW264.7 cells were maintained and routinely propagated in
Dulbecco’s modified Eagle’s medium (Invitrogen, catalog # 10566032)
34
supplemented with 10% fetal bovine serum and antibiotics at 37°C under 5%
CO2. H4, HEK293, RAW264, CCD 1112 and HepG2 were plated in 96-well
plates at a density of 4 x 104 cells/well and incubated for 24 hours with LXR
ligands in their respective medium supplemented with 10% delipidated-fetal
bovine serum and antibiotics.
For siRNA studies, 24 hours before transfection, THP-1 cells were plated in 96-
well plates at a density of 5 x 104 cells/well and differentiated with PMA, as
described above. Each transfection was carried out with either 30 nM of
scrambled siRNA (Invitrogen, catalog # AM4635,) or 30 nM LXR-specific
siRNA (LXRα, catalog # 4390824-s19568; LXRβ, catalog # 4390824-s14685,
Invitrogen) using 0.4 μl Lipofectamine RNAiMAX (Invitrogen, catalog #
13778075) in Opti-MEM Reduced Serum Medium (Invitrogen, catalog #
31985062).
Twenty-four hours after transfection, cells were washed once with DPBS and
treated with the LXR agonist in RPMI 1640 medium with Glutamax
supplemented with 10% delipidated-fetal bovine serum and antibiotics.
2.2.2. Gene expression microarray analysis. THP-1 cells were differentiated as described above and plated in 35 mm-dishes at
5 x 106 cells/dish. Twenty-four hours later, cells were pre-treated for 1 hour with
either DMSO or 1 μM T090 in delipidated FBS-containing media and then
incubated with either plain media or LPS-containing media (100 ng/ml) for an
additional 8 hours (LPS purchased from Sigma catalog# L2654).
35
Total RNA was isolated and purified using RNeasy columns (Qiagen). Reverse
transcription and hybridization on two Agilent Human GE 4 X 44K v2
Microarrays were carried out by MOgene LC (St. Louis, Missouri).
2.2.3. Analysis of the SMDPL3A expression in cells and tissues. For all cells treated in 96-well format, RNA was isolated and purified using ABI
Prism 6100 Nucleic Acid PrepStation (Applied Biosystems). cDNA was
synthesized and subjected to real-time PCR using One-Step RT-PCR reagents
(Applied Biosystems). Gene expression analysis was carried out according to the
method described by Bookout and Mangelsdorf (Bookout AL and Mangelsdorf
DJ, 2003).
cDNA from Human MTC™ Panels I and II were purchased from Clontech
(catalog# 636742 and 636743) and subjected to real-time PCR.
Whole blood from human donors was purchased from AllCells (catalog#
WB001).
Human PBMCs from the whole blood were collected in EDTA-containing tubes
and purified using standard Ficoll-Paque gradient centrifugation. Briefly, 15 ml of
blood was transferred to 50ml-tubes, diluted with 15mL of DPBS and underlayed
with 10 ml of Lymphocyte Separation Medium (9.4% Sodium Diatrizoate, 6.2%
Ficoll, MP Biomedicals, LLC, catalog # 50494X). The tubes were centrifuged for
60 min at 800 × g, with no brake. The cell interface layer was harvested carefully,
and the cells were washed three times in PBS (sedimented for 10 min at 800 × g)
and resuspended in RPMI 1640 medium with Glutamax supplemented with 10%
fetal bovine serum and antibiotics before counting. Cells were plated on 6-well
plates at a density of 3 x 106 cells/well and treated with the LXR ligand for 24
36
hours. The relative gene expression level was determined using ΔΔCt method. All
primer probe sets for the human genes were purchased from Applied Biosystems.
2.2.4. Animal studies
Male C57BL/6 mice (Charles River Laboratories) of approximately 11-13 weeks
of age were given a single daily dose, administered by oral gavage, of either
vehicle (1% Polysorbate-80 and 0.5% natrosol) or T090 at 30 mg/kg for four
consecutive days. Four animals per group were used. Four hours after the last
treatment (day four), blood was collected and preserved in RNAlater (Qiagen,
catalog # 76104) and animals were sacrificed by cervical dislocation; liver and
intestine tissues were collected and frozen in liquid nitrogen. RNA was isolated
from whole blood using Ribo Pure™-Blood kit (Invitrogen, catalog # AM1928);
RNA from the other tissues was isolated by lysis with QIAzol reagent and RNeasy
Columns (Qiagen). Total RNA was subjected to real-time PCR as described
above. Primer probe sets for the rodent genes were purchased from Applied
Biosystems.
2.2.5. SMPDL3A protein analysis. HEK293 cells were plated in 35mm-dishes at 5 x 106 cells/dish the day before
transfection. Each transfection mix contained either 5 μg of an empty control-
vector (OriGene, catalog # PCMV6XL4) or 5 μg of a Myc-DDK-tagged
SMDPL3A plasmid (OriGene, catalog # RC204332) with 30 μl of Lipofectamine
2000 (Invitrogen, catalog # 11668019) in Opti-MEM Reduced Serum Medium.
Twenty-four hours after transfection, both HEK293 cells and THP-1-macrophages
(treated with the LXR ligand, Fig. 2C) were lysed in cold RIPA buffer,
supplemented with protease inhibitors cocktail, and sonicated on a cup horn
37
(Fisher Scientific) for 2 minutes with 30 second-bursts. Cell lysates were cleared
by centrifugation for 10 minutes at 14,000 rpm at 4°C.
Lysates were subjected to Bradford assay for assessing protein concentration.
Western Blots were carried out by resolving 100 μg of protein from the total cell
lysates by SDS-PAGE, blotting to nitrocellulose, and probing overnight at 4°C
with 1.7 μg/ml polyclonal anti-SMPDL3A antibody produced in mouse (Sigma,
catalog # SAB1400412) followed by the incubation with 1:2,000 diluted donkey
anti-mouse-HRP conjugate (Jackson ImmunoResearch Laboratories, catalog #
715-035-151). As a loading control, the blot was cut and stained with 1:5,000
diluted, HRP-conjugated, anti-β-actin antibody (GenScript, catalog # A00730).
2.2.6. Gel Mobility Shift Assays.
Purified human full-length LXRα, LXRβ, and RXRα were purchased from Protein
One (catalog# P1045, P1046 and P1022). Single strands containing the LXRE
response element in human SMDPL3A
(5’-GAAGGAAGAGGGGTTACTGGAGTTCAGTGGTCTGAA-3’) were
biotinylated using the Biotin 3’ End DNA Labeling Kit (Thermo Scientific,
catalog# 89818). Double-stranded oligonucleotides were annealed via
denaturation at 95°C for 1 minute followed by incubation at 70°C for 30 minutes.
Labeled probes were incubated with 20 ng of purified receptors in 10 mM Tris
(pH 7.5), 60 mM KCl, 0.02 mM EDTA, 2% glycerol and 1 mM DTT for 30 min
at room temperature. DNA-protein complexes were resolved on a 6%
polyacrylamide gel, electro blotted to nylon membrane, UV-crosslinked for 10
minutes and incubated with Streptavidin-HRP in blocking buffer for 15 minutes
(LightShift Chemoluminiscent EMSA Kit, Thermo Scientific, catalog# 20148).
38
2.2.7. Chromatin Immunoprecipitation Assays.
THP-1 cells were differentiated as described above in 150-mm dishes for 24
hours. T090 was added in delipidated-FBS containing media overnight for 16 h.
Cells were incubated with 1% formaldehyde for 10 minutes at room temperature.
Unreacted formaldehyde was neutralized with 0.125 M glycine. Cells were
washed twice with ice-cold PBS and scraped in cold PBS containing protease
inhibitors. Cells were collected and washed twice by centrifugation at 700 × g for
5 minutes at 4°C. Cell pellets were lysed in cold RIPA buffer with protease
inhibitors and chromatin was sheared via sonication on a cup horn for 6 minutes
with 30 second-bursts to yield an average DNA fragment length of approximately
500 bp. Lysates were clarified by centrifugation at 12, 500 × g for 5 min at 4°C.
Lysates were diluted 1:5 with ChIP dilution buffer and incubated overnight at 4°C
with the following antibodies: anti-LXRα (Abcam, catalog# ab41902) or mouse
IgG as a control (Invitrogen, catalog# 100005292). Immunoprecipitations and
DNA purifications were carried out as described by Novus Biologicals
(ChromataChIP Kit, NBP1-71709). DNA was used for quantitative PCR with
POWER SYBR mix (Applied Biosystems, catalog# 4367659) and the following
primers: hSMPDL3A-F-ACTCTGTGAGTCTTCACACCT, hSMPDL3A-R-
CTGAGAGGAGGCAGGAGAGTT. For the control genes, the following primers
were used: hABCA1-F-ACGTGCTTTCTGCTGAGTGA, hABCA1-R-
ACCGAGCGCAGAGGTTACTA, h36B4-F-ACGCTGCTGAACATGCTCAA,
h36B4-R-GATGCTGCCATTGTCGAACA (as described by Phelan et al., 2008).
39
2.3 Results
2.3.1 Genome Wide Gene Expression Analysis and validation by real time-PCR (RT-PCR) We used genome-wide microarray gene expression technology to identify novel
LXR regulated genes in THP-1 derived macrophages. Cells were treated with two
LXR synthetic agonists, T0901317 (T090) (Schultz et al., 2000) and GW3965
(Collins JL et al., 2002) in either the presence or the absence of LPS. Treatment
with LPS induced more than 400 genes, many of which are known to be regulated
by LXRs. Almost all of these genes to some degree were downregulated upon co-
treatment with the LXR ligands. Specifically, pro-inflammatory genes that were
induced by LPS, TNFα and IL-6, were mildly reduced (30%-40%) by both T090
and GW3965 (Fig. 1A). Additionally, the expression of chemokine (C-C motif)
ligand 4 (CCL4), also known as macrophage inflammatory protein 1β (MIP-1β),
was modestly reduced by both LXR ligands as had been previously observed in
murine macrophages (Joseph et al., 2003). The LXR agonists upregulated a
common set of 18 genes. This set includes most of all known LXR target genes
including, ABCA1, APOE and NR1H3 (LXRα) (Venkateswaran et al., 2000;
Laffitte et al., 2001; Li et al., 2002). In addition, one novel gene was identified in
this fashion, SMPDL3A. In the absence of LPS, both T090 and GW3965 induced
~4-5-fold increase in expression of the SMPDL3A gene. Treatment with LPS
lowered SMPDL3A expression by half. Both T090 and GW3965 were able to
increase gene expression even in presence of LPS. The negative effect of LPS on
gene expression was also observed for other genes, such as the ABC transporters,
apolipoproteins and the genes involved in lipid synthesis, but not for the LXR
genes.
40
We validated the microarray results for the CCL4 and SMPDL3A genes by
quantitative RT-PCR. The downregulation of the CCL4 gene by both T090 and
GW3965 in the presence of LPS was confirmed by RT-PCR. As shown in figure
1B, both compounds significantly reduce mRNA levels of CCL4. In addition,
treatment of macrophages with either T090 or GW3965 induced the gene
expression of SMDPL3A by several folds (Fig. 1C), confirming the findings from
the microarray chip.
2.3.2 Expression of SMPDL3A is induced by LXR agonists.
SMPDL3A may be functionally related to other sphingomyelinases. Several of
these, e.g., SMPD1 and SMPD2 and SMPDL3B, were shown to be upregulated by
LXR activation in mouse skin keratinocytes (Chang et al., 2008). We measured
the effect of T090 treatment on the expression of the sphingomyelin
phosphodiesterase family in THP-1 macrophages. Since none of these were
differentially regulated by the LXR agonists in the genome-wide gene expression
analysis (data not shown), we analyzed the mRNA levels of four
sphingomyelinases and the analog of SMPDL3A, SMPDL3B, by RT-PCR in
THP-1 cells. Interestingly, SMPDL3A appears to be the only gene related to the
sphingomyelinase phosphodiesterase family that is induced by the LXR agonists
in both THP-1 monocytes and the PMA-differentiated macrophages (Fig. 2A).
The activation of the SMPDL3A gene expression was also confirmed to be
concentration-dependent for T090, with a calculated EC50 value of ~80 nM (Fig.
2B), which corresponds to the cellular potency of T090 typically observed in
Gal4-LXR reporter assays (data not shown). Additionally, the levels of
SMDPL3A protein increased in a concentration-proportional manner upon T090
41
treatment of THP-1 macrophages (Fig. 2C). Specificity of the antibody used for
analysis of SMPDL3A protein expression was demonstrated by immunostaining
of cell lysate from HEK293 cells transiently transfected with a vector encoding
the full-length human SMPDL3A fused to Myc-DDDDK tag at the C-terminus
(Supplemental Figure 1).
In order to discern the dynamics of the SMPDL3A gene induction by LXR
agonists, SMPDL3A mRNA levels were measured 4, 8 and 24 hours after
addition of T090 to THP-1 macrophages with and without stimulation with LPS
(Fig.2D). LPS suppressed basal expression of SMPDL3A by 78% and 72% at 4
and 8 hours, respectively, similar to the effect observed in the genome-wide gene
expression analysis. The suppressive effect of LPS on the base-line SMPDL3A
expression was significantly reduced at 24 hours, with only 25% decrease in
expression levels versus controls. T090 was able to increase gene expression at all
time points in a time-dependent manner, regardless of whether THP-1
macrophages were stimulated with LPS. Significant induction is seen within 4
hours reaching near maximal effect at 8 hours.
2.3.3. Knockdown of LXRs in THP-1-derived macrophages reduces the
expression of the SMPDL3A gene.
To examine whether the transcriptional regulation of the SMDPL3A gene is
indeed mediated by LXRs, we monitored the gene expression of SMDPL3A over
time in THP-1 macrophages incubated with an LXR ligand (T090) and transfected
with siRNA for LXRα, LXRβ or both (Fig. 3A). The absolute mRNA levels of
SMPDL3A (normalized to the scrambled siRNA-controls) were reduced after
silencing the LXR isoforms individually or together, implying possible
42
involvement of both LXR isoforms in the regulation of SMDPL3A. Treatment
with T090 led to significant upregulation of SMPDL3A over time when individual
LXR isoforms were knocked down, reflecting overlap in function of LXRα and
LXRβ for induction of the SMPDL3A gene expression. Less pronounced but still
significant stimulation of SMPDL3A expression by T090 was observed in the
double-knockdown experiment. This residual activation is most likely due to
incomplete silencing of both LXR isoforms - approximately ~75% and 85% for
LXRα and LXRβ, respectively, assessed by RT-PCR analysis (Supplemental
Figure 2).
2.3.4. Both Retinoid X Receptor (RXR) and LXR ligands induce SMPDL3A
gene expression.
LXRs require RXRs as obligate heterodimer partners to bind to their cognate
response elements, which can be activated by both RXR and LXR ligands (Willy
et al., 1995). To test whether the SMDPL3A gene can be induced by an RXR
ligand, we treated THP-1 macrophages with a known RXR agonist, LG100268
(Boehm et al., 1995). T090 and LG100268 were applied to THP-1 macrophages at
sub-optimal concentrations (Fig.2B; Li et al., 2002). Each compound significantly
induced SMPDL3A gene expression (Fig. 3B). When compounds were applied
together, the extent of the SMPDL3A induction appeared to be the sum of the
effects seen with either RXR or LXR agonist alone. Like LXRs, the peroxisome
proliferator-activated receptor gamma (PPARγ) functions as a heterodimer with
RXRs (Bardot et al., 1993; Gearing et al., 1993). We treated THP-1 macrophages
with Rosiglitazone, a known PPARγ agonist (Lehmann et al., 1995), and failed to
observe induction of the SMPDL3A gene expression (Supplemental Figure 3).
43
2.3.5 LXR directly interacts with LXR response element in SMPDL3A
promoter region.
We identified a putative LXR response element (LXRE) in the promoter region of
the SMPDL3A gene (Pehkonen et al., 2012) based on sequence homology to a
consensus LXRE motif (Sandelin and Wasserman, 2005). Duplex
oligonucleotides containing the base pairs 2105-2120 of the SMPDL3A gene
(NC_000006.11, bp 123109971…123130865 of Chromosome 6) exhibited
specific binding to a heterodimer of the full-length LXRα/β and RXRα proteins.
The DNA duplex recruited none of the proteins as either monomers or
homodimers (Fig. 4A). The labeled DNA can be displaced from the protein-DNA
complex with the unlabeled duplex DNA having the same sequence.
In order to demonstrate direct interaction of LXR with the promoter region of
SMPDL3A within a cell we conducted Chromatin Immunoprecipitation (ChIP) in
THP-1 macrophages with LXRα-specific antibodies and analyzed the abundance
of the LXRE DNA by real-time PCR (Fig. 4B). Treatment of the cells with LXR
agonist T0901317 led to a significant increase in the amount of the SMPDL3A
LXRE DNA in the immunoprecipitated material, similar to the DNA of a known
LXR target, ATP binding cassette (ABC) transporter A1.
2.3.6. LXRs regulate the SMPDL3A gene in a cell type-specific fashion in
human cells.
Next, we investigated the expression levels of the SMDPL3A gene in multiple
human tissues. The expression levels of the SMPDL3A gene across all human
tissues were normalized to spleen tissue, which showed the lowest level of
expression. Kidney, colon with mucosa lining, placenta, lung and liver showed the
44
highest relative expression of the gene (Fig. 5A). We then analyzed various
immortalized cell lines derived from the tissues expressing low and high levels of
SMPDL3A. As shown in Figure 5B, no SMPDL3A gene induction by T090 was
observed in human H4 neuroglioma cells, CCD-1112 skin fibroblasts, HepG2
hepatocytes and HEK293 kidney cells. Control studies showed that known LXR
target genes were robustly induced in these cell lines by T090: ABCA1 in
neuronal cells, HEK293 and skin fibroblasts and SREBP1c in HepG2 cells (see
supplemental data). In order to rule out the possibility that regulation of
SMDPL3A by LXRs is restricted to an immortalized cell line, such as THP-1
from acute monocytic leukemia, we measured the effects of T090 on human
peripheral blood mononuclear cells (PBMCs) isolated from two healthy donors.
As shown in Figure 5C, treatment with T090 led to robust SMPDL3A and
ABCA1 gene induction in the PBMCs from both donors.
2.3.7. SMPDL3A is not induced by LXRs in mice.
In contrast to human monocytes, the Smpdl3a gene induction was not observed in
RAW264.7 mouse macrophages treated with T090 (Fig. 6A). We also analyzed
expression levels of Smpdl3a in blood, liver and intestine in mice treated with
either vehicle or 30 mg/kg of T090 for four days. While T090 treatment strongly
induced known target genes, Abca1 and Srebp1c, the expression levels of
Smpdl3a remained unaffected by the LXR ligand in blood, intestine or liver (Fig.
6B). These data imply that regulation of SMPDL3A gene by LXR occurs in
human monocytes and macrophages but does not occur in murine tissues.
45
2.4 Discussion
In order to identify novel LXR target genes in THP-1 macrophages, we analyzed
genome-wide expression profiles of forty-four thousand genes using microarray
gene expression analysis in THP-1 macrophages with and without stimulation of
inflammatory response with LPS. The validity of the gene expression results was
supported by robust induction of the genes that had been previously ascribed to
regulation by LXRs. Anti-inflammatory properties of LXRs in THP-1
macrophages appear to be not as strong as those observed with steroidal
glucocorticoid receptor (GR) agonists (Auphan et al., 1995). However, the overall
down-regulation of the expression of several cytokines, including chemokines
such as CCL1, CCL4 and chemokine (C-X-C motif) ligand 3 (CXCL3) reflects an
LXR-mediated transrepression of proinflammatory genes tuning down the
attraction of additional monocytes to atherosclerotic foam macrophages.
The novel LXR target gene, SMPDL3A, was originally identified based on its
sequence similarity with acid sphingomyelinases-phosphodiesterases. The
function of the protein has not been characterized so far, other than its increased
expression and association with DBCCR1 protein in bladder cancer. Given the
biological importance of acid sphingomyelinases in activated macrophages
(Truman et al., 2011), we decided to further investigate the SMPDL3A gene
regulation by LXRs.
We confirmed the microarray findings by real-time PCR quantitation of the
SMPDL3A mRNA in THP-1 macrophages treated with two known LXR ligands,
T090 and GW3965. We saw strong induction of the gene expression by both LXR
agonists demonstrating that the SMPDL3A gene is indeed the target of LXR
transcriptional activity in THP-1 cells. The induction of the SMPDL3A gene by
46
the RXR agonist LG100268 alone and its additive effect with the LXR-mediated
transcription of the gene further supports direct regulation of the SMDPL3A gene
by LXR/RXR heterodimers. While working on the manuscript we became aware
of the recent study (Pehkonen et al., 2012) where two LXR peaks within the
transcription start site of the SMDPL3A gene were detected in THP-1
macrophages by ChIP-Seq analysis. We used this information for identifying an
LXRE sequence within the region pinpointed by the ChIP-Seq study and
demonstrated direct interaction of LXR with this region by EMSA and ChIP
analyses. To investigate the cell specific activity we also carried out ChIP analysis
in HepG2 cells and observed that LXR is recruited to the SMPDL3A promoter in
response to ligand (data not shown) indicating that the cell-specific activation by
LXRs must lie in the differential recruitment of cofactors to LXR, similar to what
has been described for the Estrogen Receptors (Shang and Brown, 2002). Taken
together, these results unequivocally prove that LXR has an active role in
transcriptional control of SMPDL3A gene expression.
LPS appears to suppress the expression of SMPDL3A at least by two-fold, and
this effect wanes over time. We have also observed a similar effect in RAW264
murine macrophages upon treatment with LPS (data not shown). Similar down-
regulation of sphingomyelinase activity by pertussis toxin (PTX), also a TLR-4
ligand, had been described by Wang et al. (2007), who showed that the PTX
treatment prolongs macrophage survival by inhibiting acid sphingomyelinase
activity. The effect of the LXR agonists does not depend on the stimulation of
THP-1 macrophages with LPS. T090 induced the SMPDL3A gene expression
with and without LPS. Knockdown of both LXR isoforms followed by the
treatment with T090 showed significant reduction in the expression levels of
47
SMPDL3A demonstrating that the gene is under direct control of LXR, and both
LXR isoforms contribute to the stimulation of the SMPDL3A gene expression.
Collectively, the data indicate SMPDL3A is a direct LXR target gene.
We were intrigued by the observation that SDMPL3A was the only gene
belonging to the sphingomyelinase family to be regulated by LXRs. This may
suggest that SMPDL3A has functions other than sphingomyelinase and
phospodiesterase activities. The fact that the protein levels of SMPDL3A increase
in a concentration-dependent fashion in the T090-treated THP-1 macrophages
implies a functional role of SMPDL3A in leukocytes.
The cell-type specificity of the SMDPL3A regulation by LXRs is also very
interesting phenomenon. The expression of the SMPDL3A gene appears to be
controlled by LXRs in monocytes and macrophages, immortalized cells derived
from monocytic leukemia, and primary cell cultures from healthy donors.
However, no LXR-mediated induction of the SMPDL3A gene was observed in
kidney, liver, skin fibroblasts and neuroglioma immortalized cell lines. Expression
of SMPDL3A is not restricted only to leukocytes. The gene is widely expressed
among human tissues. The significantly higher gene expression levels of
SMDPL3A in kidneys and colon may suggest a particular functional role of this
gene in epithelial cells. Further analysis of SMPDL3A expression in primary cell
cultures will be helpful in assessing the significance of the tissue-specific
regulation of this gene by LXRs. The induction of the SMPDL3A gene by LXRs
may be species-specific, since no increase in gene expression could be observed in
murine macrophage-like cells (RAW264.7) nor any changes had been detected in
three different tissues, including blood, collected from the mice treated with T090.
48
Further work is in progress on elucidation of the functions of SMPDL3A and the
role of LXR-mediated induction of this gene in human monocytes and
macrophages.
2.5 References Auphan N, DiDonato JA, Rosette C, Helmberg A, Karin M (1995) Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of I kappa B synthesis. Science 270 (5234): 286-90.
Bardot O, Aldridge TC, Latruffe N, and Green S (1993). PPAR-RXR heterodimer activates a peroxisome proliferator response element upstream of the bifunctional enzyme gene. Biochem. Biophys. Res. Commun. 192: 37-45. Boehm MF, Zhang L, Zhi L, et al. (1995) Design and synthesis of potent retinoid X receptor selective ligands that induce apoptosis in leukemia cells. J Med Chem; 38: 3146-55. Bookout AL and Mangelsdorf DJ (2003) Quantitative real-time PCR protocol for analysis of nuclear receptor signaling pathways Nuclear Receptor Signaling 1:e012 Calkin AC, Tontonoz P, Liver X Receptor Signaling Pathways and Atherosclerosis (2010) Arterioscler Thromb Vasc Biol. 30 (8): 1513-8
Chang KC, Shen Q, Oh IG, Jelinsky SA, Jenkins SF, Wang W, Wang Y, LaCava M, Yudt MR, Thompson CC, Freedman LP, Chung JH, Nagpal S (2008) Liver X receptor is a therapeutic target for photoaging and chronological skin aging. Mol Endocrinol. 22 (11): 2407-19
Collins JL, Fivush AM, Watson MA, Galardi CM, Lewis MC, et al. (2002) Identification of a nonsteroidal liver X receptor agonist through parallel array synthesis of tertiary amines. J Med Chem. 45 (10): 1963-6.
Fontaine C, Rigamonti E, Nohara A, Gervois P, Teissier E, Fruchart JC, Staels B, Chinetti-Gbaguidi G (2007) Liver X receptor activation potentiates the lipopolysaccharide response in human macrophages. Circ Res.101 (1): 40-9.
Gearing KL, Göttlicher M, Teboul M, Widmark E, Gustafsson JA (1993) Interaction of the peroxisome-proliferator-activated receptor and retinoid X receptor. Proc Natl Acad Sci USA 90 (4): 1440-4.
Ghisletti S, W Huang, Ogawa S, Pascual G, Lin ME , Willson TM, Rosenfeld MG, Glass CK (2007) Parallel SUMOylation-dependent pathways mediate gene- and signal-specific transrepression by LXRs and PPARγ. Mol. Cell. 25: 57-70.
49
Goodwin B, Watson MA, Kim H, Miao J, Kemper JK, Kliewer SA (2003) Differential regulation of rat and human CYP7A1 by the nuclear oxysterol receptor liver X receptor-alpha Mol Endocrinol. 17 (3): 386-94.
Janowski BA, Grogan MJ, Jones SA, Wisely GB, Kliewer SA, Corey EJ, Mangelsdorf DJ (1999) Structural requirements of ligands for the oxysterol liver X receptors LXRa and LXRb Proc Natl Acad Sci 96 (1): 266-71
Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P (2003) Reciprocal regulation of inflammation and lipid metabolism by liver X receptors Nat. Med. 9 (2): 213-9. Laffitte BA, Repa JJ, Joseph SB, Wilpitz DC, Kast HR, Mangelsdorf DJ, Tontonoz P (2001) LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes Proc Natl Acad Sci USA. 98 (2): 507-12.
Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA (1995) An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR gamma). J Biol Chem. 270 (22): 12953-6.
Li Y, Bolten C, Bhat BG, Woodring-Dietz J, Li S, Prayaga SK, Xia C, Lala DS (2002) Induction of human liver X receptor α gene expression via an autoregulatory loop mechanism Mol. Endocrinol. 16 (3): 506-14. Mak PA, Laffitte BA, Desrumaux C, Joseph SB, Curtiss LK, Mangelsdorf DJ, Tontonoz P, Edwards PA (2002) Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. A critical role for nuclear liver X receptors alpha and beta J Biol Chem. 277: 31900–31908.
Pehkonen P, Welter-Stahl L, Diwo J, Ryynanen J, Wienecke-Baldacchino A, Heikkinen S, Treuter E, Steffensen KR, Carlberg C (2012) Genome-wide landscape of liver X receptor chromatin binding and gene regulation in human macrophages BMC Genomics 13 (1): 50.
Phelan CA, Weaver JM, Steger DJ, Joshi S, Maslany JT, Collins JL, Zuercher WJ, Willson TM, Walker M, Jaye M, Lazar MA (2008) Selective partial agonism of liver X receptor alpha is related to differential corepressor recruitment Mol Endocrinol. 22 (10): 2241-9
Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shimomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ (2000) Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta Genes Dev. 14 (22): 2819-30. Sandelin A and Wasserman WW (2005) Prediction of nuclear hormone receptor response elements Mol Endocrinol. 19 (3): 595-606
50
Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, Schwendner S, Wang S, Thoolen M, Mangelsdorf DJ, Lustig KD, Shan B (2000) Role of LXRs in control of lipogenesis Genes Dev.14 (22): 2831-8. Shang Y and Brown M (2002) Molecular determinants for the tissue specificity of SERMs Science 295 (5564): 2465-8. Suon S, Zhao J, Villarreal SA, Anumula N, Liu M, Carangia LM, Renger JJ, Zerbinatti CV (2010) Systemic treatment with liver X receptor agonists raises apolipoprotein E, cholesterol, and amyloid-β peptides in the cerebral spinal fluid of rats Mol Neurodegener. 29: 5:44. Truman JP, Al Gadban MM, Smith KJ, Hammad SM (2011) Acid sphingomyelinase in macrophage biology Cell Mol Life Sci. 68 (20): 3293-305. Venkateswaran A, Laffitte BA, Joseph SB, Mak PA, Wilpitz DC, Edwards PA, Tontonoz P (2000) Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha Proc Natl Acad Sci USA. 97 (22):1 2097-102. Wang SW, Parhar K, Chiu KJ, Tran A, Gangoiti P, Kong J et al (2007) Pertussis toxin promotes macrophage survival through inhibition of acid sphingomyelinase and activation of the phosphoinositide 3-kinase/protein kinase B pathway Cell Signal 19 (8): 1772-1783. Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA, Mangelsdorf DJ (1995) LXR, a nuclear receptor that defines a distinct retinoid response pathway Genes Dev. 9 (9): 1033-45. Wright KO, Messing EM, Reeder JE (2002) Increased expression of the acid sphingomyelinase-like protein ASML3a in bladder tumors J Urol. 168 (6): 2645-9.
51
2.6. Figure Legends Figure 1. A, Results of the genome-wide analysis of human genes in THP-1
macrophages. Transactivation of known LXR target genes by T090 (T) and
GW3965 (G) and LXR-mediated transrepression of LPS-induced genes. Cells
were pre-treated with either 1 μM T090 or GW3965 for 1 hour and then incubated
for 8 hours with either LPS-containing- or plain media. SMPDL3A is identified as
a novel LXR target gene. B, Regulation of CCL4 by LXRs confirmed via RT-
PCR (THP-1 macrophages treated the same way as for the genome-wide
analysis). C, Relative expression of the SMDPL3A gene in THP-1-macrophages
treated with 1 μM of either LXR ligand for 8 hours. Data represent mean ± SD
(n=4). *p < 0.05, **p<0.01, ***p<0.001 as determined by Student’s t-test.
Figure 2. Regulation of the SMPDL3A gene by LXRs in THP-1 cells.
The relative expression of all genes analyzed was measured by real-time PCR.
A, Relative expression of human sphingomyelinases in THP-1 cells (monocytes
versus derived-macrophages) treated with 1μM T090 for 24 hours.
B, Concentration-dependent SMDPL3A gene induction by T090 in THP-1
macrophages. The extrapolated EC50 is ~ 80 nM. C, Western Blot analysis of
SMPDL3A expression in THP-1-derived macrophages treated with either DMSO
(lane 1) or T090 at 50, 500 and 5,000 nM for 24 hours (lanes 2-4). 100 μg of total
cell lysates were resolved by SDS-PAGE, blotted to nitrocellulose, and stained
with 1.7 μg/ml anti-SMPDL3A followed by DAM-HRP (1:2,000). D, Time-
dependent SMPDL3A gene up regulation by 1 μM T090 with and without 100
ng/ml LPS. For each time point, the “DMSO+LPS” data (ΔΔCt) was normalized
52
to “DMSO” data (ΔCt) and the “T090+LPS” data was in turn normalized to the
“DMSO+LPS” data. Data represent mean ± SD (n=4). *p < 0.05, **p<0.01,
***p<0.001 as determined by Student’s t-test.
Figure 3. A, LXR-mediated induction of the SMPDL3A gene. THP-1
macrophages were treated with either scrambled siRNA or LXRα/β siRNA for 24
hours and incubated with the LXR ligand for 4, 8 and 24 hours. B, Treatment with
either 30 nM of either T090 or LG100268 for 18 hours leads to SMDPL3A gene
induction. Data represent mean ± SD (n=4). *p < 0.05, **p<0.01, ***p<0.001 as
determined by Student’s t-test.
Figure 4. Cell type-specific induction of the SMDPL3A gene by LXRs.
A, Relative expression of the SMPDL3A gene across a panel of human tissues
(Clontech Human MTC™ Panels I and II). Data normalized to spleen tissue
(lowest expression) B, SMPDL3A mRNA levels in several cell-lines treated with
three different concentrations of T090 for 24 hours. C, Significant induction of the
SMPDL3A and ABCA1 (control) genes by T090 in human peripheral blood
mononuclear cells isolated from two healthy donors. Data represent mean ± SD
(n=4). *p < 0.05, **p<0.01, ***p<0.001 as determined by Student’s t-test.
Figure 5. Identification of a DR-4 type LXRE within the human SMPDL3A gene.
A, Electromobility Shift Assays (EMSAs) using purified full-length LXRs and
RXRα with the DR4-LXRE sequence identified within the SMPDL3A gene
(2095-2130). Both LXRα:RXRα and LXRβ:RXRα bind to the LXRE (lanes 4 and
7, respectively). Excess of non-biotinylated probe (200X) abolishes the interaction
53
of the LXR:RXR heterodimers with the Biotin-LXRE (lanes 5 and 8). B,
Chromatin Immunoprecipitation Assays (ChIP) for THP-1 macrophages.
Treatment with 5μM T090 for 24hr increases the occupancy of LXRα within the
SMDPL3A gene. The known LXR target gene, ABCA1, was included in the
analysis as a positive control. ChIP signal was normalized to nonspecific DNA
region spanning the 36B4 gene, and data represent mean ± SD (n=4). Data are
from a representative experiment repeated three times with similar results.
*p<0.05, **p<0.01, ***p<0.001 as determined by Student’s t-test.
Figure 6. Analysis of gene expression for Smpdl3a in mouse tissues. A,
Treatment with T090 at various concentrations for 24 hours does not induce the
gene expression of Smpdl3a in RAW264.7 macrophages as opposed to the control
LXR target-gene, Abca1. B, Gene expression analysis of Smpdl3a in tissues
collected from mice treated with either vehicle or 30 mpk T090 for four days.
Data represent mean ± SD (n=4). *p < 0.05, **p<0.01, ***p<0.001 as determined
by Student’s t-test.
70
CHAPTER 3: LXR TRANSCRIPTOME IN CYNOMOLGUS MONKEY BRAIN
Paul B. Noto1,2, Yuri Bukhtiyarov1, Gerard M. McGeehan1 and Deepak S. Lala1.
1Discovery Biology, Vitae Pharmaceuticals, Inc, Fort Washington, Pennsylvania
2Department of Biology, Drexel University, Philadelphia, Pennsylvania (PBN)
71
Abstract Recent evidence has established a critical role for LXRs in lipid metabolism in the
central nervous system (CNS), and these receptors have emerged as attractive
targets for the treatment of Alzheimer’s disease (AD). In mouse brain, activation
of LXRs induces both abca1 and apoE levels, leading to increased Aβ clearance.
Benefits of LXR modulators on cognition and amyloid load in the brain have been
demonstrated in several rodent models of AD. Nonetheless, the ABCA1-ApoE-
dependent Aβ clearance has not yet been investigated in higher species, such as
non-human primates. Therefore, we treated Cynomolgus monkeys with a potent,
CNS-penetrant, LXRβ-selective agonist (VTP-5) for 14 days and examined the
effect on ABCA1 and ApoE gene expression as well as Aβ levels in cerebral
cortex and hippocampus.
The LXR modulator significantly increased the expression of ABCA1 and ApoE
in the brain with a concomitant decrease in hippocampal Aβ42 levels. Here, we
also show auto-induction of LXRα in monkey brain, but not liver. This has only
been shown in human cells but not rodents. Additionally, we investigated
modulation of the LXR transcriptome by VTP-5 in Cynomolgus brain via RNA-
sequencing. Our findings revealed the upregulation of apolipoprotein AI (Apo-AI)
by VTP-5, strengthening the role of LXRs at the cerebrovascular level. Taken
together with the key aspects of LXR-mediated effects on AD markers in non-
human primates, our data further validate LXRs as attractive targets for the
treatment of AD in humans.
72
3.1 Introduction Liver X receptors (LXRs) are nuclear hormone receptors that act as oxysterol
sensors, regulating genes involved in cholesterol and lipid metabolism (Janowski
et al., 1999). Whenever the intracellular levels oxysterols rise, as the result of
excessive cholesterol, LXRs activate ATP-binding cassette (ABC) transporters,
such as ABCA1/G1/G5/G8, to promote cholesterol efflux to high-density
lipoproteins (HDL) particles, via specific interaction with Apo-AI (Chambenoit et
al., 2001). Although LXRs represent attractive therapeutic targets for the
treatment of atherosclerosis, due to their ability to promote reverse cholesterol
transport (RCT) upon activation by both natural and synthetic agonists (Joseph et
al., 2002), a compelling undesired effect is the parallel activation of sterol
regulatory element-binding protein-1c (SREBP1c) (Repa et al., 2000) and
upregulation of several other genes involved in fatty acid synthesis such as Fatty
Acid Snythase (FAS) and Acetyl-CoA Carboxylase (ACC) leading to lipogenesis
(Calkin and Tontonoz, 2010).
LXRα and LXRβ are diversely expressed in tissues. While LXRα is primarily
expressed in liver, intestine, adipose tissue and macrophages, LXRβ is present in
all tissues and organs (Annicotte et al., 2004; Su et al, 2004). Given the higher
levels of expression of LXRα in liver, with respect to LXRβ, LXRα has been
suggested to be major driver for the upregulation of lipogenic genes upon
activation with ligands. Therefore, development of LXRβ-selective synthetic
ligands may represent a therapeutic advantage by limiting activation of LXRα in
liver (Bradley et al., 2007).
Although the LXR signaling pathway is mostly conserved across species, LXRs
can also regulate their target genes in a species- and isoform-specific fashion.
73
Examples of genes differentially regulated across species include CYP7A1, the
rate-limiting enzyme in bile acid synthesis, which is activated by LXRs in mouse
but not in human (Goodwin et al., 2003) and the Toll-like receptor 4 (TLR4),
which is up-regulated by LXR agonists in human but not mouse macrophages
(Fontaine et al., 2007). Another example is the SMPDL3A (Sphingomyelin
Phosphodiesterase Acid-Like 3A) gene, which is regulated by LXRs in humans,
but not rodents, in a tissue-specific fashion (Noto et al., 2012). Similarly, in
human macrophages LXRα, but not LXRβ, positively controls its own expression
upon activation with known LXR ligands and this effect has not been observed in
murine macrophages (Li et al., 2002). An additional example of isoform-specific
regulation is the AIM gene (also known as Spα), which is induced by LXRα, but
not LXRβ, in murine macrophages (Joseph et al., 2004)
Recently, modulation of LXRs has been proposed for the treatment of
Alzheimer’s disease. Several studies have demonstrated that activation of LXRs
results in increased apolipoprotein E (ApoE) levels in murine and human
macrophages (Mak et al., 2002; Jiang et al., 2003) and in rat brain, in which
higher levels of lipidated apolipoprotein E positively correlate with amyloid Aβ
clearance (Suon et al., 2010). The clearance process requires the transfer of
intracellular cholesterol via ABCA1 onto interstitial ApoE (Wharle et al., 2004;
Hirsch-Reinshagen et al., 2005) to form HDL-like particles (Fagan et al., 1999).
Importantly, lipidation of ApoE appears to be required in order to enhance both
degradation and efflux of the neurotoxic amyloid peptides, Aβ40 and Aβ42
(Tokuda et al., 2000; Morikawa et al., 2005; Bell et al., 2007). Treatment with
LXR modulators has been proven beneficial in several rodent models of AD, by
74
improving cognitive functions and reducing amyloid load in brain (Jiang et al.,
2008; Fitz et al., 2010).
Here we demonstrate that treatment of Cynomolgus monkeys for 14 days with a
potent, bioavailable and brain-penetrant LXR modulator (VTP-5) leads to
increased levels of ABCA1 and ApoE in the brain, with a concomitant decrease in
Aβ42 levels in hippocampus. For the first time in non-human primates, we also
show auto-induction of LXRα in the brain, but not in the liver. Most
importantly, RNA-sequencing of Cynomolgus brain tissue revealed new insights
on modulation of gene expression by LXRs.
75
3.2 Material and Methods
VTP-5 was synthesized at Vitae Pharmaceuticals, Inc. The LXR ligands GW3965
and TO901317 were purchased from Tocris (catalog # 2474 and 2373).
3.2.1. Cell Culture and treatment of CCF-STTG1 cells
Cells were purchased from ATCC (catalog # CRL-1718) and maintained in
RPMI 1640 medium with Glutamax (Invitrogen, catalog # 61870127)
supplemented with 10% fetal bovine serum (Hyclone, catalog # SH30531) and
antibiotics [penicillin (50 U/ml)-streptomycin (50 μg/ml), Invitrogen, catalog #
15070063] at 37°C under 5% CO2. Twenty-four hours before treatment, CCF-
STTG1 cells were harvested and plated in 6-well plates at a density of 2.5 x 105
cells/well and incubated overnight with complete growth medium for attachment.
Medium was replaced with RPMI 1640 medium with Glutamax supplemented
with 0.2% fatty acid-free bovine serum albumin (Sigma, catalog # A6003) and
incubated for an additional 24 hours. Cells were treated for 48 hours with DMSO
or LXR ligands as described in figure legends.
3.2.2. ApoE protein analysis in human CCF-astrocytes.
Cell supernatants were collected prior to lysing cells. Briefly, cells were lysed in
cold RIPA buffer, supplemented with protease inhibitors cocktail, and sonicated
on a cup horn (Fisher Scientific) for 2 minutes with 30 second-bursts. Cell lysates
were cleared by centrifugation for 10 minutes at 14,000 rpm at 4oC.
Lysates were subjected to Bradford assay for assessing protein concentration.
Western Blots were carried out by resolving 100 μg of protein from the total cell
lysates by SDS-PAGE, blotting to nitrocellulose, and probing overnight at 4oC
76
with 1:1,000 diluted polyclonal anti-ApoE antibody produced in goat (EMD,
catalog # 178479) followed by the incubation with 1:30,000 diluted rabbit anti-
goat-HRP conjugate (EMD, catalog # 401515). As a loading control, the blot was
cut and stained with 1:20,000 diluted, HRP-conjugated, anti-β-actin antibody
(GenScript, catalog # A00730).
3.2.3. Experimental protocol for monkey studies
Cynomolgus monkeys (Macaca fascicularis) (non-naïve) were used for this study.
The monkeys were housed and treated at the testing facility of SNBL USA, Ltd.
(Everett, WA 98203). A total of 16 monkeys were randomized into four groups
(four per treatment group; all males, 3.4–6.3 kg, 4–8 years of age) and treated via
nasogastric (NG) intubation with vehicle or VTP-5 at doses of 0.1, 0.3 and 1
mg/kg/day once daily for 14 days, within 2 hours of lights on. The diet was
routinely analyzed for contaminants and found to be within the manufacturer’s
specifications. Food analysis records were maintained at the testing facility.
Animals were fed twice a day and food was withheld for at least 4 hours post-
dose. The vehicle used for the study contained 0.5% Natrosol and 1% Polysorbate
80 in water. VTP5 was prepared in this vehicle. Body weights were assessed twice
during acclimation, including the day prior to the first dosing (day 1), and then
weekly throughout the dosing phase. A blood sample was obtained from all
animals two days prior to initiation of dosing (pre-dose baseline), between 4 and 6
hours after lights on. Blood was collected at 4 hours (prior to feeding) and 8
hours post dose on days 1, 3, 5, 7, 11 and 14. On day 14, animals were sedated
with an IM injection of ketamine and anesthetized with an intravenous injection of
Euthasol® followed by exsanguination. Tissue samples from the left cerebrum,
77
left lobe of the liver and duodenum were collected and snap frozen in liquid
nitrogen. Additionally, the right hippocampus was split into 5 sections (~0.1 cm3)
and transferred to a cassette, snap frozen and stored at -60ºC. Animals were
treated in accordance with standard procedures for veterinary care and in
compliance with USDA and animal welfare guidelines.
3.2.4. Gene expression analysis in cells and tissues.
Total RNA from CCF-astrocytes was isolated using RNeasy columns (Qiagen),
following the manufacturer’s instructions.
Approximately 50 mg of frozen cerebrum and liver tissue was homogenized in 1
mL of QIAzol reagent followed by addition of 0.5 mL chloroform. Samples were
vortexed and centrifuged at 14,000 rpm for 15 minutes at 4ºC. The aqueous phase
was recovered and isolation of total RNA was performed using RNeasy columns
(Qiagen), following the manufacturer’s instructions.
cDNA was synthesized and subjected to real-time PCR using One-Step RT-PCR
reagents (Applied Biosystems). Primer probe sets for all genes analyzed were
purchased from Applied Biosystems. Gene expression analysis was carried out
according to the method described by Bookout and Mangelsdorf (Bookout AL and
Mangelsdorf DJ, 2003).
3.2.5. ABCA1, ApoE and Apo-AI protein analysis in monkey cerebrum.
Approximately 50 mg of frozen cerebrum tissue was homogenized in 10 volumes
of cold RIPA buffer, supplemented with protease inhibitors cocktail. Lysates were
incubated on ice for 30 minutes and cleared by centrifugation for 30 minutes at
14,000 rpm at 4ºC. Lysates were subjected to Bradford assay for assessing protein
concentration. Lysates from the animals of each group were pooled and Western
78
Blots were carried out by resolving 60 μg of protein from the total cell lysates by
SDS-PAGE, blotting to nitrocellulose, and probing overnight at 4ºC with the
following primary antibodies diluted 1:1,000: monoclonal anti-ABCA1 antibody
produced in mouse (Abcam, catalog # ab18180), monoclonal anti-Apo-AI
antibody produced in mouse (Cell Signaling, catalog # 3350), 1:1,000 diluted
polyclonal anti-ApoE antibody produced in goat (EMD, catalog # 178479).
ABCA1 and Apo-AI blots were then incubated with 1:5,000 diluted donkey anti-
mouse-HRP conjugate (Jackson ImmunoResearch Laboratories, catalog # 715-
035-151).
The ApoE blot incubation with 1:30,000 diluted rabbit anti-goat-HRP conjugate
(EMD, catalog # 401515). As a loading control, an additional blot was stained
with 1:20,000 diluted, HRP-conjugated, anti-β-actin antibody (GenScript, catalog
# A00730).
3.2.6. Analysis of Aβ peptides levels in monkey cerebra and hippocampi. 30-70 mg of either cerebra or hippocampi samples were homogenized in 3
volumes of lysis buffer (20 mM TRIS-HCl, pH 8; 0.2% Triton X-100
supplemented with protease inhibitors cocktail) and cleared by centrifugation for
60 minutes at 21,000 x g at 4ºC. Supernatants were subjected to immunodetection
of Aβ peptides using the MSD 96-well MULTI-SPOT Human/rodent Abeta
Triplex Ultra-Sensitive Assay (Mesoscale Discovery, catalog # K15141E-2).
79
3.2.7. RNA-sequencing of monkey cerebra. Total RNA from the four animals of both vehicle and VTP-5 (0.3 mpk) groups
was pooled and sent to Ambry Genetics (Aliso Viejo, CA) for RNA sequencing.
At the facility, samples were prepared using the Illumina protocol outlined in
“TruSeq RNA Sample Preparation Guide” (Part# 15008136 Rev. A November
2010). First, mRNA was purified from total RNA using magnetic oligo (dT)
beads, and then fragmented using divalent cations under elevated temperature.
cDNA was synthesized from the fragmented mRNA using Superscript II
(Invitrogen), followed by 2nd strand synthesis. cDNA fragment ends were
repaired and phosphorylated using Klenow, T4 DNA Polymerase and T4
Polynucleotide Kinase. Next, an ‘A’ base was added to the 3’ end of the blunted
fragments, followed by ligation of Illumina adapters via T-A mediated ligation.
The ligated products were size selected by AMPure XP Beads and then PCR
amplified using Illumina primers. The library size and concentration were
determined using an Agilent Bioanalyzer. The libraries were seeded onto the
flowcell at 6pM per lane (HiSeq2500) yielding approximately 600K pass-filter
clusters per mm2 tile area. The libraries were sequenced using 101+7+101 cycles
of chemistry and imaging.
Initial data processing and base calling, including extraction of cluster intensities,
was done using RTA 1.17.20 (HiSeq Control Software 2.0.5). Sequence quality
filtering script was executed in the Illumina CASAVA software (ver 1.8.2,
Illumina, Hayward, CA).
Mapping, read quantification, differential expression and KEGG pathway
enrichment analysis were performed at ContigExpress (New York, NY). Briefly,
the Illumina paired-end 2x100bp reads for each RNA sample were mapped to the
80
Cynomolgus macaque genome (Beijing Genome Institute, BGI) using the
splicing-aware mapper, TopHat. The resulting BAM files were processed for gene
quantification in FPKM and differential expression analysis using Cufflinks. For
identified differentially expressed (DE) genes (FDR ≤ 0.05), KEGG pathway
enrichment analysis was performed. Cynomolgus macaque genomic sequence,
gene predication, and functional annotation were downloaded from
http://macaque.genomics.org.cn/page/species/index.jsp (Yan et al., 2006). The
references sequences were indexed using Bowtie2 (Langmead et al., 2012) and the
raw reads were mapped with standard paired-end parameters using TopHat
(Trapnell et al., 2009). Mapped statistics were calculated using Picard (weblink).
Overall mapping rates ranged from 52% to 84%. The recent version of the
Cufflinks software (Roberts et al., 2011) was utilized for read quantification and
differential expression analysis, according to the predicted gene structures due to
the limited annotations available for the reference genome. The identified DE
genes in each pair-wise comparison were subjected to KEGG pathway enrichment
analysis using KOBAS (Xie et al., 2011).
81
3.3 Results
3.3.1 VTP-5 is a potent, LXRβ selective modulator.
VTP-5 is a small synthetic molecule developed at Vitae Pharmaceuticals that
shows significant affinity for the ligand-binding domains (LBD) of LXRα and
LXRβ. VTP-5 possesses higher affinity for the LXRβ-LBD. The binding
constants (Ki), obtained by displacement of radiolabeled T0901317, are 295 and
17 nM for LXRα and LXRβ, respectively. Consistent with the Ki’s, VTP-5 shows
the ability to activate both receptors in Gal4 transactivation cell-based assays,
with EC50s equal to 282 nM and 12 nM for LXRα and LXRβ, respectively. We
have also assessed the selectivity of VTP-5 for LXRs over other hormone nuclear
receptors. The compound did not show affinity towards any of the tested receptors
and most importantly did not activate the retinoid X receptors (RXRs), LXRs’
obligate heterodimer partners (Willy et al., 1995). In-depth characterization of
VTP-5 will be published elsewhere.
3.3.2 VTP-5 increases expression of ABCA1 and ApoE in human astrocytes.
We employed cultured human CCF-STTG1 astrocytes to show the LXR-mediated
increased expression of ABCA1 and ApoE. As shown in Figure 1A, treatment of
astrocytes with known LXR modulators, such as T0901317 and GW3965, and
VTP-5 for 48 hours led to a concentration-dependent increase in the transcription
levels of ABCA1 and, here shown for the first time in human cells, ApoE.
Consistent with the increased levels of ApoE transcript, we observed a
concentration-dependent increase in the protein levels of apoE in both cell lysate
and supernatants by Western Blot analysis (Fig. 1B).
82
3.3.3. VTP-5 significantly increases expression of ABCA1 and ApoE in
cerebral cortex in primates.
In order to assess the efficacy and bioavailability of VTP-5 in non-human
primates, Cynomolgus macaques (Macaca fascicularis) were treated with doses of
0.1-0.3 and 1 mg/kg via oral administration once a day for 14 days. Four hours
after the last dosing on day 14, animals were sacrificed and several relevant
organs were collected for gene expression analysis and drug exposure. VTP-5 was
found in high concentration in plasma and brain tissues at all doses (personal
communication).
Treatment with VTP-5 led to a significant dose-dependent up-regulation of
ABCA1 gene levels in brain cortical tissues. As demonstrated by RT-PCR
(Fig.2A), VTP-5 induced ABCA1 mRNA levels 2 to 4 fold over the vehicle
control.
We also measured the protein levels of both ABCA1 and ApoE in the same
tissues by Western Blot analysis (Fig. 2B). When compared to vehicle-treated
animals, VTP-5 was able to yield a substantial dose-dependent increase in
ABCA1 and ApoE levels after 14 days of treatment.
3.3.4. VTP-5 lowers Aβ1-42 in primate hippocampus in a dose-dependent
manner.
In order to address the potential beneficial role of LXR modulators in the context
of amyloid pathogenesis and Alzheimer’s’ disease, we measured the levels of
Aβ1-42 peptide in both brain cortical and hippocampal tissues after treatment with
VTP-5 for 14 days.
83
As shown in figure 3, at the highest dose the compound was able to yield
approximately 37% decrease in the levels of Aβ1-42 in hippocampus, but not
cerebral cortex (data not shown).
Although the effects observed at all doses did not reach statistical significance, the
reduction of Aβ1-42 levels appeared to follow a dose-dependent trend without any
significant accumulation of triglycerides in either plasma or liver tissues at 0.1 and
0.3 mpk (this data will be presented elsewhere).
3.3.5 LXRα and LXRβ are expressed at different levels in Cynomolgus brain
and liver tissues.
In order to address the biological implications of LXRβ selective-activation by
VTP-5 across tissues, we measured the levels of expression of both LXR isoforms
in both brain and liver samples from animals treated with either vehicle or VTP-5
at 0.3 mg/kg for 14 days. First, we verified that the binding efficiency of the RT-
PCR primer probe sets for both LXRs was comparable. This was assessed by
employing DNA constructs that encode for both full-length human LXRα and
LXRβ (data not shown). As shown in figure 4A, the expression levels of LXRβ
are significantly higher than LXRα in brain, as opposed to liver where LXRα
appears to be expressed at higher levels with respect to LXRβ. While LXRβ
transcript levels do not seem to vary significantly across brain and liver tissues,
the expression levels of LXRα are abundantly higher in liver with respect to brain.
Also, treatment with VTP-5 led to increased LXRα expression in brain at all doses
(Fig. 4B). The auto-regulatory loop mechanism has been previously shown for
LXRα, but not LXRβ, in human macrophages (Li et al., 2002) and, through the
present study, appears to be limited to brain only, as no significant induction of
84
LXRα was observed in liver upon treatment with VTP-5. Consistently, no
induction of LXRβ by the LXR agonist was observed in either brain or liver
tissues.
3.3.6. RNA-sequencing of monkey cerebrum confirms the induction of
several known LXR target genes by treatment with VTP-5.
In order to profile the LXR transcriptome in brain after treatment with VTP-5 at
0.3 mpk for 14 days, we subjected RNA from cerebral cortex to sequencing
(performed by Ambry Genetics). In table 1, we show several known LXR target
genes involved in both cholesterol and lipid metabolism that were upregulated in a
statistically significant fashion (in-depth analysis performed by ContigExpress).
Importantly, these include both ABC transporters (A1/G1) and, although to a
lower extent, ApoE. Interestingly, for the first time in monkey brain, LXR
activation led to induction of both lipoprotein lipase (LPL) and phospholipid
transfer protein (PLTP), previously shown to be regulated by LXRs in
macrophages and liver only (Zhang et al., 2001; Laffitte et al., 2003).
Additionally, treatment with the LXR modulator resulted in the induction of the
lipogenic genes SREBF and SCD. Preliminary sequencing results had revealed a
substantial induction of Apo-AI, which was later confirmed by RT-PCR (figure
5A) and western blotting (Figure 6). Also, RNA-sequencing revealed a mild
increase in the levels of Tissue Plasminogen Activator (PLAT) levels. This was an
intriguing finding, given the potential benefit in the context of cerebrovascular
ischemia (Papadopoulus et al., 1987).
85
3.3.7. VTP-5 promotes Aβ clearance without affecting key genes involved in
Aβ synthesis/degradation
Next, we wanted to understand whether the effect on Aβ42 lowering observed in
hippocampi is entirely dependent on increased levels of both ABCA1 and ApoE
or resulting from changes in the expression of key genes involved in the
generation and/or degradation of amyloid peptides. As shown in table 2, treatment
with VTP-5 did not affect either the transcription levels of the amyloid precursor
protein (APP), nor the expression of key enzymes involved into the processing of
APP, such as α−β- and γ secretases, which have an impact on generation of
amyloidogenic peptides (Lammich et al., 1999; Vassar et al., 1999; Hansson et al.,
2004).
3.3.8. VTP-5 induces mRNA expression of Apo-AI and PLAT genes.
In order to verify the induction of Apo-AI and PLAT by VTP-5, we performed
RT-PCR on RNA from all animals treated with VTP-5 at all doses. As shown in
Figure 5 (A-B), the compound led to a substantial upregulation of the Apo-AI
gene, in particular at 1 mpk, and a mild induction of PLAT transcription levels at
all doses.
Additionally, we investigated the effects of VTP-5 on the gene expression of both
apo-a1 and plat in cerebrums from mice treated with the compound at 30 mpk for
4 days. While the transcription levels of murine plat were modest, apo-a1 mRNA
was nearly undetectable. Despite the gene induction of abca1 by VTP-5, no effect
by the drug was seen on either apo-a1 or plat genes (data not shown). This might
suggest species-specific differences for the LXR mediated regulation of both Apo-
AI and PLAT.
86
3.3.9. VTP-5 increases the Apo-AI protein levels in Cynomolgus cerebrums.
Next, we wanted to assess whether the induction of Apo-AI gene expression
observed via both RNA sequencing and RT-PCR translated in increased protein
levels. As shown in figure 6, the LXR modulator led to a dose-dependent increase
of Apo-AI protein.
3.3.10. KEGG pathway analysis reveals a possible involvement of LXRs in
neurotransmission.
As shown in table 3, we summarized pathways affected by treatment with VTP-5
at 0.3 mpk based on their statistically significance (p<0.05). Although we’re
currently in the process of following up with several of the listed genes, LXR
activation appears to yield changes on pathways that regulate neurotransmission
and, possibly cognitive function.
For instance, both dopamine receptors D1 and D2 (DRD1/2) were upregulated.
VTP-5 also led to increased levels of several other key enzymes downstream of
the dopaminergic signaling cascade, such as adenylate cyclase type 5 (ADCY5)
and regulator of g-protein signalling 9 (RGS9), which lead to an overall increase
of intracellular cyclic adenosine monophosphate (cAMP). Interestingly, it has
been shown that RGS9 KO mice exhibit a lack of motor coordination and
impaired working memory (Blundell et al, 2008). Furthermore, the LXR
modulator led to downregulation of the metabotropic glutamate receptor 2/3
(GRM2/3), which exerts inhibitory effects on the cAMP cascade (Flor et al.,
1995).
The analysis also revealed upregulation of the serotonin receptor 2A (HTR2),
which has been extensively studied and shown to be involved in several distinct
processes, such as learning (Wood et al., 2011) and inflammation, by inhibiting
87
the pro-inflammatory effects mediated by tumor necrosis factor α (TNFα) (Yu et
al., 2008). Several genes involved in synaptic vesicular transport were
differentially regulated by treatment with VTP-5. These include members of the
Synaptotagmin family, which act as calcium sensors and are involved in both
synaptic vesicle docking and fusion with presynaptic membranes (Fukuda et al.,
2000; Pang et al., 2006) for neurotransmitter release.
Despite the bidirectional modulation of several members of the carbonic
anhydrase family, the physiological relevance of these genes in neurobiology
requires further elucidation and will be addressed elsewhere.
Finally, several genes involved in lipid metabolism, and which are involved in
PPAR signaling, were positively regulated. Among these, and as previously
discussed, known LXR target genes were induced, such as SCD, PLTP and LPL.
Interestingly, RXRγ was significantly upregulated. The relevance of SORBS1 and
FABP3 gene expression in brain will require further investigation.
3.4 Discussion
We wanted to assess whether the mechanism of ABCA1/ApoE-mediated brain Aβ
clearance shown in rodent models is conserved in higher species, such as non-
human primates. First, we investigated and confirmed the ability of human
astrocytic cells to upregulate both ABCA1 and ApoE genes upon LXR activation.
Also, our results show induction of ApoE at both the mRNA and protein level.
Induction of ApoE at the transcription level has been somewhat controversial, as
some authors have demonstrated that LXRs do not up-regulate apoE mRNA levels
in either neurons or glial cells in mice (Whitney et al., 2002) while others have
88
clearly showed the increase of apoE mRNA in murine astrocytes and glial cells
(Lefterov et al., 2007).
Treatment of Cynomolgus monkeys with a potent, CNS penetrant LXRβ-selective
modulator for 14 days clearly led to upregulation of LXR target genes, ABCA1
and ApoE. VTP-5 was able to yield a substantial dose-dependent increase in
ABCA1 and ApoE protein levels. Next, we looked at the levels of Aβ42 in both
hippocampus and cerebral cortex. Upon treatment with VTP-5 we were able to
observe a mild, but dose-dependent reduction of the amyloid peptide in
hippocampi only. No effect on either Aβ40 or Aβ42 was observed in cerebral
cortex. This is indeed consistent with observations made in Tg2576 mice, an
established model of AD, highlighting that the T090-mediated reduction of Aβ42,
but not Aβ40, is restricted to hippocampi only (Riddell et al., 2007). The effect on
hippocampal Aβ42 was achieved at doses that did not cause accumulation of
either plasma or liver triglycerides. In order to assess whether selective LXRβ
activation confers tissue-specific modulation of LXR target genes, we measured
the expression of both LXR isoforms in brain and liver tissues.
Consistent with previous reports (Whitney et al., 2002), we show that LXRβ is
more abundant than LXRα in monkey brain. Despite the comparable levels of
LXRβ in both brain and liver tissues, LXRα is expressed at much higher levels in
liver. Interestingly, treatment with VTP-5 leads to increased LXRα expression in
brain, but not liver. This represents a biological advantage for the development of
LXRβ selective modulators, which would allow better separation of beneficial
effects, such as enhanced RCT and reduction of Aβ burden in brain, from
undesired triglyceride elevation in liver (Calkin and Tontonoz, 2010).
89
RNA-sequencing of brain total RNA from VTP-5-treated monkeys allowed us to
confirm the induction of several LXR target genes, including the ABC
transporters, factors involved in lipid metabolism and PLTP. Although regulation
of PLTP by LXRs has been shown to be restricted to liver and lipid-loaded
macrophages (Laffitte et al., 2003), it is quite interesting to observe this in brain
tissue as well as it may prove beneficial in supporting cholesterol efflux from
atherosclerotic lesions. Importantly, the reduction of hippocampal Aβ42 appears
to be ABCA1/ApoE-dependent, as VTP-5 had no effect on the expression of any
of the genes involved in either Aβ synthesis or degradation.
Our results also revealed both mRNA and protein induction of Apo-AI, a critical
component of the RCT machinery (Chambenoit et al., 2001). Upregulation of
Apo-AI has also been observed in mouse brain and hippocampus, upon treatment
with the LXR full agonist, T090 (Lefterov et al., 2007; Fitz et al., 2010). This
supports the LXR-mediated induction of Apo-AI we observed in non-human
primates.
Despite the primary role of ApoE in brain cholesterol homeostasis (Elliott et al.,
2010) and amyloid metabolism (Jiang et al., 2008) with respect to other
apolipoproteins, increased Apo-AI levels may enhance the reduction of
cholesterol overload at the cerebrovascular level and possibly contribute to Aβ
clearance. In facts, the ability of Apo-AI to bind Aβ peptides has already been
shown in murine cells (Burns et al., 2006) and postmortem cerebrospinal fluid
(CSF) samples from AD patients (Paula-Lima et al., 2009).
Additionally, our RNA-sequencing results showed a mild induction of PLAT,
which was verified by RT-PCR. Upregulation of PLAT not only might improve
cerebrovascular conditions by promoting fibrinolysis and breakdown of clots, but
90
also contribute to Aβ clearance and inhibit amyloid-induced neurotoxicity, as
shown in mouse models of AD (Melchor et al., 2003).
KEGG pathway analysis revealed a very intriguing modulation of neurochemical
processes by LXR activation, suggesting a potential beneficial role of LXRs on
cognitive functions. Indeed, the LXR modulator affected the expression of key
genes involved in dopaminergic signaling cascades, such as DRD1/2 and ADCY5,
and synaptic plasticity, which ultimately leads to enhanced release of
neurotransmitters. To a certain extent, these findings are in line with the
observations reported by Dai et al (2012), showing the protective role of LXRβ on
dopaminergic neurons in a mouse model of Parkinson’s disease (PD).
Additionally, our findings showed induction of HTR2, which has been shown to
be involved in learning processes (Wood et al., 2011). Several of the findings just
discussed will require in-depth validation to assess whether such effects are
directly mediated by LXRs or result from secondary mechanisms that originate
from sub-chronic treatment of animals with LXR modulators. Overall, our
observations support the line of evidence established by other groups on the
critical role of LXR activation in rodent models of AD, showing improvement in
contextual memory (Jiang et al., 2008; Fitz et al., 2010).
In conclusion, we show that the treatment of non-human primates with a potent,
CNS-penetrant LXRβ selective modulator leads to induction of ABCA1, ApoE
and Apo-AI in brain with a concomitant decrease of Aβ42 in hippocampus and
modulation of several signaling pathways involved in neurotransmission and
synaptic plasticity, without a significant accumulation of either plasma or liver
triglycerides.
91
3.5 References Annicotte JS, Schoonjans K, and Auwerx J (2004). Expression of the liver X receptor alpha and beta in embryonic and adult mice. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 277: 312–316. Bell RD, Sagare AP, Friedman AE, Bedi GS, Holtzman DM, Deane R, Zlokovic BV (2007). Transport pathways for clearance of human Alzheimer's amyloid beta-peptide and apolipoproteins E and J in the mouse central nervous system. J Cereb Blood Flow Metab;27:909–918. Blundell J, Hoang CV, Potts B, Gold SJ, Powell CM (2008). Motor coordination deficits in mice lacking RGS9. Brain Research 1190: 78–85. Bradley MN, Hong C, Chen M, Joseph SB, Wilpitz DC, Wang X, Lusis AJ, Collins A, Hseuh WA, Collins JL, Tangirala RK, Tontonoz P (2007). Ligand activation of LXR beta reverses atherosclerosis and cellular cholesterol overload in mice lacking LXR alpha and apoE. J Clin Invest. 117(8):2337-46. Burns MP, Vardanian L, Pajoohesh-Ganji A, Wang L, Cooper M, Harris DC, Duff K, Rebeck GW (2006) The effects of ABCA1 on cholesterol efflux and Abeta levels in vitro and in vivo. J Neurochem. 98(3):792-800. Calkin AC, Tontonoz P (2010). Liver x receptor signaling pathways and atherosclerosis. Arterioscler Thromb Vasc Biol. 30(8):1513-8. Chambenoit O, Hamon Y, Marguet D, Rigneault H, Rosseneu M, Chimini G (2001). Specific docking of apolipoprotein A-I at the cell surface requires a functional ABCA1 transporter. J Biol Chem. 276: 9955–60. Dai YB, Tan XJ, Wu WF, Warner M, Gustafsson JA (2012). Liver X receptor beta protects dopaminergic neurons in a mouse model of Parkinson disease. Proc. Natl. Acad. Sci. U.S.A. 109:13112-13117 Elliott DA, Weickert CS, Garner B (2010) Apolipoproteins in the brain: implications for neurological and psychiatric disorders Clin Lipidol.1;51(4): 555-573. Fagan AM, Holtzman DM, Munson G, Mathur T, Schneider D, Chang LK, Getz GS, Reardon CA, Lukens J, Shah JA, LaDu MJ (1999) Unique lipoproteins secreted by primary astrocytes from wild type, apoE (−/−), and human apoE transgenic mice. J Biol Chem 274:30001–30007. Fitz NF, Cronican A, Pham T, Fogg A, Fauq AH, Chapman R, Lefterov I, Koldamova R (2010) Liver X receptor agonist treatment ameliorates amyloid pathology and memory deficits caused by high-fat diet in APP23 mice. J Neurosci 30:6862-6872.
92
Flor PJ, Lindauer K, Puttner I, Ruegg D, Lukic S, Knopfel T, Kuhn R (1995). Molecular cloning, functional expression and pharmacological characterization of the human metabotropic glutamate receptor type 2. Eur J Neurosci 7 (4): 622–9. Fukuda M, Moreira JE, Liu V, Sugimori M, Mikoshiba K, Llinas RR (2000). Role of the conserved WHXL motif in the C terminus of synaptotagmin in synaptic vesicle docking. Proc Natl Acad Sci USA 97 (26): 14715–14719 Hansson CA, Frykman S, Farmery MR, Tjernberg LO, Nilsberth C, Pursglove SE, Ito A, Winblad B, Cowburn RF, Thyberg J, Ankarcrona M (2004). Nicastrin, presenilin, APH-1, and PEN-2 form active gamma-secretase complexes in mitochondria. J. Biol. Chem. 279 (49): 51654–60. Hirsch-Reinshagen V, Maia LF, Burgess BL, Blain JF, Naus KE, McIsaac SA, Parkinson PF, Chan JY, Tansley GH, Hayden MR, et al. (2005). The absence of ABCA1 decreases soluble ApoE levels but does not diminish amyloid deposition in two murine models of Alzheimer disease. J Biol Chem 280:43243–43256. Janowski BA, Grogan MJ, Jones SA, Wisely GB, Kliewer SA, Corey EJ, and Man- gelsdorf DJ (1999) Structural requirements of ligands for the oxysterol liver X receptors LXRa and LXRb. Proc Natl Acad Sci USA 96:266–271. Jiang Q, Lee CY, Mandrekar S, Wilkinson B, Cramer P, Zelcer N, Mann K, Lamb B, Willson TM, Collins JL, Richardson JC, Smith JD, Comery TA, Riddell D, Holtzman DM, Tontonoz P, Landreth GE (2008) ApoE promotes the proteolytic degradation of Abeta. Neuron 58:681-693. Jiang XC, Beyer TP, Li Z, Liu J, Quan W, Schmidt RJ, Zhang Y, Bensch WR, Eacho PI, Cao G (2003). Enlargement of high density lipoprotein in mice via liver X receptor activation requires apolipoprotein E and is abolished by cholesteryl ester transfer protein expression. J Biol Chem 278:49072–49078. Joseph SB, Bradley MN, Castrillo A, Bruhn KW, Mak PA, Pei L, Hogenesch J, O'connell RM, Cheng G, Saez E, Miller JF, Tontonoz P (2004). LXR-dependent gene expression is important for macrophage survival and the innate immune response. Cell 119(2):299-309. Joseph SB, McKilligin E, Pei L, Watson MA, Collins AR, Laffitte BA, Chen M, Noh G, Goodman J, Hagger GN, Tran J, Tippin TK, Wang X, Lusis AJ, Hsueh WA, Law RE, Collins JL, Willson TM, Tontonoz P (2002). Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc. Natl. Acad. Sci. U.S.A. 99 (11): 7604–9. Laffitte BA, Joseph SB, Chen M, Castrillo A, Repa J, Wilpitz D, Mangelsdorf D, Tontonoz P (2003) The phospholipid transfer protein gene is a liver X receptor target expressed by macrophages in atherosclerotic lesions. Mol Cell Biol. 23(6):2182-91.
93
Lammich S, Kojro E, Postina R, Gilbert S, Pfeiffer R, Jasionowski M, Haass C, Fahrenholz F (1999). Constitutive and regulated alpha-secretase cleavage of Alzheimer's amyloid precursor protein by a disintegrin metalloprotease. Proc Natl Acad Sci USA 96(7):3922-7. Langmead B, Salzberg SL. (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods. 9(4):357-9. Lefterov I, Bookout A, Wang Z, Staufenbiel M, Mangelsdorf D, Koldamova R. (2007) Expression profiling in APP23 mouse brain: inhibition of Abeta amyloidosis and inflammation in response to LXR agonist treatment. Mol Neurodegener. 22;2:20. Li Y, Bolten C, Bhat BG, Woodring-Dietz J, Li S, Prayaga SK, Xia C, and Lala DS (2002) Induction of human liver X receptor α gene expression via an autoregulatory loop mechanism. Mol Endocrinol 16:506–514. Mak PA, Laffitte BA, Desrumaux C, Joseph SB, Curtiss LK, Mangelsdorf DJ, Tontonoz P, and Edwards PA (2002) Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. A critical role for nuclear liver X receptors a and b. J Biol Chem 277:31900–31908. Melchor JP, Pawlak R, Strickland S. (2003) The tissue plasminogen activator-plasminogen proteolytic cascade accelerates amyloid-beta (Abeta) degradation and inhibits Abeta-induced neurodegeneration. J Neurosci. 23(26):8867-71. Morikawa M, Fryer JD, Sullivan PM, Christopher EA, Wahrle SE, DeMattos RB, O'Dell MA, Fagan AM, Lashuel HA, Walz T, et al. (2005) Production and characterization of astrocyte-derived human apolipoprotein E isoforms from immortalized astrocytes and their interactions with amyloid-beta. Neurobiol Dis 2005;19:66–76 Noto PB, Bukhtiyarov Y, Shi M, McKeever BM, McGeehan GM, Lala DS (2012) Regulation of sphingomyelin phosphodiesterase acid-like 3A gene (SMPDL3A) by liver X receptors. Mol Pharmacol. 82(4):719-27. Pang ZP, Melicoff E, Padgett D, Liu Y, Teich AF, Dickey BF, et al. (2006). Synaptotagmin-2 is essential for survival and contributes to Ca2+ triggering of neurotransmitter release in central and neuromuscular synapses. The Journal of Neuroscience 26 (52): 13493–13504. Papadopoulos SM, Chandler WF, Salamat MS, Topol EJ, Sackellares JC (1987). Recombinant human tissue-type plasminogen activator therapy in acute thromboembolic stroke. J Neurosurg. 67(3):394-8. Paula-Lima AC, Tricerri MA, Brito-Moreira J, Bomfim TR, Oliveira FF, Magdesian MH, Grinberg LT, Panizzutti R, Ferreira ST (2009) Human apolipoprotein A-I binds amyloid-beta and prevents Abeta-induced neurotoxicity. Int J Biochem Cell Biol. 41(6):1361-70
94
Pussinen, P J; Jauhiainen M, Metso J, Pyle L E, Marcel Y L, Fidge N H, Ehnholm C (Jan. 1998). Binding of phospholipid transfer protein (PLTP) to apolipoproteins A-I and A-II: location of a PLTP binding domain in the amino terminal region of apoA-I. J. Lipid Res. 39 (1): 152–61. Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shimomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ (2000). "Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta". Genes Dev. 14 (22): 2819–30. Riddell DR, Zhou H, Comery TA, Kouranova E, Lo CF, Warwick HK, Ring RH, Kirksey Y, Aschmies S, Xu J, Kubek K et al. (2007) The LXR agonist TO901317 selectively lowers hippocampal Abeta42 and improves memory in the Tg2576 mouse model of Alzheimer's disease. Mol Cell Neurosci. 34(4):621-8. Roberts A. et al. (2011) Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics. 27(17):2325-9. Su AI, Wiltshire T, Batalov S, et al (2004). A gene atlas of the mouse and human protein-encoding transcriptomes. Proc. Natl. Acad. Sci. U.S.A. 101 (16): 6062–7. Suon S, Zhao J, Villarreal SA, Anumula N, Liu M, Carangia LM, Renger JJ, and Zerbinatti CV (2010) Systemic treatment with liver X receptor agonists raises apolipoprotein E, cholesterol, and amyloid-β peptides in the cerebral spinal fluid of rats. Mol Neurodegener 5:44. Tokuda T, Calero M, Matsubara E, Vidal R, Kumar A, Permanne B, Zlokovic B, Smith JD, Ladu MJ, Rostagno A, et al. (2000) Lipidation of apolipoprotein E influences its isoform-specific interaction with Alzheimer's amyloid beta peptides. Biochem J 348(Pt 2):359–365. Trapnell C. et al. (2009) TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 25(9):1105-11. Vassar R, Bennett BD, Babu-Khan S, Kahn S, Mendiaz EA, Denis P, Teplow DB, Ross S, Amarante P, et al. (1999). Beta-secretase cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE. Science 286 (5440): 735–41. Wahrle SE, Jiang H, Parsadanian M, Legleiter J, Han X, Fryer JD, Kowalewski T, Holtzman DM. (2004) ABCA1 is required for normal central nervous system ApoE levels and for lipidation of astrocyte-secreted apoE. J Biol Chem 279:40987–40993. Xie C. et al. (2011) KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 39 (Web Server issue):W316-22.
95
Yan G. et al., (2006) Genome sequencing and comparison of two nonhuman primate animal models, the cynomolgus and Chinese rhesus macaques. Nat Biotechnol. 29(11):1019-23. Yu B, Becnel J, Zerfaoui M, Rohatgi R, Boulares AH, Nichols CD (2008). Serotonin 5-hydroxytryptamine(2A) receptor activation suppresses tumor necrosis factor α -induced inflammation with extraordinary potency. J. Pharmacol. Exp. Ther. 327 (2): 316–323 Zhang Y, Repa JJ, Gauthier K, Mangelsdorf DJ (2001) Regulation of Lipoprotein Lipase by the Oxysterol Receptors, LXRα and LXRβ. J Biol Chem. 16;276(46):43018-24.
3.6. Figure Legends Figure 1. Regulation of the ABCA1 and ApoE genes by LXRs in CCF-STTG1
astrocytoma cells. The relative expression of both genes analyzed was measured
by real-time PCR. A, Relative expression of human ABCA1 and ApoE in human
astrocytes treated with 1 µM of LXR full agonists (T090 and GW3965) or VTP-5
at 5, 50 and 500 nM for 48 hours. B, Western Blot analysis of ApoE protein
expression in supernatants and lysates from human astrocytes treated with either
DMSO (lane 1) or 1 µM T090 and GW3965 (lanes 2-3) and VTP-5 at 5, 50 and
500 nM (lanes 4-6). 100 μg of total cell lysates or 20 µl were resolved by SDS-
PAGE on a 4-12% Bis-Tris gel, transferred to nitrocellulose and stained as
described in methods. Data represent mean ± SD (n=4). *p < 0.05 and ***p<0.001
as determined by Student’s t-test. Results are representative of two separate
experiments.
Figure 2. Upregulation of LXR target genes in Cynomolgus monkey brain.
Relative mRNA expression of ABCA1 (A) and Western Blot analysis (B) of
ABCA1 and ApoE protein expression in cortical cerebra of monkeys treated with
96
either Vehicle (Veh.) or VTP-5 at doses of 0.1, 0.3 and 1 mpk once daily for 14
days. 60 μg of cleared brain tissue lysates were resolved by SDS-PAGE on 10%
and 4-12% Bis-Tris gels for ABCA1 and ApoE protein analysis, respectively.
After transfer to nitrocellulose, blots were stained as described in methods. Data
represent mean ± SE (n=4). **p<0.01 as determined by Student’s t-test.
Figure 3. Detection of soluble Aβ1-42 in Primate Hippocampus.
Immuno-detection of soluble Aβ1-42 in hippocampi tissue lysates from monkeys
treated either Vehicle or VTP-5 at doses of 0.1, 0.3 and 1 mpk once daily for 14
days.
Figure 4. Relative mRNA expression of LXRs in Cynomolgus monkey brain and
liver. A, Comparison of LXR isoforms in cerebral cortex and liver tissues from
vehicle-treated animals. Data was normalized to the relative levels of brain LXRα.
B, Relative levels of LXRs in brain and liver tissues upon treatment with VTP-5.
Data normalized to the relative levels of each LXR isoform in brain and liver
tissues from vehicle-treated animals. Data represent mean ± SE (n=4). **p<0.01,
***p<0.001 as determined by Student’s t-test.
Figure 5. Relative mRNA expression of Apo-AI (A) and PLAT (B) genes in
Cynomolgus monkey brain upon treatment with treated either Vehicle or VTP-5 at
doses of 0.1, 0.3 and 1 mpk once daily for 14 days. Data represent mean ± SE
(n=4).
97
Figure 6. Western blot analysis of Apo-AI protein expression in in cortical
cerebra of monkeys treated with either Vehicle (Veh.) or VTP-5 at doses of 0.1,
0.3 and 1 mpk once daily for 14 days. 60 μg of cleared brain tissue lysates were
resolved by SDS-PAGE on a 4-12% Bis-Tris gel, blotted to nitrocellulose and
stained as described in methods.
3.7 Table Legends
Table 1. Differential gene expression analysis of LXR target genes by RNA-
sequencing of Cynomolgus monkey brain. RNA from all 4 animals of both
vehicle- and VTP-5 (0.3 mpk)-treated groups was pooled and subjected to RNA
sequencing as described in methods.
Table 2. Differential gene expression analysis of genes involved in Aβ
metabolism by RNA-sequencing of Cynomolgus monkey brain. RNA from all 4
animals of both vehicle- and VTP-5 (0.3 mpk)-treated groups was pooled and
subjected to RNA sequencing as described in methods.
Table 3. KEGG pathway enrichment analysis from RNA sequencing results.
Fold change indicates the differential gene expression ratio between vehicle and
VTP-5-treated animals. Only statistically significant gene pathways are shown
(corrected p value<0.05).
3.8 Acknowledgements
Linghang Zhuang* is kindly acknowledged for the synthesis of VTP-5.
We also thank Joan* and Rong Guo* for the bioanalytical measurement of VTP-5
in animal tissues. Andy Hardy* and Shi Meng* are also acknowledged for
performing gene expression analysis and measurement of triglyceride levels in
blood and liver tissues. *Vitae Pharmaceuticals, Inc. Fort Washington, PA.
98
Table 1: VTP-5 treatment leads to up-regulation of several known LXR-target genes and potential new ones
99
Table 2: VTP-5 promotes Aβ clearance without affecting key genes involved in Aβ synthesis/degradation
111
CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS Since the discovery of LXRs and their involvement in cholesterol and lipid
homeostasis, the mechanism of gene regulation has been extensively characterized
in rodent systems. Although the LXR signaling pathway is mostly conserved
across species, LXRs can also regulate their target genes in a species-, tissue- and
isoform-specific fashion. In the context of host defense and innate immunity, the
LXR genome landscape had only been investigated in murine macrophages.
Therefore, we analyzed genome-wide expression profiles of forty-four thousand
genes using microarray gene expression analysis in human THP-1 macrophages
with and without stimulation of inflammatory response with LPS. First, we
showed that although the anti-inflammatory properties of LXRs in THP-1
macrophages appear to be not as strong as those observed with steroidal GR
agonists (Auphan et al., 1995), the overall down-regulation of the expression of
several cytokines and chemokines reflects an LXR-mediated transrepression of
pro-inflammatory genes, thus tuning down the attraction of additional monocytes
to atherosclerotic foam macrophages. These findings are in general agreement
with the effects observed in murine macrophages (Joseph et al., 2003). In the
same study, we also identified the SMPDL3A as a novel human LXR target gene.
Through EMSA and ChIP analysis experiments, we demonstrated the presence of
an LXRE within the promoter of the human SMDPL3A gene. Additionally, we
characterized the regulation of SMDPL3A by LXRs across several primary and
immortalized human cell lines. We showed that the SMPDL3A gene appears to be
controlled by LXRs in monocytes, THP-1 derived macrophages and primary cell
cultures from healthy donors but not in kidney, liver, skin fibroblasts and
neuroglioma cell lines. In addition, our data indicates that the induction of the
112
SMPDL3A gene by LXRs may be species-specific, since no increase in gene
expression could be observed in murine macrophage-like cells (RAW264.7) nor
any changes had been detected in three different tissues, including blood,
collected from the mice treated with T090.
Hence, we show that SMPDL3A might represent an additional example of
species- and tissue-specific LXR target gene (Noto et al., 2012). Although the
functions of SMPDL3A remain to be elucidated, further analysis of SMPDL3A
expression in primary cell cultures will be helpful in assessing the significance of
the tissue-specific regulation of this gene by LXRs. Characterization of
SMPDL3A enzymatic activity in both biochemical and cell based assays might be
very helpful, given the biological importance of acid sphingomyelinases in
activated macrophages (Truman et al., 2011).
As the role of LXRs in neurodegenerative disorders has never been investigated in
higher species, such as non-human primates, we wanted to confirm the LXR-
mediated upregulation of ABCA1 and ApoE genes in Cynomolgus monkey brains
upon treatment with an LXRβ-selective modulator. First, we showed that LXR
activation leads to induction of ABCA1 and ApoE genes in monkey cerebra.
Additionally, we were able to observe a mild reduction of Aβ42 levels in monkey
hippocampi, but not cerebra. This is indeed consistent with observations made in
lower species, such as a mouse model of AD (Riddell et al., 2007). Since the
effect on hippocampal Aβ42 was achieved at doses that did not cause
accumulation of either plasma or liver triglycerides, we measured the expression
of both LXR isoforms in brain and liver tissues in order to help understand
whether selective LXRβ activation indeed confers tissue-specific modulation of
LXR target genes.
113
Consistent with previous reports (Whitney et al., 2002), we showed that LXRβ is
more abundant than LXRα in monkey brain. Despite the comparable levels of
LXRβ in both brain and liver tissues, LXRα was found to be expressed at much
higher levels in liver. Interestingly, treatment with VTP-5 led to increased LXRα
expression in brain, but not liver. This may represent a biological advantage for
the development of LXRβ selective modulators, which would allow better
separation of beneficial effects, such as enhanced RCT and reduction of Aβ
burden in brain, from the undesired triglyceride elevation in liver. In addition, we
also characterized the LXR transcriptome in Cynomolgus brain by RNA-
sequencing in order to identify potential novel LXR target genes. We were able to
confirm the induction of several known LXR target genes in brain, including
PLTP, which, interestingly, was previously shown to be upregulated by LXRs
exclusively in macrophages and liver (Zhang et al., 2001; Laffitte et al., 2003).
For the first time in higher species, we also showed upregulation of Apo-AI in the
brain of Cynomolgus monkey upon treatment with a synthetic LXR modulator.
Despite the primary role of ApoE in brain cholesterol homeostasis (Elliott et al.,
2010) and amyloid metabolism (Jiang et al., 2008), with respect to other
apolipoproteins, increased Apo-AI levels may enhance the reduction of
cholesterol overload at the cerebrovascular level and possibly contribute to Aβ
clearance (Burns et al., 2006; Paula-Lima et al., 2009). Additionally, we identified
PLAT as a possible novel LXR target gene in monkey cerebra, as shown by the
mild induction upon treatment with the LXR ligand. Upregulation of PLAT not
only might improve cerebrovascular conditions by promoting fibrinolysis and
breakdown of clots, but also contribute to Aβ clearance and inhibit amyloid-
induced neurotoxicity, as shown in mouse models of AD (Melchor et al., 2003).
114
Although upregulation of PLAT gene expression was verified only by RT-PCR,
we currently have not identified antibodies suitable for the detection of PLAT
protein in primates.
Finally, KEGG pathway analysis revealed a very intriguing modulation of
neurochemical processes by LXR activation. Our LXR modulator positively
affected the expression of several genes that belong to signaling pathways
involved in neurotransmission and synaptic plasticity. Although we are currently
following up with several of these genes, our findings seem to support the general
notion that LXRs may hold a potential beneficial role in cognitive functions.
Eventually, the therapeutic value of LXR modulation in neurological disorders
will require conducting behavioral studies in aged non-human primates, which
would be more predictive of the human neuropathophysiology.
115
LIST OF REFERENCES A.I. Shulman, C. Larson, D.J. Mangelsdorf, and R. Ranganathan (2004) Structural Determinants of Allosteric Ligand Activation in RXR Heterodimers. Cell, Vol. 116, 417–429 Akira S, Takeda K, Kaisho T (2001) Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol. 2:675–680. Altmann SW, Davis HR Jr, Zhu LJ, Yao X, Hoos LM, Tetzloff G, Iyer SP, Maguire M, Golovko A, Zeng M et al. (2004) Niemann-Pick C1-like 1 protein is critical for intestinal cholesterol absorption. Science 303 1201–1204. Apfel R, Benbrook D, Lernhardt E, Ortiz MA, Salbert G, Pfahl M (1994). A novel orphan receptor specific for a subset of thyroid hormone-responsive elements and its interaction with the retinoid/thyroid hormone receptor subfamily. Mol. Cell. Biol. 14 (10): 7025–35. Asquith DL, Miller AM, Hueber AJ, McKinnon HJ, Sattar N, Graham GJ, McInnes IB (2009) Liver X receptor agonism promotes articular inflammation in murine collagen-induced arthritis. Arthritis Rheum. 60(9):2655-65. Auphan N, DiDonato JA, Rosette C, Helmberg A, Karin M (1995) Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of I kappa B synthesis. Science 270 (5234): 286-90. Barter PJ, Brewer HB Jr, Chapman MJ, Hennekens CH, Rader DJ, Tall AR (2003). Cholesteryl ester transfer protein: a novel target for raising HDL and inhibiting atherosclerosis. Arterioscler Thromb Vasc Biol 23 (2): 160–7 Bell RD, Sagare AP, Friedman AE, Bedi GS, Holtzman DM, Deane R, Zlokovic BV (2007). Transport pathwaysfor clearance of human Alzheimer's amyloid beta-peptide and apolipoproteins E and J in the mouse central nervous system. J Cereb Blood Flow Metab 27:909–918. Bischoff ED, Daige CL, Petrowski M, Dedman H, Pattison J, Juliano J, Li AC, Schulman IG (2010) Non-redundant roles for LXRalpha and LXRbeta in atherosclerosis susceptibility in low density lipoprotein receptor knockout mice. J Lipid Res. 51(5):900-6 Blaschke F, Takata Y, Caglayan E, Collins A, Tontonoz P, Hsueh WA, Tangirala RK (2006) A nuclear receptor corepressor-dependent pathway mediates suppression of cytokine-induced C-reactive protein gene expression by liver X receptor. Circ Res. 99(12):e88-99.
116
Boyles JK, Zoellner CD, Anderson LJ, Kosik LM, Pitas RE, Weisgraber KH, Hui DY, Mahley RW, Gebicke-Haerter PJ, Ignatius MJ, et al. (1989) A role for apolipoprotein E, apolipoprotein A-I, and low density lipoprotein receptors in cholesterol transport during regeneration and remyelination of the rat sciatic nerve. J Clin Invest. 83(3):1015-31. Bradley MN, Hong C, Chen M, Joseph SB, Wilpitz DC, Wang X, Lusis AJ, Collins A, et al. (2007) Ligand activation of LXR beta reverses atherosclerosis and cellular cholesterol overload in mice lacking LXR alpha and apoE. J Clin Invest. 117(8):2337-46. Chambenoit O, Hamon Y, Marguet D, Rigneault H, Rosseneu M, Chimini G (2001). Specific docking of apolipoprotein A-I at the cell surface requires a functional ABCA1 transporter. J Biol Chem. 276: 9955–60. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457 Dai YB, Tan XJ, Wu WF, Warner M, Gustafsson JA (2012). Liver X receptor beta protects dopaminergic neurons in a mouse model of Parkinson disease. Proc. Natl. Acad. Sci. U.S.A. 109:13112-13117 Delvecchio CJ, Bilan P, Radford K, Stephen J, Trigatti BL, Cox G, Parameswaran K, Capone JP (2007) Liver X receptor stimulates cholesterol efflux and inhibits expression of proinflammatory mediators in human airway smooth muscle cells. Mol Endocrinol. 21(6):1324-34. DeMattos RB, Cirrito JR, Parsadanian M, May PC, O'Dell MA, Taylor JW, Harmony JA, Aronow BJ, Bales KR, Paul SM, Holtzman DM (2004) ApoE and clusterin cooperatively suppress Abeta levels and deposition: evidence that ApoE regulates extracellular Abeta metabolism in vivo. Neuron 41:193–202. Duval C, Touche V, Tailleux A, Fruchart JC, Fievet C, Clavey V, Staels B & Lestavel S (2006) Niemann-Pick C1 like 1 gene expression is down-regulated by LXR activators in the intestine. Biochemical and Biophysical Research Communications 340 1259–1263. Elshourbagy NA, Liao WS, Mahley RW, Taylor JM (1985) Apolipoprotein E mRNA is abundant in the brain and adrenals, as well as in the liver, and is present in other peripheral tissues of rats and marmosets. Proc Natl Acad Sci USA. 82(1):203-7. Endo A (1992) The discovery and development of HMG-CoA reductase inhibitors. J Lipid Res. (11):1569-82. Fan X, Kim HJ, Bouton D, Warner M & Gustafsson JA (2008) Expression of liver X receptor beta is essential for formation of superficial cortical layers and migration of later-born neurons. PNAS 105 13445–13450.
117
Fontaine C, Rigamonti E, Nohara A, Gervois P, Teissier E, Fruchart JC, Staels B, and Chinetti-Gbaguidi G (2007) Liver X receptor activation potentiates the lipo- polysaccharide response in human macrophages. Circ Res 101:40–49. Fowler AJ, Sheu MY, Schmuth M, Kao J, Fluhr JW, Rhein L, Collins JL, Willson TM, Mangelsdorf DJ, Elias PM, Feingold KR (2003). Liver X receptor activators display anti-inflammatory activity in irritant and allergic contact dermatitis models: liver-X-receptor-specific inhibition of inflammation and primary cytokine production. J Invest Dermatol. 120(2):246-55. Gelissen IC, Harris M, Rye KA, Quinn C, Brown AJ, Kockx M, Cartland S, Packianathan M, Kritharides L & Jessup W (2006) ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I. Arteriosclerosis, Thrombosis, and Vascular Biology 26 534–540. Ghisletti S, Huang W, Ogawa S, Pascual G, Lin ME, Wilsson TM, Rosenfeld MG and Glass CK (2007) Parallel SUMOylation-dependent pathways mediate gene- and signal-specific transrepression by LXRs and PPARγ. Mol. Cell 25, 57–70. Glass CK, and Witztum JL (2001) Atherosclerosis: the road ahead. Cell 104, 503–516. Groot, P. H., N. J. Pearce, J. W. Yates, C. Stocker, C. Sauermelch, C. P. Doe, R. N. Willette, A. Olzinski, et al. (2005). Synthetic LXR agonists increase LDL in CETP species. J Lipid Res 46: 2182-2191. Hardy J, Allsop D (1991) Amyloid Deposition as the Central Event in the Aetiology of Alzheimer's Disease. Trends Pharmacol. Sci.12(10):383–88 Hassen Ratni & Matthew B Wright (2010) Recent progress in liver X receptor-selective modulators. Current Opinion in Drug Discovery & Development 13(4):403-413 Hatano Y, Man MQ, Uchida Y, Crumrine D, Mauro TM, Feingold KR, Elias PM, Holleran WM (2010). Murine atopic dermatitis responds to peroxisome proliferator-activated receptors alpha and beta/delta (but not gamma) and liver X receptor activators. J Allergy Clin Immunol. 125(1):160-9.e1-5 Hirsch-Reinshagen V, Maia LF, Burgess BL, Blain JF, Naus KE, McIsaac SA, Parkinson PF, Chan JY, Tansley GH, Hayden MR, et al. (2005). The absence of ABCA1 decreases soluble ApoE levels but does not diminish amyloid deposition in two murine models of Alzheimer disease. J Biol Chem 280:43243–43256. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG (1995) Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404 Hu X, Li S, Wu J, Xia C, Lala DS (2003) Liver X Receptors Interact with Corepressors to Regulate Gene Expression. Mol Endocrinol, 17(6):1019–1026
118
Ignatius MJ, Gebicke-Härter PJ, Skene JH, Schilling JW, Weisgraber KH, Mahley RW, Shooter EM (1986) Expression of apolipoprotein E during nerve degeneration and regeneration. Proc Natl Acad Sci USA. 83(4):1125-9. Ishimoto K, Tachibana K, Sumitomo M, Omote S, Hanano I, Yamasaki D, Watanabe Y, Tanaka T, Hamakubo T, Sakai J, Kodama T, Doi T (2006) Identification of human low-density lipoprotein receptor as a novel target gene regulated by liver X receptor alpha. FEBS Letters 580 4929–4933. Janowski BA, Grogan MJ, Jones SA, Wisely GB, Kliewer SA, Corey EJ & Mangelsdorf DJ (1999) Structural requirements of ligands for the oxysterol liver X receptors LXRalpha and LXRbeta. PNAS 96 266–271. Jiang Q, Lee CY, Mandrekar S, Wilkinson B, Cramer P, Zelcer N, Mann K, Lamb B, Willson TM, Collins JL, Richardson JC, Smith JD, Comery TA, Riddell D, Holtzman DM, Tontonoz P, Landreth GE (2008) ApoE promotes the proteolytic degradation of Abeta. Neuron 58:681-693. Jiang XC, Beyer TP, Li Z, Liu J, Quan W, Schmidt RJ, Zhang Y, Bensch WR, Eacho PI, Cao G (2003). Enlargement of high density lipoprotein in mice via liver X receptor activation requires apolipoprotein E and is abolished by cholesteryl ester transfer protein expression. J Biol Chem 278:49072–49078. Jiang XC, Bruce C, Mar J, Lin M, Ji Y, Francone OL & Tall AR (1999) Targeted mutation of plasma phospholipid transfer protein gene markedly reduces high-density lipoprotein levels. Journal of Clinical Investigation 103 907–914. John G. Menke at al. (2002) A novel liver X receptor agonist establishes species differences in the regulation of cholesterol 7a-hydroxylase (CYP7a) Endocrinology vol. 143, No. 7 2548-2558 Joseph SB, Bradley MN, Castrillo A, Bruhn KW, Mak PA, Pei L, Hogenesch J, O'connell RM, Cheng G, Saez E, Miller JF, Tontonoz P (2004). LXR-dependent gene expression is important for macrophage survival and the innate immune response. Cell 119(2):299-309. Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, and Tontonoz P (2003) Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med 9:213–219. Joseph SB, Laffitte BA, Patel PH, Watson MA, Matsukuma KE, Walczak R, Collins JL, Osborne TF, Tontonoz P (2002) Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. J Biol Chem. 277(13):11019-25.
119
Juvet LK, Andresen SM, Schuster GU, Dalen KT, Tobin KA, Hollung K, Haugen F, Jacinto S, Ulven SM, Bamberg K, Gustafsson JA, Nebb HI (2003) On the role of liver X receptors in lipid accumulation in adipocytes. Mol Endocrinol. 17(2):172-82. Kennedy MA, Venkateswaran A, Tarr PT, Xenarios I, Kudoh J, Shimizu N, Edwards PA (2001) Characterization of the human ABCG1 gene: liver X receptor activates an internal promoter that produces a novel transcript encoding an alternative form of the protein. J Biol Chem. (42):39438-47 Kratzer A, Buchebner M, Pfeifer T, Becker TM, Uray G, Miyazaki M, Miyazaki-Anzai S, et al. (2009) Synthetic LXR agonist attenuates plaque formation in apoE-/- mice without inducing liver steatosis and hypertriglyceridemia. J. Lipid Res. 50 (2): 312–26. Kumar R, Thompson EB (1999) The structure of the nuclear hormone receptors. Steroids. 64(5): 310–9. Laffitte BA, Joseph SB, Chen M, Castrillo A, Repa J, Wilpitz D, Mangelsdorf D, Tontonoz P (2003) The phospholipid transfer protein gene is a liver X receptor target expressed by macrophages in atherosclerotic lesions. Mol Cell Biol. 23(6):2182-91. Lee JH, Zhou J & Xie W (2008) PXR and LXR in hepatic steatosis: a new dog and an old dog with new tricks. Molecular Pharmaceutics 5 60–66. Lee M, Metso J, Jauhiainen M & Kovanen PT (2003) Degradation of phospholipid transfer protein (PLTP) and PLTP-generated pre-beta-high density lipoprotein by mast cell chymase impairs high affinity efflux of cholesterol from macrophage foam cells. Journal of Biological Chemistry 278 13539–13545. Lee MH, Lu K & Patel SB (2001) Genetic basis of sitosterolemia. Current Opinion in Lipidology 12 141–149. Li W, Wu Y, Min F, Li Z, Huang J, Huang R (2010) A nonhuman primate model of Alzheimer's disease generated by intracranial injection of amyloid-β42 and thiorphan. Metab Brain Dis. 25(3):277-84. Li Y, Bolten C, Bhat BG, Woodring-Dietz J, Li S, Prayaga SK, Xia C, Lala DS (2002) Induction of human liver X receptor alpha gene expression via an autoregulatory loop mechanism. Mol Endocrinol.16(3):506-14. Liang G, Yang J, Horton JD, Hammer RE, Goldstein JL, Brown MS (2002) Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c. J Biol Chem. 277(11):9520-8.
120
Lo Sasso G, Murzilli S, Salvatore L, D'Errico I, Petruzzelli M, Conca P, Jiang ZY, Calabresi L, Parini P, Moschetta A (2010) Intestinal specific LXR activation stimulates reverse cholesterol transport and protects from atherosclerosis. Cell Metab. 12(2):187-93. Mak PA, Laffitte BA, Desrumaux C, Joseph SB, Curtiss LK, Mangelsdorf DJ, Tontonoz P, and Edwards PA (2002) Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. A critical role for nuclear liver X receptors α and β. J Biol Chem 277:31900–31908. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM (1995) The nuclear receptor superfamily: the second decade. Cell. 83(6): 835–9 Masters CL, Simms G, Weinman NA, Multhaup G, McDonald BL, Beyreuther K (1985) Amyloid plaque core protein in Alzheimer disease and Down syndrome. Proc Natl Acad Sci USA.82(12):4245-9. Melchor JP, Pawlak R, Strickland S. (2003) The tissue plasminogen activator-plasminogen proteolytic cascade accelerates amyloid-beta (Abeta) degradation and inhibits Abeta-induced neurodegeneration. J Neurosci. 23(26):8867-71. Morales JR, Ballesteros I, Deniz JM, Hurtado O, Vivancos J, Nombela F, Lizasoain I, Castrillo A, Moro MA (2008) Activation of liver X receptors promotes neuroprotection and reduces brain inflammation in experimental stroke. Circulation. 118(14):1450-9. Morikawa M, Fryer JD, Sullivan PM, Christopher EA, Wahrle SE, DeMattos RB, O'Dell MA, Fagan AM, Lashuel HA, Walz T, et al. (2005) Production and characterization of astrocyte-derived human apolipoprotein E isoforms from immortalized astrocytes and their interactions with amyloid-beta. Neurobiol Dis 19:66–76 Noto PB, Bukhtiyarov Y, Shi M, McKeever BM, McGeehan GM, Lala DS (2012) Regulation of sphingomyelin phosphodiesterase acid-like 3A gene (SMPDL3A) by liver X receptors. Mol Pharmacol. 82(4):719-27. Novak N, Heinzel T (2004) Nuclear receptors: overview and classification. Curr Drug Targets Inflamm Allergy 3(4):335–46. Park MC, Kwon YJ, Chung SJ, Park YB, Lee SK (2010) Liver X receptor agonist prevents the evolution of collagen-induced arthritis in mice. Rheumatology (Oxford). 49(5):882-90. Peng D, Hiipakka RA, Dai Q, Guo J, Reardon CA, Getz GS, Liao S (2008). Antiatherosclerotic effects of a novel synthetic tissue-selective steroidal liver X receptor agonist in low-density lipoprotein receptor-deficient mice. J Pharmacol Exp Ther 327(2):332-342.
121
Quinet EM, Basso MD, Halpern AR, Yates DW, Steffan RJ, Clerin V, Resmini C, Keith JC, Berrodin TJ, Feingold I, et al. (2009) LXR Ligand Lowers LDL Cholesterol in Primates, is Lipid Neutral in Hamster, and Reduces Atherosclerosis in Mouse. J Lipid Res. 50(12):2358-70. Quinet EM, Savio DA, Halpern AR, Chen L, Miller CP, Nambi P (2004) Gene-selective modulation by a synthetic oxysterol ligand of the liver X receptor. J Lipid Res. 45(10):1929-42. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ (2002) Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J Biol Chem. 277(21):18793-800. Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shimomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ (2000) Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta. Genes Dev. 14 (22): 2819–30. Riddell DR, Zhou H, Comery TA, Kouranova E, Lo CF, Warwick HK, Ring RH, Kirksey Y, Aschmies S, Xu J, Kubek K et al. (2007) The LXR agonist TO901317 selectively lowers hippocampal Abeta42 and improves memory in the Tg2576 mouse model of Alzheimer's disease. Mol Cell Neurosci. 34(4):621-8. Roger T, Miconnet I, Schiesser AL, Kai H, Miyake K, Calandra T (2005) Critical role for Ets, AP-1 and GATA-like transcription factors in regulating mouse Toll-like receptor 4 (Tlr4) gene expression. Biochem J. 387:355–365. Roher AE, Lowenson JD, Clarke S, Woods AS, Cotter RJ, Gowing E, Ball MJ (1993) beta-Amyloid-(1-42) is a major component of cerebrovascular amyloid deposits: implications for the pathology of Alzheimer disease. Proc Natl Acad Sci USA. 90(22):10836-40. Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, Schwendner S, Wang S, Thoolen M, Mangelsdorf DJ, Lustig KD, Shan B (2000) Role of LXRs in control of lipogenesis. Genes Dev. 14(22):2831-8. Selkoe DJ (1993) Physiological production of the beta-amyloid protein and the mechanism of Alzheimer's disease. Trends Neurosci. 16(10):403-9. Shoji M, Golde TE, Ghiso J, Cheung TT, Estus S, Shaffer LM, Cai XD, McKay DM, Tintner R, Frangione B, et al. (1992) Production of the Alzheimer amyloid beta protein by normal proteolytic processing. Science. 2;258(5079):126-9. Sironi L, Mitro N, Cimino M, Gelosa P, Guerrini U, Tremoli E, Saez E (2008) Treatment with LXR agonists after focal cerebral ischemia prevents brain damage. FEBS Lett. 582(23-24):3396-400. Song C, Kokontis JM, Hiipakka RA, Liao S (1994). Ubiquitous receptor: a receptor that modulates gene activation by retinoic acid and thyroid hormone receptors. Proc. Natl. Acad. Sci. USA. 91 (23): 10809–13.
122
Strittmatter WJ, Saunders AM, Schmechel D, Pericak-Vance M, Enghild J, Salvesen GS, Roses AD (1993) Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc Natl Acad Sci USA. 90(5):1977-81. Strittmatter WJ, Weisgraber KH, Huang DY, Dong LM, Salvesen GS, Pericak-Vance M, Schmechel D, Saunders AM, Goldgaber D, Roses AD (1993b) Binding of human apolipoprotein E to synthetic amyloid beta peptide: isoform-specific effects and implications for late-onset Alzheimer disease. Proc Natl Acad Sci USA. 90(17):8098-102. Su AI, Wiltshire T, Batalov S, et al (2004) A gene atlas of the mouse and human protein-encoding transcriptomes. Proc. Natl. Acad. Sci. USA. 101 (16): 6062–7. Sun Y, Hao M, Luo Y, Liang CP, Silver DL, Cheng C, Maxfield FR, Tall AR (2003) Stearoyl-CoA desaturase inhibits ATP-binding cassette transporter A1-mediated cholesterol efflux and modulates membrane domain structure. J Biol Chem. 278(8):5813-20. Suon S, Zhao J, Villarreal SA, Anumula N, Liu M, Carangia LM, Renger JJ, and Zerbinatti CV (2010) Systemic treatment with liver X receptor agonists raises apolipoprotein E, cholesterol, and amyloid-β peptides in the cerebral spinal fluid of rats. Mol Neurodegener 5:44. Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T, Takeda K, Akira S (1999) Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity. 11:443–451. Terpstra, V., van Amersfoort, E.S., van Velzen, A.G., Kuiper, J., and van Berkel, TJ (2000). Hepatic and extrahepatic scavenger receptors: function in relation to disease. Arterioscler. Thromb. Vasc. Biol. 20, 1860–1872. Tokuda T, Calero M, Matsubara E, Vidal R, Kumar A, Permanne B, Zlokovic B, Smith JD, Ladu MJ, Rostagno A, et al. (2000) Lipidation of apolipoprotein E influences its isoform-specific interaction with Alzheimer's amyloid beta peptides. Biochem J 348(Pt 2):359–365. van Haperen R, van Tol A, Vermeulen P, Jauhiainen M, van Gent T, van den Berg P, Ehnholm S, Grosveld F, van der Kamp A, de Crom R (2000) Human plasma phospholipid transfer protein increases the antiatherogenic potential of high density lipoproteins in transgenic mice. Arteriosclerosis, Thrombosis, and Vascular Biology 20 1082–1088. Venkateswaran A, Laffitte BA, Joseph SB, Mak PA, Wilpitz DC, Edwards PA, Tontonoz P (2000) Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc Natl Acad Sci USA 97(22):12097-102.
123
Wagner BL, Valledor AF, Shao G, Daige CL, Bischoff ED, Petrowski M, Jepsen K, Baek SH, Heyman RA, Rosenfeld MG, Schulman IG, Glass CK (2003) Promoter-specific roles for liver X receptor/corepressor complexes in the regulation of ABCA1 and SREBP1 gene expression. Mol Cell Biol. 23(16):5780-9. Wahrle SE, Jiang H, Parsadanian M, Legleiter J, Han X, Fryer JD, Kowalewski T, Holtzman DM (2004) ABCA1 is required for normal central nervous system ApoE levels and for lipidation of astrocyte-secreted apoE. J Biol Chem 279:40987–40993. Whitney KD, Watson MA, Collins JL, Benson WG, Stone TM, Numerick MJ, Tippin TK, Wilson JG, Winegar DA, Kliewer SA (2002) Regulation of cholesterol homeostasis by the liver x receptors in the central nervous system. Mol Endocrinol 2002, 16:1378-1385. Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA, and Mangelsdorf DJ (1995) LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes Dev 9:1033–1045.
Yi Luo and Alan R. Tall (2000) Sterol upregulation of human CETP expression in vitro and in transgenic mice by an LXR element. J Clin Invest 105(4): 513–520. Yu L, Hammer RE, Li-Hawkins J, Von Bergmann K, Lutjohann D, Cohen JC & Hobbs HH (2002) Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. PNAS 99 16237–16242. Zhang Y, Repa JJ, Gauthier K, Mangelsdorf DJ (2001) Regulation of lipoprotein lipase by the oxysterol receptors, LXRalpha and LXRbeta. J Biol Chem. 276(46):43018-24. Zelcer N, Hong C, Boyadjian R & Tontonoz P (2009) LXR regulates cholesterol uptake through idol-dependent ubiquitination of the LDL receptor. Science 325 100–104. Zelcer N, Khanlou N, Clare R, Jiang Q, Reed-Geaghan EG, Landreth GE, Vinters HV, Tontonoz P (2007) Attenuation of neuroinflammation and Alzheimer's disease pathology by liver x receptors. Proc Natl Acad Sci USA. 104(25):10601-6. Zhong S, Sharp DS, Grove JS, Bruce C, Yano K, Curb JD, Tall AR (1996) Increased coronary heart disease in Japanese-American men with mutation in the cholesteryl ester transfer protein gene despite increased HDL levels. J Clin Invest 97 (12): 2917–23.
124
APPENDIX A Supplemental data from chapter 2 Supplemental Figure 1
Supplemental Figure 1. Western Blot analysis of SMPDL3A protein HEK293 cells were transiently transfected with either a control empty vector (lane
1) or a plasmid encoding the full-length human SMPDL3A fused to Myc-DDK
tag at the C-terminus (lane 2). 100 μg of total cell lysates were resolved by SDS-
PAGE, blotted to nitrocellulose, and stained with 1.7 μg/ml anti-SMPDL3A
followed by DAM-HRP (1:2,000)
β-Actin
51
1 2
125
Supplemental Figure 2
Supplemental Figure 2. Knockdown of LXRs in THP-1-derived macrophages Cells were treated with either 30 nM scrambled siRNA or LXR-specific siRNA
(using RNAiMAX Lipofectamine) for 24 hours. After transfection, cells were
treated with either DMSO or 1 µM T090 for 4, 8 and 24 hours. RNA was isolated
and subjected to RT-PCR for both LXR genes.
126
Supplemental Figure 3
Supplemental Figure 3. Treatment of THP-1 macrophages with a PPARγ
agonist
Cells were treated with various concentrations of Rosiglitazone for 24 hours.
T090 was used as a positive control for SMDPL3A gene induction.
127
Supplemental Figure 4
Supplemental Figure 4. Induction of LXR-regulated genes in human cell lines
Cells were treated with 1 µM T090 for 24 hours. RNA was isolated and subjected
to RT-PCR for ABCA1 and SREBP1c genes.
128
VITA
Paul Bart Noto
EDUCATION Ph.D. Biological Sciences Drexel University, Philadelphia, PA. February 2009 – May 2013 (anticipated completion) MS Pharmacology Thomas Jefferson University, Philadelphia, PA. September 2005 – April 2007. BS/MS Biological Sciences/Molecular Biology (summa cum laudae) University of Palermo, Palermo, Italy. October 2000 – July 2004.
129
RESEARCH EXPERIENCE Doctoral Research (2009-2013)
Dissertation Title: “Analysis of Liver X Receptor target gene expression across
species”
Senior Research Associate (2008-present)
Discovery Biology, Vitae Pharmaceuticals, Inc. Fort Washington, PA.
Projects and responsibilities: Biochemical and cell-based assay development for
pharmacological characterization of small molecule agents for the treatment of
hypertension (Renin and Mineralocorticoid Receptor), Alzheimer’s disease
(BACE1 and LXRs) and inflammatory disorders (RORγt, SYK, JAK3 and LXRs).
Research Associate (2007).
Screening Sciences Department, Wyeth Research, Collegeville, PA.
Projects and responsabilities: Cell- based assay development for high throughput
screening of therapeutic compounds.
Research Assistant (2005 to 2007). S.H.R.O. for Cancer Research and Molecular Medicine, College of Science and Technology, Temple University. Thesis Title: “Expression of Rb proteins in Small and Non-Small Lung Cancer cells” Clerkship title: “Alternative stabilities of a proline-rich antibacterial peptide in vitro and in vivo” Research Trainee (2003-2004) Department of Developmental and Cell Biology, University of Palermo, Italy. Thesis Title: "Physical Mapping of Re-arranged DNA in Human Colorectal Cancer"
130
PUBBLICATIONS Noto PB, Bukhtiyarov Y, Shi M, McKeever BM, McGeehan GM, Lala DS (2012) Regulation of sphingomyelin phosphodiesterase acid-like 3A gene (SMPDL3A) by liver X receptors. Molecular Pharmacology 82(4):719-27. Noto PB, Abbadessa G, Cassone M, Mateo GD, Agelan A, Wade JD, Szabo D, Kocsis B, Nagy K, Rozgonyi F, Otvos L Jr. (2008) Alternative stabilities of a proline-rich antibacterial peptide in vitro and in vivo. Protein Science 17(7):1249-55. Macaluso M, Montanari M, Noto PB, Gregorio V, Bronner C, Giordano A (2007) Epigenetic modulation of estrogen receptor-alpha by pRb family proteins: a novel mechanism in breast cancer. Cancer Research 67(16):7731-7. Macaluso M, Montanari M, Noto PB, Gregorio V, Surmacz E, Giordano A (2006) Nuclear and cytoplasmic interaction of pRb2/p130 and ER-beta in MCF-7 breast cancer cells. Annals of Oncology 17 Suppl 7:vii27-9. Laszlo Otvos, Jr, M. Cassone, V. de Olivier Inacio, Paul Noto, J.J Rux, J.D. Wade and Predrag Cudic. Synergy between a lead proline-rich antibacterial peptide derivative and small molecule antibiotics. From the book: Peptides for Youth, American Peptide Society, 2007. Noto PB, Bukhtiyarov Y, McGeehan GM and Lala DS (2013) LXR transcriptome in Cynomolgus monkey brains (manuscript in preparation).