Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002....

15
Vf, DAFTARPUSTAKA Adisarwanto R, Wudiantu R. 1989. Meningkatkan Hasit Panen Kedetai di Lahan Sawa h - Kering - Pasang Surut. Penerbit Swadaya. Jakarta. Akhdiya, A. 2000. Kloning gen y ang terfibat dalarn mekanisrne patagenisitas Xanfhornonas axonopodis pv. glycines. Tesis Mag ister Sains. Program Pascasarjana lnstitut Pertanian Bogar. Alien LN, Hanson RS. 1985. Construction of broadhost-range casrnid cloning vectors: identification of genes necessary fur growth of Methylobacterium organophijum on methanol. J. Bacterial. 161 :955-962. Ananim. 1990. Petunjuk bergambar untuk identifikasi hama dan penyakit kedelai cli Indonesia. JICA ATA - 3378 Project: Strengthening of pioneering research for palawija crop production. Pusat Penelhian dan P,engembangan Tanaman Pangan Bagar. Baldini RL, Tahara ST, Rosato YB. 1999. A rolling circle miniplasmid of Xanfhamonas campmttr's pv. glycimes: The nucleotide sequence and its use as a cloning vector. Piasmid 42: 126-1 33. Baxevanis AD, Ouellete Bff. 2001 . Bioinforrnatics of Practical Guide the Analysis of Genes and Proteins. 2"6 ed. John Willey & Sons. Inc. New York. Siro Pusat Statistik. 2001 . Statistik Indonesia: Statisticat Year Book of Indonesia 2001. Biro Pusat Statistik. Jakarta. Bradbury Jf. 1986. Guide to Plant Pathogenic Bacteria. CAB international Mycaloogical institute, England. Braun V. 1995. Energy-caupfed transport and signal transduction through the Gram-negative outer membrane via TonB-Exb8-ExbD-dependent receptor proteins. FEMS Microbid. Rev. 4 6:295-307. Burke Jf . 1996. PCR: Essential Techniques. John Wiley & Sans. United Kingdom. Chan JWYF, Goodwin PH. 1999. The rnabcular genetics of virulence of Xanfhomonas campestds. Biotech. Adv. 1 7:489-508. Chen LY. 1996, XpsD, an outer membrane protein required for pratein secretion by Xanthomanas campesf#s gv. campesfris, forms a rnuitimer. J. Bid. Chem. 271 :2703-2708. da Silva ACR et af. 2002. Comparison of the genomes of two Xanfhomonas pathogens with differing hast specificity. Natu~ 4 1 T459-rl.63.

Transcript of Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002....

Page 1: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

Vf, DAFTARPUSTAKA

Adisarwanto R, Wudiantu R. 1989. Meningkatkan Hasit Panen Kedetai di Lahan Sawa h - Kering - Pasang Surut. Penerbit Swadaya. Jakarta.

Akhdiya, A. 2000. Kloning gen y ang terfibat dalarn mekanisrne patagenisitas Xanfhornonas axonopodis pv. glycines. Tesis Mag ister Sains. Program Pascasarjana lnstitut Pertanian Bogar.

Alien LN, Hanson RS. 1985. Construction of broadhost-range casrnid cloning vectors: identification of genes necessary fur growth of Methylobacterium organophijum on methanol. J. Bacterial. 161 :955-962.

Ananim. 1990. Petunjuk bergambar untuk identifikasi hama dan penyakit kedelai cli Indonesia. JICA ATA - 3378 Project: Strengthening of pioneering research for palawija crop production. Pusat Penelhian dan P,engembangan Tanaman Pangan Bagar.

Baldini RL, Tahara ST, Rosato YB. 1999. A rolling circle miniplasmid of Xanfhamonas campmttr's pv. glycimes: The nucleotide sequence and its use as a cloning vector. Piasmid 42: 126-1 33.

Baxevanis AD, Ouellete B f f . 2001 . Bioinforrnatics of Practical Guide the Analysis of Genes and Proteins. 2"6 ed. John Willey & Sons. Inc. New York.

Siro Pusat Statistik. 2001 . Statistik Indonesia: Statisticat Year Book of Indonesia 2001. Biro Pusat Statistik. Jakarta.

Bradbury J f . 1986. Guide to Plant Pathogenic Bacteria. CAB international Mycaloogical institute, England.

Braun V. 1995. Energy-caupfed transport and signal transduction through the Gram-negative outer membrane via TonB-Exb8-ExbD-dependent receptor proteins. FEMS Microbid. Rev. 4 6:295-307.

Burke J f . 1996. PCR: Essential Techniques. John Wiley & Sans. United Kingdom.

Chan JWYF, Goodwin PH. 1999. The rnabcular genetics of virulence of Xanfhomonas campestds. Biotech. Adv. 1 7:489-508.

Chen LY. 1996, XpsD, an outer membrane protein required for pratein secretion by Xanthomanas campesf#s gv. campesfris, forms a rnuitimer. J. Bid. Chem. 271 :2703-2708.

da Silva ACR et af. 2002. Comparison of the genomes of two Xanfhomonas pathogens with differing hast specificity. N a t u ~ 4 1 T459-rl.63.

Page 2: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

Daniels MJ etal. $984. Cloning of genes involved in pathogenicity ufXanthomonas campestn's pv. campest& using broad host range plasmid pUFR 1 . EMBO t1 . 313323-3328.

Daniels MJ. 1988. Molecular gemtics of host-pathogen interactions. Di dalam: Psstacias $3, Verma DPS, editor. Molecular Genetics of Plant Microbe Interactions. APS Press. St. Paul, him 229-234-

de Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS transpasan derivatives for insertion rnutagenesis, promoter probing, and ch rarnosamal insertion of cloned DNA in Gram-rtegative Eubacteria. J. Bacfetlu/. 1726568- 6572.

Dieffenbach CW, Dveksler GS. 1995. PCR Primer: A Laboratory Manual. Cold Spring Harbor Labaratow Press. New Yo&.

Ditta G, Stanfield S, Curbin 0, Heisinki DR. 1980. Broad host range DNA cloning system far Gram-negative bacteria: canstructian of a gene bank of Rhimbium melibti, P m . Na t Acad. Sci. USA, ?7:?347-735 1.

Donald McJG, Wong E. 2001. Use of a mottoclonal antibody and genornic fingerprinting by repetitivesequence-based polymerase chain reaction to identify Xanthomonas populi pafhovars. Can. J. Plant Pathol. 23:47-5 1 .

Daw JM, Scafield G, Trafford K, Turner PC, Daniels MJ. 1987. A gene cluster in Xanfhamonas campestris pv. campestris required fur pathogenicity cant~ols the excretion of polygalacturonate lyase and other enzymes. Physiuj. Mol. Plant Patfro!. 3 1 : 26 1 -27 1 .

Expert D, Enard C, Masclaux C . 1996. The role of iron in plant trust-pathogen interaction. Trends Microbiof. 4232-237.

Gherna R. Pienta P. 1992. Catalogue of bacteria and phages. Rockvilie: American Type Culture Collection.

Gillis M, Ruth DA, Johnson J, Rudolph K, 1990. Characterization by nucleic acids. Di dalam: Methods in phytobacteriolagy. Klement Z ef al. (editor). Akadernial Kiado. Budapest. htm. 21 6-232.

Glick BR, Pasternak JJ. 1 994. Molecular Biotechnology Principles and Application of Recombinant DNA. ASM Press. Washington DC, USA.

Hidayat JR, Harnoto, Machmud M, Surnarno. 2000. Teknaiogi Praduksi Benih Kedelai. Pusat Penelitisnn dan Pengembangan Tanaman Pangan. Badan Litbang Departemen Pertmian.

Hu NT et a!. 1992. Cloning and characterkation of a gene required for the secretion of extracellular enzymes across the outer membrane by Xanthomonas campesfris pv. camp@stris, J. Bactariol. 1 74:26?8-2687.

Page 3: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

Hwang I, Lim SM, Shaw PD. 1992. Cloning and characterization of pathogsnice genes from Xanffiomonas axunopodis pv. glycinea J. BacferioI. 1 74: 1 923-. 1931.

Kamoun S, Kada CI. 1990. A plant-inducible gene of Xafhomonas axonopoljis pv. exonopodis encodes an exocellular component required for growth in the host and hypersensitivity on nonhosts. J. Bacteriof. 172:6165-5172.

Kaben F, Becker A, Zorreguieta A, Piihler A, lelpi L. 1996. Promoter analysis of the Xanfhomonas campestris pv. campest& gum operon directing biosy nthesis of the xanthan polysaccharide. J. Bactefiol. 1 78:4313-4318.

Kennedy BW, Siridair 48. 1989. Bacterial b~sub. Di dafarn: Sinclair JB, Backman PA, editor. Compendium of Soybean Diseases, APS Press. Minnesota. USA.

Kim JG et a]. 2003. Characterization of the Xanthomonas axonopodis pv. glycines Hrp Pathogenicity Island. J* Bacteriof, 185:3155-3166.

Kfement Z, Goodman RN, 5967. The role of living bacterial cefl and induction time in the hypersensitive-reaction of the tobacco plant. Phytopafhology 57: 322- 323.

Laha ye T, Bonas U. 2001. Molecufar secrets of bacterial type IIt effector proteins. Trends Plant Sci. 6:479-4885.

L a w n JAY Higashi DL, StojiIjitovic I, So M. 2002. Replicatian af Neisseria menin~itis within ephitelial cells requires TonB-dependent acquisition of the host cell iron. Infect. Immun. 70:1461-1467.

Lazo GR, Roffey R, Gabriel DW. 1987. Conservation of plasmid DNA sequences and pathovaf identification of strains of Xanfhomonas campstris. P h y f ~ ~ t h ~ l ~ g ~ 77 1448-4 53.

Lfop P, Caruso P, Cubero J, Morente C, lopez MM. 1999. A simple extraction procedure for efficient routine detection of pathogenic bacteria in plant material by polymerase chain reaction. J. Microbid. Methods 37:23-31

Machmud M, Jurnanto H, Sudjadi M. 1999. Current progress of research on soybean diseases in Indonesia. Di dalam: Workshop on Soybean Biotechnology for Aluminum Tolerance an Acid Sails and Disease Resistance, Research Institute for Food Crops Biotechnology, Bagor, 14-1 5 September 1 999.

Mansfield J , Jenner C, Hockenhull R, Betrnet MA, Stewart R.1994. Characterization of avrPphE, a gene for cuttivar-specific avlrulence from P. syrr'ngae pv. phasealicofa which is physically linked to hrpY, a new hrp gene identified in the halo- blig ht bacterium. Mu!, Plant-Micmb~ntemct. ?:722-773,

Page 4: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

Meis JE. 2003. The ~ a s t e r ~ r n p ~ Real-Time RT-PCR kit provides superior sensitivity and consistent quantifatian. EPICENTRE Fowm 1 0:4

Mesait, F.M., A. Suwanto, B. Tjahjono, dan E. Guhardja. 1994. Modifikasi bioesei kotiledon kedela i untu k uji patogenesis Xanthomonas campesffis pv. glycines. J. f.i. Ped. lndon. 4 : '1 7-82.

Mortensen CN. 1 989. Seed-borne Bacterial Disease. Danish Government institute of Seed Pathology for Developing Countries, Heilenrp, Denmark.

Neergard P. 1979. Seed Pathology. 2"6 vol. (revised ed.). The Mac Millan Press Ltd., London.

Neidhart F C, Ingraham JL, Schaechter M. 1990. Physiology of the Bacterial Cell. Sinauer Associates, Inc. Pu bl. Su nderland, Massachusetts.

Neilands JB. 1995. Siderophores: Structure and function of microbial iron transport compounds. J. BioI. Chern. 270:26?23-26726.

Prentki P, Krisch HM. 1984. In vitro insertional rnutagenesis with a selectable DNA fragment. Gene 29:303-313.

Priefer UB. f 993. Genetic engineering of Gram negative bacteria. Di dalarn: Piihler A, editor. Genetic Engineering of Microorganisms. VCH Publ. New Yark. hlm. 56-82.

Reyrat, J.M., V. Pelicic, B. Gicquel, and R. Rappuoli. 1998. Counterselectable markers: Untapped tools far bacterial genetics and pathogenesis. fnfect. /mmun. 66:40114017.

Rukayadi Y. 1995. Anafisis profil DNA genom sejurnlah isolat Xanthomonas axon6podis pv. glycines dengan mengguna ka n elektroforesis gen medan berpulsa (Pulsed-Field Ge/ Eiectmphoresis). Tesis Magister Sains. lnstitut Pertanian Bogor.

Ru kayadi Y. t 998. Konstruksi peta parsial dan karakterisasi sintasan spifitik mutan nan-pa tag en ik da ri Xanfhornonas axonopodis (campest&) pv. glycines YR32. Disertasi Daktar. lnstitut Pertanian Bogor.

Rukayadi, Y., A. Suwanto, B. Tjahjono, and R. Hariing. 2000. Suwivai and ephiphytic fitness of a nonpatogenic mutant of Xanfhomonas campestris pv. glycines. Appl, Envimn. Microbial. 66: 1 1 83-1 1 89.

Sakhtivel N, Martensen CN, Mathur $8. 2001. Detection of Xanthamonas wyzae pv. orgrrae in artificially inoculated and naturally infected rice seeds and plants by molecular techniques. Appf. Microbial. Biofechnoi. 56:435-44 1 .

Page 5: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

Sarnbrook J, Russell. 2001. Molecular Cloning: A Laboratory Manual. 3ded. Cold Spring Harbor Lab. Press. New Yo&.

Sharma A, Syed AN, Nair PM. 1994. Characterization and plasmid profile of Xanfhomonas campeslris pv. glycines from Ma harasthra India. Phflopatol. 141 53-58.

Shukia AK. 1994. Pilot estimation studies of soybean (Glycine max) yield lasses by various levels of bacteria! bisule (Xanfhomonas campestris pv. giycirtes) infection. int. J. Pest Manag. 40:249-251.

Sigee DC. 1993. Bacterial Piant Pathology: Cell and Molecular Aspects. Cambridge Univ. Press. 325p.

Simon R, Priefer V, Piihler A. f 983. A broad host range mobilization system for in viva genetic: transpasan mufagenesis in Gram-negative bacteria. Biflechnology 1 : 784-79 1.

Sinclair .IS, Buckman PA. 1989. Compendium of soybean diseases. 3K' ed. APS Press. St. Paul.

Suwantu A. 1994. Pulsed-field gel electrophoresis: A revolution in microbial genetics. AsPac. J, Mol. Biol. Biofechnof. 2:78-85.

Tang J et a!. 1 99 1. Genetic and molecular analysis of a cluster of pf genes involved in positive regulation of synthesis of extraceluflar enzymes and polysaccharide in Xanthomonas campesfris pv. campesfris. Moi. Gen. Genet. 226:409-41.

Turner P, Barber CE, Daniels MJ. 1 985. Evidence of clustered pathagenictty genes in Xanfhomonas campestds pv, campestris. Mul. Gen. Genet. 1 99: 338-343.

Vauterin t, Hoste B, Kerters K, Swings J. 1995. Reclassification of Xanthomonas. J. Sysf. BacteriuI. 44:4472-489,

Veena MS, van Vuurde J WL. 202. Indirect irnrnunafluarescence coiany staining method for detecting bacteria I pathogens of tomato. J. MMicbioi. Methods 49:11-17.

Verdier V. 1998. Detection of the cassava bacterial blight pat hogen, Xanfhomonas axonopodis pv. rnanihotis, by polymerase chain reaction. Plant Dis. 8279- 83.

Vieira J, Messing J. t 99 1 . New pUC-derived cloning vectors with different selectable markers and DNA replications origins. Gene 1 00: 1 89-f 94.

Wang TW, Tseng YH. 1992. Electrotransfomation of Xanfhomonas campesfds by Rf DNA of filamentous phage fLf. Lstf. Appl. Microbial. 14:65-68.

Page 6: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

Widjaja R, Suwanto A, Tjahjono B. 1999- Genome size and macrorestfiction map of Xanlhamonas campestris pv. glycines Y R32 chromasame. FEMS Microbial. Lett. 1 75:5988.

Wiggerih HG, Pljhler A. 2000. The exbD2 gene as wefl as the iron-uptake genes ton& exbB and exbDf of Xanihmonas campesin's pv. campesfris are essential far the induction of a hypersensitive response on pepper (Capsicum annuurn). Microbid. 146: 1 053- 1 060.

Wrather JA et a!. 2001. Soybean disease loss estimates for the top ten soybean- producing countries in 1998. Can. J. Plant Pathol. 23: t 15-1 2 1.

Page 7: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS
Page 8: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

BLASTM 2,OMP-WashU /29-Mar-20031 [decunix5.0a-ev6-1P32LF64 2003-03- 30216:44:251

Query- (1793 letters)

Sequences producing High-scoring Segment Pairs:

Smallest sum

'digti Probability Score P I N ) N

M ' '1 AE011700.1 Xanthomonas axonopodrs pv. c l t . . . 2383 5.3e-387 2 EM~PRO:&~;I~{^~' AEOll699.1 Xanthomonirs axonopodls pv. clt... 1898 6.8e-78 1

>EPq_PRO:AE011700 AE03.l'f00.1 Xanthamonas axanopwdis pv. citri str. 306, s e c t i o n 78 of 469 o f the complete genome.

Length - 9955

Plus Strand RSPs:

Score = 2383 ( 3 6 3 . 6 bits), Expect = 5 . 3 ~ - 2 8 1 , Sum P ( 2 1 = 5.3e-287 Identities = 589/704 ( 8 4 % ) , Positives = 589/704 ( 8 4 % ) , Strand - Plus / Plus

Query: 424 GTGCGCTCCCGATATCTTTGCACGCACCGTTGCAGGTCAATGf;CGGCFAGGTCGG 4 8 3 i l I l l l I l l l l l I l l t l t l l l t l l l l l l l l f I l l l l t l l 1 l l l t l t I l l l l f l l l l l l l

S b j c t : Z GTGCGC'fCCCGATATCTTTWACGCACCG~TGCAEGTCFBTECCGETAAGG 60

Query: 4 8 4 GCTTCCAGAGCGCTATCGAACGCTTTCGAAAGTGACTGTTGACACGATCTTTTAGAGAC 5 4 3 I1 l l l l l l l l l I l l l ~ l i l l l l f l f I t l t l ~ l l l l l l l I ~ l l l l l l i l f l l l l l l l l

S b j c t : 6 3 ACTATCAGAECKTATCGAACGCTTTCGARAGTGACTGTTGACACGATCTTTTAGAGACC 120

- I l l t l t l l 1 l l l i t l t l l l I l l l l l l l l I I 1 I 1 1 1 1 I 1 I l I 1 I ~ I I 1 l l I l i l l l t i 1 l

Sbjct: 121 ATAAGAATCAACTCCACTCrABTTGGTACTTTCCAGTCAGGGCCGTTGGTCAGCMTGGCA 180

Query: 604 TGCGTGCCCGTCCTEEGACGGACGCGGCATCEGCACCCACGEI;GGGECTTGCGGGG'PGC 663 l l l t l l l l l l l l l l l l l t l i l l l I I l l l f t l t l l I l l l I I I I t l l l l l l l l l l l l l l l l l

Sbjct: 181 TGCGTGCCCGTCCTGGGACFGACGCGGCATCGGCACCCACGGGGGGCTTGCEGGTG 240

- 4

I I I ~ I I I I I I I I I ~ ~ I I I I I I ~ I I I I I ~ I I I ~ I ~ I I I I I ~ I I ~ I I I I I I ~ I I I I ~ I I I I Sbjct : 2 4 1 CGCAEACAACAEATCECCGGCGGTTCCGGACATCCGGAACfEGTGACCTGTGCGCGCGTG 300

Query: 724 GTTGGGTTECAA-CGCCG(;GATCTGTCATCGCTGATCGATCGEARCGCCAGTCTT 7 8 2 l111111~11 I l l l l l l I l l l l l I l l l l l l f l l l l l l l l l l l I l l l I l l l l l l l l l l l

Sbjct: 301 ETTEGGTTGCCAGCGCCGEGATCTGTCATCECT~TCGATCEGAACECCAEC 360

Query: 783 CGTCCRCCCATTCCACTTCAGGATTTCTCATGTCGCCTCTCCCGCGTGCCTCECTGT 842 i i i l l l l i ~ I l l l l l l f l I l I l l l l l l l l t l ~ i l l l I l l l l l l l l l l l l I l t l l l t l l

S b j c t : 361 CGTCCAGCCATTCCACTTCAGGATTTCTCATGTCGCCTCTCC€GCGTGCTCGCTGCGTT 420

Query: 8 4 3 T T T G T C C G C C T C C G T C G C T G T C C C T T G C - W T T G C C T T G C T T C G A 900 l i l l I f 11 I l f t l f l l l l l l l l l l I l l t l I I I l l l I l l l l I ~ l11llll1 1

Sbjct: 421 G T T G T T C G C C C T C G T C G C T G T C C C T T G C C R T T G C G C T G T C T C A 180

Query: 901 ACGC-CAGAC-CACGAC-CRTCGGCGGCGGAT-CGGEGCGAATCTCCCMCTCGATGCAC 956 I l i l t i l i l I I i l l I l l i l l l l t l t l I I I I 1 l 1 l l ! l l l l l I l I l l l l I

S b j c t : 481 ACGCGCAGACA~AGGACGCATCGGf:EGCGGC~~GCGGCECAGATI:TCCCAACTCGTGC-C 539

Query: 957 AIbEGTCACCAECTCCTACCRARhCAE-CCTGI(TC:ACCECGATGGACAACAAGCECGACAR 1015 1 I l l I ! i l I I t I I I1 l i I I I l l l i t I l1!111

Sbjct: 540 A---TCA--AGGTC--ACCAGCTCGTACCRGAAGAGCCTGATC-ACGGCCAT-G-GACBA 589

Query: 1016 CTTECGC-ATGACCGACGGCATCTCTCCCAGGACCATC-G-GCAGGTTTCCTGCCGW 1072 1 1 1 1 I ! / I $ 1 l l i I I I I I l l I I l l 1 1 I I 1 1 I !

Sb j c t : 5 9 0 ~IUTICGCGACGACGTGCG-CATGACCGACGGCATC-TCTGCGCAGGA- -CAT-CGECAAE 6 4 4

Query: 1073 CTCCGCCI;GGGCAACECATCACCCATCCGGTGT-GCARRT 1115 I 1 1 1 I i l 1 1 1 1 l I I I1 I ! I I1 I l l

Sbjct: 645 TTTC-CTECCGM-CATCGCCEAGECGATCCAGCGCATCC 686

Lampiran 1. Hasil analisis sekuen gen yang terlibat patogenisitas X. axortopodis pv. glycires (1 793 nt) rnenggunakan program 8lASTN 2,U

Page 9: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS
Page 10: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

>Ef.iPRO:AE011699 AE011699.1 Xanthomonas axonopodis pv. citri str. 306, section 77 o f 469 of t h e com~lete aenone.

Length - 11,301 Plus Strand HSPs:

Score - 1898 ( 2 9 0 . 8 b i t s ) , Expect = 6.8e-78, P - 6.8e-78 Identities - 424 /460 (92%), Pos i t ives - 424/460 (92%) , Strand = Plus / Plus

- .. I l l l l I i 1 1 t l 1 l t l l I l l l l 1 I I1 I t I l l I I I I

S b j c t : 10846 AATTGCTEGGCTTCCCTEC-TACTCCGGAGCGCEGGTTTTTGCGCAACEAFGAAGGTCGA 10904

Guery: 87 TT-CAG--GAAACAGCTATGACTGGCGACGTGCCACAGCGCCCETCTTCTGCACCAT 143 1 1 l l l t l l l I 1 l 1 I 1 1 l I I l t l l l I l l l I I l l l l l l l l l l l l l t f l I l l l l l l l I

Sbjct : 10905 TTGCACTAGAAAC-GCTATGACTGGCGACGTGCCACAGCGCCCGTCTTCTGCACCATGT 10963

Ouerv: 1 4 4 C G T G C A T G C G T T G C G G C T G G T A T G T T C G T T G C G G C G A T T G C C 203 - .. l l l l l l l l l l l l 1 l l l l l l t l t l I l l l l l l i l l l l l l l I l l l f l t I l l l l l I I l l I l I l l

Sbjct: 10964 CGTGCATGCETTGCGGCTGGTATGTTCGTTGCGECGATTGGATGGCGTGTRGGCTCATC 11023

Query: 204 GTTGACA19CGTTGTCGTCGTGGCGCGGCAAGChGTCATCGCGGCACGGGTTTC 263 I l l f l l I l l l l l t l l l l f l l l l l I l l l l l l l l l l l l l I l l t l l l t i l t l l l i l l l t l t I i

Sbjct: 11024 G T P G A C A A C E T T G T C E T C G T G G C G C E G C A R G C l a . G T C A T C G C G G C A C T C T 11083

Query: 264 AAGTACTGCGATACGCKTTTGGAATACACATERGCACGCTGCGAACIEACE(;TGACGCAG 323 l l l f I I l I l l l l l l l l l l l l l l l l l l l l l i l I l t l l l l l l l l l I l l t l t l i l t l l l l l i

Sbjc t : 11084 ARGTACCGCGATACGCGCTTTGGAATACACATEAGCACGCTGCGAAGGACGGTGACGCAG 11143

Query: 324 CCAGCRGTGATTGCGACGTCGGGGCCGCGACGTEGACTGCCWGAATTGETCTEGT~CA 383 I t l t l t l l l I I l l l l t l l l l l l l l l l l l i l l I l l l l l l l l l I t l l l t l t l l l i l l l l

Sbjct: 11144 CCRGCAGTG-T-GCGACGTCGGGGCCGCGA.CGTCGACTGC:CCAGAATTGGTCTEGTCACh 11201

Query: 384 A G G h A T T G G T C A G T M C T G G T C A T G T G A C A A C G R T G C C C A E T G C G C T T T T 443 l l l l t l l l l l l l l t l I l l l t l l l l I l l l l l l l ! i l l l l I t t l I l l t l l I t l l l I I l l l I l

Sbjct: 12202 AGGAATTGGTCAGTGACTGGTCATGTGACFCACGATGCCCAGTGCGCTCCCGATATCTTTG 11261.

Query: 4 4 4 CACGCACCGTTGCAGGTCAATEGCGGCRAGGATCGGGTGC 483 l i l l l l I l I l I ~ l l l I l t i I l l l l I l I l l l l t l l l l t l i

Sbjct : 11262 CACGCACCGTTGCAGGTCAATGCGGTARGEATCGGT 11301

Page 11: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

BLASTW 2.0MP-BashU 329-Mar-20033 fdecunix5.0a-ev6-IP3214F64 2003-03-30T16:4$:25]

Query- ( 5 0 0 letters)

Sequences producing High-scoring Segment Pairs:

Smallest Sum

Sigh Probabi l . i t y Score P(NJ W

EM-PRO: +C?-;-r1::I AE011700,I Xanthumonas axonopodis pv. clt. . . 1387 5.2e-75 2

>EM-PRO:Ab'm:i-'m' AE011700.L Xanthomonas axonopodis pv, citri s t x , 3 0 6 , section 7 S of 469 o f t h e complete genome.

Length = 9955

Score - 1387 ( 2 1 4 . 2 bits), Expect = 5.2e-75, Sum ~ ( 2 ) = 5.2e-75 Identities - 307 /323 t 9 5 8 ) , P o s i t i v e s - 307/323 ( 9 5 % ) , Strand = Plus / Plus

Query: 1289 G C C G G T G - C C T E T - G G G C A C G E T A A R - A T C A A - A C - A - C - C A G 1341 I l l l f i l I l l I I l l l l l l l l I l l i l I 1 l l 1 1 l11l l l l l I l l l l l l l l l l l

Sbjct: 885 GCCEGTGECCTATCGEECACGGTCAACATCAACACCACCaBACCCCTGGACTACCAGCAG 9 4 4

Ouerv: 2342 -CCbLAGCTGCTETTCTCAGCCAAFACGChGTACTCCEAGTTTGCCGG-GGTTCGCCFAC 1399 -, ., t l l l l l l l l l l l l l l l l ~ l t l l l l l i l l t l I l l l ~ l t l t l l t l l f 1 t l l l l t l t l t l l

Sbjct : 945 ACCAAECTCrCTGTTCTCAGCCAAAACGCAGThCTCCGRGTTTGCCGGCGGTTCGCCAPICG 1004

Query: 1400 C C C ~ G G G - G T G G C T G A C C T A T A T C G A C C A G T T C B A G T T C G G T G G C G C C T 1458 l l l l l l l t f l t L l l l l l l l l t l i l l f l f I t l l l l l l l l l l l l l l l t l I l l l l l t t l l l

Sbjct: 1005 CCCAAGGGCGTG-CTGACCTATATCEACCAGTTCAAGTTCGGTGCCCTTGCT 1063

Query: 1459 GTTCTCTCBGCGCCGGCTATCAGBAGCTCAAGGATCGCGCCEATTATCCTGTGGATCGAC 1518 l i l i I l l l l l l l l l l l l l l f l I l l l l l l t l l ~ l l l l l l l I 1 l I 1 1 I 1 I t l t l l l l t l l

Sbjct: 1064 GTTC-CTCAGCGCCGGCTATCAEAAGCTCAAEGATCGCGCCEATTATC-TETGGATCGAC 1121

Query: 1519 CGTTGGTACACGCAG-C~CCGACGCCGGChCGTTf;TAThTCCCACGCCGTCCGCGCTAT 1577 l l l l l l l l l l l l l l l I l l t l l l l l l t l i l l l l l l I l l l l ~ l l t l t l l l l l l l I l l l I l l

Sbjct: 1122 C G T T G G T A C A C G C A G G C C A C C G A C G C C E G C A C G T T G T A T A 1181

Query: 1578 CECTCGATCEAGCGCGAGACCAC 1600 I l l i l I l l l l l i l l ~ l l l l I l l I

S b j c t : 1182 CGCTCGATCGAGCGCGAGACCAC 1204

Score = 538 (86.8 bits), Expect = 5.2e-75, Sum P ( 2 ) = 5.2e-75 Identities = 1 $ 2 / 2 4 2 (75&), Positives - 182/242 f 7 5 % ) , Strand - Plus / Plus

Query: 1100 GGTETGCAAATCCCCTCGATCCCCGEGGECGTCCCCATCACTTGCTTGCCCCCCG~ 1160 t l ~ l t l l l 1 1 I t 1 1 1 1 f l l l 1 1 1 I l l I t I 1 1 I l l I I l l1

Sbjct: 687 EGTETGCAGATTTCCACTATCAACGGGCGCGGTTCCACCRTTAGCGTGCGTGGCCTGG 7 4 6

Query: llhl CC-CA-TATCCCCCCCCATCACCGTCAGTGATCAGAAGTGATCARA-G-GCCGATT-C 3215 I1 l l I l l 1 l l 1 l i t 1 I l l 1 l i l I l l l r l l l l I l t ! l l l l I l l

Sbjct: '747 C C G C A G T A T T C G G C C A C - - C A C C A T C W B C G G C C A G - - G T 802

Query : 1216 CGATGE-TTCCGGTAAGA-ATTATC-A-CCAGAAGT-GCCGCCGGCATCGAGGTGATCAA 1270 l l I1 l l l t l l f 1 1 I1 / I I l l I I l l l l l l l l I l l l l l l l l l l l l l l l t l 1111

Sbjct: 803 CGATGGCTTCCGCTRCGACATCATCCAGCCAEAAGTAGCCGCCGGCATCGAEGTGATCAB 8 6 2

Query: 1271 -T-GCCGTCGG-GGACATGGA-GCCGGTE-CCTGT-GGECACGGTELAA-ATCAABCACAR 1323 I I I I I l l1 l l I l I l I l l I l l l l l l I l l I I l l l l l t l l I t I l l i i I I I I

S b j c t : 863 A T C G C C A T C G G C r ; I ; A C A T G G A C G C C ( ; G T E G C C T A T C 923.

Query: 1224 AC 1325 1

S b j c t : 922 CC 923

Lampiran 2. Hasil analisis sekuen gen yang tedibat patogenisitas X. axonupadis pv. glycines (nt 1 i 00-1 600) menggunakan program BLASTN 2.0

Page 12: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

AX011700 standard; DNA; PRO; 9955 BP AEOll"100; AE008923;

28-MAY-2002 ( R e l . 71, Created) 06-3uw-2002 ( R e l . 7 2 , t a f t updated, Versi.on 4 )

Xan-nas a x o n w e pv. citr4. la*. 306, secticrr~ 78 of 4 6 9 o f the complete genome.

Xanthomonas axonopodis pv. citri s tr . 306 Bacteria; Proteabacteria; Gamproteobacteria: Xaxlthomonadaceae; Xanthomonas: Xanthomonas axonopodia; Xanthomonas axonopodis pv. citri.

11 1 1-9955 PIEDLIME; ,--L. *

PUBMED; A:,A ;::; ,,':,"( . da Silva A.C.R., Ferro J . A . , Reinach F.C., Farah C . S . , Furlan L.R., Quaggio R . B . , Monteiro-Vitorello C.B., Van Sluys M.A., hlmeida Jr H . P . , ALves L.B.C., do Amasal A.M., Berto l in i Y.C., Camargo L.E.A., Camarotte G., Cannavan F., Cardozo J, , Chambergo F., Ciapina L. P., Cicsrel.li R . M . B. , Coutinho L . L . , Cursino-Santos J.R., El-Doxry El, , Faria J.B., Ferreise A . J . S . , Ferreira R.C,C., Fesro M. I .T. , Formighieri E.F., Franco M.C., Gregglo C.C., Gruber A . , Katsuyama A.M., Kishi L.T., Leite 3r R . P . , Lemos C.F.M., Lemos M.V.F., tocali E.C., Machado M . A . , Madeira A.M.B.N., Martinez-Rossi N . M . , Martins E.C., Meidanis J., Menck C . F . M . , Mlyaki C.Y., Moon D.H., Horeira L . M . , Movo M.T.M., Okura V . K . , Qliveira M.C., 0li"veixa V.R . , Peseira Jr B.A. , Rossi A,, Sena J.A.D., Si3.va C . , de Souza R.F., Spino la L . A . F . , T a k i t a M.A., Tamura R.E., Teixeira E.C., Tezza R. I .D., Trindade dos Santos M., TruEEi D., Tsai S.M., White F . F . , Setubal J . C . , Kitajima J . P . ; "Comparison of t h e genmes o f two Xanthomonas pathogens with d i f f e r i n g host specificities"; Nature 417 (68871 :459 -46J t2002 ) .

1 . ,9955 /db-xref-"raxon: . " /note="pathovar: citri" /organism="Xanthomonas exonopodis pv. c l t r l str. 306'' /stl;ain="306" . > , 390.. 3098 /cotfurl-s t a r t -1 / d b x r e f - " G O A : , . '* /db-xref-"SPTREMRT, : , ,- " /n~ta-~~deneified by sequence sim~lar~ty; putat ive; ORY located using Blastx/Gbimmer/Genemask" /transl-table-ll /gen&="1 TON* /product-"TanB-&psmd=smt rectpptarn

/protein-ld-"

Lampiran 3. Open Reading Frame (URF) gen iroM penyandi TonBdq?endenf receptor gada GenBank (nomor aksesi AEO11700)

Page 13: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

SQ Scqucnce 9955 BP; I f 6 3 A; 3131 C; 3217 G : 1844 T; 0 other;

gtgcgcrccc: actatcagag ataagaatca tgcgtgcccg cgcagacaac gttgggttgc cgtccagcca w-togac

garatctttg cacgcaccgt tgcaggtcaa tggcggtaag gatcgggtgc cgctatcgaa cgctttcgaa agtgactgtt gacacgatct tttagagacc actccactga a r t g g t a c t t tccagtcagg gccgttggtc agcaatggca tcctgggacg qacgcggcat cggcacccac gggggggctt gcggggtgct agatcgccgg cggttccgga catccggaac tggtgacctg tgcgcgcgtq cagcgccggg atctgtcatc gctgatcgat cggaacgcca gtcgcgttgt t t ccac t - tca ggatttctca igtugcctct oacgagtgnc togctgqkt ctegtagatg tocctGgcca +tprrgcw* Bctgcttgcc tScgg-2-

M e ~ c gttgaaGqeg m a t t - OogkagqM acEttegutc gclgatgtgcg aqgegagaa ttoctgtako tgctaaggac cggtgcggtg taegqettog aatgttccc ggagctgkcc gcspccagaa gcacggtw camcttcctk gacggacaac trsspctorroa QQ-Wtgg t -wwa tOQCw9PCT cc5rWw-t acaSfwocg gtgctgttt(f cscogcapag wc-sgc skogag-csg acatttcttc ggegtatgag a w e tcgacacqa cataggcagc atgogtckgc g"gg-w ~ m t g c g a tapgaaamka caa&acgct*a cacogatacc tacctgbcta apa-gc cgcoagagao wage-tg tcPgtqgtagq o=w-o goga=*og agt*attacl*a c m t g a c c agcctgaatc tatgoircgaa (gscttgttgc tqcgotttgc ggacgc~aag gkoekggtgc g~ccgaittct ggscag-c &cagcgutcg uktagaagat ttqaccgge acalurtrrc*g g q g ~ ~ ~ c a a awatlrtgto gtcgaccagg gccam-=ww Cctgaaggca ttwagcw cc-ctg g a g w e t : m - c p g oggcgqctg accpkggcag gattctggaa -ca- arreqgo&cct tcmataqcat cgtttquccg gccgccttks aogg-cgt gctgtccagc rarrwaagoag Qagattgtgt gagtagtaw ggagstatot ~ogagatcm cqecact3~cc a a t g a t c a g m seaaggtaas wttw-t *w=ga- wtss8ag- swetggat gccwttga weCSg8- tk-t~ ~ C C ~ C C I I * B ~ ~ g m t t C w C ( * 8 WCgabC-

atttQllapt cagCB#kCct$ tcaqaaawa cEtqgaacgC gacagcgtsc tgggagagcg ogaactactc ggcaogagtS togetasaka atcgaagcga gtaagsscllg g-gcagcg acagcttctt ogegagag&a ggoaaaataa tganqqcaeg anagangatg gatgcama ttg'gctt&coa ggteaaqac slyrctpqtt tocrrgctggg qgcctpl~bt ~t-kacu g-sgguaga a q c g t a w gaa*taacc~ gccsgetQgaa gat$mawc gtamckggta gaagctsctw c e w a w csgtggqmca tqctttqatg ctgaggcagc gcgcttcggg

Page 14: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

ID XX AC xx sv XX DT DT XX DE UE XX 0s OC: OC XX fW HP RX RA RA RA RA RA RA RA RA RA RA RA FLA PA m RT KY RL XX FH FH ZT FT FT FT FT FT FT FT FT FT FT FT F'I' FT FT FT FT E'T

AE021699 standard; DNA; PRO; 11301 BP.

28-MAY-2002 (Rel. 71, Created) 28-HAY-2002 ( R e l . 71, Last updated, Version 1)

Xanthomonas axonopodis pv. citri str . 306, section 77 of 470 of the complsre genome.

Xantbomonas axonopcdis pv. citxi str. 306 Bacteria; Protsobacteria; gamma subdivision; Xanthomonas group; Xanthomonas; Xanthomonas axonopodis; Xanthomonas axonopodis pv. citri.

t l l 1-11301 PUBMED; c;3J41:1.1,' . da S i i v a A . C ,R., Ferrn J.A., Reinach F.C., Farah C . S . , Fur lan L.B., Quaggio R . B . , Wvnteiro-Vitorello C . B . , Van S l u y s M.R., Almeida Jr N . F . , Alves L . M . C . , do Amaral A.M., Bertolini M.C., Camargo L.E.A., C a W r O t t e G . , Cannavan F., Cardozo J., Chambergo F., Ciapina L , P , , Cicarelli. R . M . B . , Coutinhu L.L,, Cursino-Sactos S.R., El-Dorry H . , Faria J . B . , Ferreira A . J . S . , Ferreira R.C.C., Fesro M . I . T . , Formighi.eri E.P., Fxanco M.C. , Greggio C . C . , Gruber A., Katsuyama A.M., Kishi L.T., Leite 3r R. P., Lemos E.G.M., Lemos M.V. F., btocali E.C., Machado M.A., Madeira A . M . B . N . , Hartinez-Rossi N . M . , Martins E . C . , Meidanis J., Menck C.I.W., Miyaki C . Y . , Moon D . H . , Mol-eira L.M., Navo M.T.M., Okusa V . R . , Ol ive ira M . C . , Oliveira V . A . , Pereira 3r H.A. , Rossi A . , Sena J. A. D., Silva C . , de Sauza R. F., Spinola L .A, F., T a k ~ . ta M.A., Tamura A.E. , Teixeira E , C . , Tezza P . . f . D . , Tricdade do5 Santos M., T r u f f i . O., Tsai S.M. , White F . F . , Setubal J . C . , Kitaji.ma 3.P.; "Campafisor~ of the genomes o f t w o Xanthomonas pathogens with differing host specificities"; Nature 417 (69871 :459-46312002) .

1. .I1301 /db-xref="taxon: : :: .; - -: " /n~ta-"~athovar:~-c~tri" /oryarlism-"Xanthomonas axonopodis pv, citsi str . 306" /strai.n="306" 10194..18913 /codon,,-s t ar t-1 /note-"identified by sequence similarity; putati.ve; ORF located u s i n g R l . a s t x / G I . imer/Gensrrrark" /transl-table-11 /gene~ '+xc~N*' /product-"type I1 secretion system p r o t e i n h"' / p ro te in id=". ::, , . - * / t ~~~~~~~~.~~="EFTWRWAI.,ILVSMAEVAI,IAPVPLRLVI,PREGLPFSVLDVEGPTW ACiTLRQVQW()G3:VfGDVAVRP~WPLtKGERRVQLQSTQLQ~,~f~LV~~;A(IREMKWAQGef~ LVRQPGGVAII 1 DIaAVQL#VI)LLFDATCrCVQAHGZVSTT~~I,ASGAGALPGLPPLRX~SG12 PACVDATAVLTLLPUTALPAWQAK~QLQIJWPDGRHIIL~'SRVDPA~~UAVLFVFEQT.~LGE' RATPERGELRNDEGRLR"

Larnpiran.4. OpenReadingF=ram~(ORF)genxcsNpenyandifypeIIsecrefion system protein N pada GenBenk (namor aksesi) AEUI f 699

Page 15: Analisis Sekuen DNA yang Terlibat dalam Patogenisitas dan ... · da Silva ACR et af. 2002. Comparison of the genomes of ... Lorenzo V, Herreru M, Jakubzik U, Timmis KN. 1990. Mini-TnS

XX SQ Sequence 11301 BP; 1801 A; 3562 C ; 3954 G; I984 T; 0 other;

gcacgcgagc agqgccaact ccgcgtacgc tgcgggtttg cggaatcggg accgtgacac gcatgcgctg ggccttgatc ttggtgtcga tggcgggcgt cgcgctgctg gcattrgfcc cgttgcgtct g#tgc:tgccg cgcgaggggc tgccgttctc ggtqctggat gtggagggcc cgatctgggc cggcacgttg cggcaggtgc aatqgcaaqg catcgtgrtc ggcgatgtgg cggtgcggcc gcaggtctgg ccgctgttgc gtggcgaacg tcgggtgcag ttgcagtcca cacagttgca actgctgttg gtggacggcg cgcaacgcgg catgcgcrat gcacagggcc aactcctggt gcgccagccg qgtggcgtgg cactgatcga tctggcggtg cagctgcagc aggtcgatct gctattcgnt gccaccggct gcgtgcaggc gcacgggcgt gtcagcctgc eattgctggc arrgcggggcg ggcgcgctgc ccggtctgcc gCCaCtgCgC ttgtccgggc agccggcgtg cgtggatcac accgccqtgc tgaccttgct gcccgacacc gcattgcccg ccqgcgtgca qgccaslggcg cagctgcaac tctggcccga cggacgctgg cnactgcagt cgcgcgtgga tccagcgcag gacgcagtgt tgggtgtcgg ac-ttg otgggatw ciqetactcc gpagop~ggg tttttgagen zmpatq- togattgcac tagaaacgct atgactggcg acgtgccaca gcgcccgtct tctgcaccat gatcgtgcat gcgttgcggc tggtatgttc gttgcggcga ttggatggcg tgtaggctca tccgttgaca acgttgtcgt cgtggcgcgg caagcagtca tcgcggcacg ggttcgcctg tgcraagtacc gcgatecgcg ctttggaata cacatgagca cgctgcgaag gacggtgacg cagccagcag tgtgcgacgt cggggccgcg acgtcgactg cccagaattg gtctggtcac aagcqaattgg tcagtgactg gtcatgtgac aacgatgccc agtgcgctcc cgatatcttr gcacgcaccg ttgcaggtca atqwggtsa ggatcgwtg c

//