In Vitro Analysis of Virus Particle Subpopulations in Candidate Live ...
An Update on a Candidate BK Virus DNA Standard Reference ...
1
Professional Template for a 100cm x 100cm poster presentation Your name and the names of the people who have contributed to this presentation go here. The names and addresses of the associated institutions go here. An Update on a Candidate BK Virus DNA Standard Reference Material Jo Lynne Harenza 1 , Justin A. Buck 1,2 , Linda Cook 3 , and Peter M. Vallone 1 1 Applied Genetics Group, National Institute of Standards and Technology, Gaithersburg, MD, 20899 2 South Carroll High School, Sykesville, MD, 21784 3 Molecular Virology Laboratory, University of Washington, Seattle, WA, 98102 Abstract The polyomavirus, BKV, is widespread in the population due to primary infection during childhood and largely remains latent in the majority of individuals. However, illnesses as a result of BKV occur in immunocompromised patients, organ transplant, HIV/AIDS-infected, or diabetic patients. Two common illnesses resulting from BKV, hemorrhagic cystitis and nephropathy, occur in transplant patients, as prescribed anti-rejection medications can weaken the immune system and this often ultimately leads to renal allograft failure. To treat BKV, accurate quantitation of viral load is necessary for proper adjustment of anti-rejection medications. Currently, no international “higher order” standard for BKV exists, making chronic monitoring of the virus difficult. Therefore, we propose a candidate standard reference material (SRM) to aid in precise measurements of viral load across laboratories and time. We have amplified and sequenced six full-length BKV genomes. Various primer and probe sets were designed and optimized for qPCR and digital PCR (dPCR). The availability of a panel of BKV DNA genotypes as potential reference materials will enable traceability for manufacturers of calibrant materials. This will ultimately improve upon the consistency and accuracy of viral load quantitation measurements across laboratories, leading to improved dosing regimens in infected patients. B Dorsal Development Strategies Utility of multiple strains Feedback from the clinical community triggered the design of a candidate reference material containing multiple genotypes. Viral DNA was extracted from six available clinical isolates with distinct genotypes (Ia, Ic, III, IV, V, VI) of the BK virus (Hoffman, et. al, 2008). Sample digestion by BamHI or EcoRI, followed by long-range PCR with Takara LA Taq DNA polymerase (Clontech) and genotype-specific primers surrounding BamHI or EcoRI, allowed amplification of some, but not all six genotypes (Figure 1). This was likely due to strain polymorphisms within primer binding sites and/or the existence of multiple, instead of single BamHI or EcoRI sites predicted from known sequence information. Scan the QR code to tell us your needs for DNA- or RNA-based reference materials! Contact Information: [email protected] Whole genome amplification using ϕ29 DNA polymerase (Epicentre) and random RNA hexamers, successfully amplified BKV genomes from each clinical isolate, Figure 2. Next- generation sequencing was performed using the Nextera XT library prep and MiSeq v3 600-cycle chemistry. Figure 2. Whole genome amplification of BKV genomes prior to NGS. Rolling circle amplification created BKV genome concatamers, which were either left in tact or digested with a single cut restriction enzyme (HhaI, EcoRI, or BamHI). Quality was assessed via the Agilent Bionalyzer, A, prior to NGS, B (representative of each cut genotype shown). Characterization Techniques Certification for concentration Digital PCR, which allows for the calculation of absolute copy number per volume, will be used to certify the BKV material for concentration. Further, multiple assays will be used across droplet digital and chamber digital platforms (ddPCR using BioRad QX100 and cdPCR using BioMark Fluidigm). Sequence Data Next-generation sequencing data will be provided in the SRM certificate as informational value. Assay optimization Seven BK-specific assays were designed and tested at 2-3 T m s (58, 60, 62, 64ºC) for qPCR, ddPCR, and cdPCR, Figure 7. — — — T G — G T C A G G C — — G — — — A — — G — — — C Figure 4. Concordance of BKV WGA-prepped clinical isolates with previously published Sanger sequence data. NGS identified previously ambiguous bases (red). Three nucleotides were discordant from previous Dunlop strain sequence data (blue). Genotype SNPs previously reported were confirmed, with the exception of genotype III (green), n=2-3 separate WGA preparations per clinical sample. Figure adapted from Hoffman, et. al, 2008. 0 25 50 75 100 0 25 50 75 100 0 25 50 75 100 0 25 50 75 100 0 25 50 75 100 0 25 50 75 100 Ia Ic III IV V VI 0 1000 2000 3000 4000 5000 Frequency [%] Type Deletion Insertion MNV SNV 0 1000 2000 3000 4000 5000 Genomic Region ori agno VP2 VP3 VP1 Large T small T Figure 3. NGS polymorphism distribution across the BKV genome for six genotypes. For each clinical isolate, 1-2 digested replicates and the non-digested replicate from WGA were used for NGS. Shown are polymorphisms in the non- digested samples, compared to the Dunlop strain, V01108.1. As expected, genotypes III and IV have the highest number of polymorphisms, as they are the most divergent of all of the genotypes. BK Verification of Isolate Genotypes prepared by WGA Following quality base trimming (Q<30) and alignment to the BK Dunlop strain, V01108.1, variant calling at a 5% frequency was performed with CLC Genomics Workbench, Figure 3. To determine concordance, the resulting variants were compared to two publications documenting genotype SNPs, Figure 4 and Table 1. Each sample had a minimum coverage of 1000x. Ia Ic III IV V VI Number of SNPs discordant 0 1 >10 >10 4 3 Number of new SNPs found 0 0 - - 1 1 Table 1. Concordance of WGA-prepped BKV clinical isolates with previously published Sanger sequence data. Of the 235 SNPs documented in Sharma, et. al, 2006, the Ia clinical isolate sequenced was the only concordant genotype. Conclusions and Future Directions Amplification and cloning challenges have prompted NIST to redirect its efforts to characterization of synthetic constructs, as they are easier to prepare, can be stored indefinitely in E. coli, and will allow for quicker production of reference materials. Additionally, we will be providing a JC virus construct along with the BKV construct. By integrating data from multiple assays and platforms, we can expand the measurement uncertainty, which may arise due to different master mixes and/or inconsistencies in droplet/chamber volumes. Figure 6. The target plasmid conformation matters for digital PCR. As observed in both ddPCR (C) and cdPCR (A, B, D), there are more targets amplifying at later cycles in the supercoiled plasmid compared to the linear plasmid. Further, at 60 cycles, the supercoiled plasmid is still being amplified (D), but the linear plasmid has fully amplified. Linear super coiled Linear Supercoiled 30 40 50 60 0.0 0.1 0.2 0.3 Fraction Positive Chambers Ct Linear Supercoiled A B C D Synthetic plasmid construct and preparation The wild-type BKV genomic sequence (Accession No. JQ713822.1) was synthesized, ligated into the pUC57 vector, and transformed into E. coli (Genewiz) in preparation for SRM production, Figure 5. The plasmid will be propagated in E. coli, giga-prepped, purified, and linearized with restriction enzymes unique to the pUC57 backbone, leaving the entire BKV sequence in tact. Linearization of the plasmid is necessary for accurate digital PCR quantitation, Figure 6. Figure 5. Candidate BKV SRM construct. Plasmid maps for the BKV WT sequence, JQ713822.1, pUC57, and candidate BKV SRM to be certified for concentration. b l a l a c Z p M B 1 re p l i c o n b l a l a c Z p M B 1 re p l i c o n 2710 bp pUC57-Amp te bla (Ap ) R MCS EcoRI SacI KpnI XbaI EcoRV BamHI XmaI SmaI ApaI SalI PstI StuI HindIII lacZ M13F(-47) M13F(-21) M13R rep (pMB1) BKV WT JQ713822.1 + + AdhI BsshII pUC57 BK WT Figure 7. BKV assays optimized for dPCR. Five (B, D, E, F, G) of seven assays designed within coding regions of the BKV genome, showed optimal positive/negative droplet separation and curve morphologies for dPCR (left panel) and cdPCR (right panel). Note: Assay A was not used for cdPCR. 3UREH *URXSV 3UREH *URXSV B C D E F G A B C D E F G Ladder NTC A B Ic V Ia III IV VI Figure 8. Certification of SRMs utilizing multiple assays. By treating the results of multiple assays across platforms as an interlaboratory study, we can use the DerSimonian-Laird approach to calculate a consensus value. G60 dd F60 dd C60 dd E60 dd B60 dd D60 dd E60 cd C60 cd D60 cd F60 cd B60 cd G60 cd 1.0 1.5 2.0 2.5 3.0 Billion Targets Consensus Value Assay Figure 1. Long-range PCR of six BKV clinical samples. 1.8% Agarose gel electrophoresis of long-range PCR products. Complete genomes of genotypes Ia, Ic, IV, and V (boxed in blue), but not genotypes III and VI, were successfully amplified. The Dunlop (Dun) and MM strains were used as Ia genotype positive controls. NTC = no template control, E = empty well. A B C E IV V NTC E MM Ia NTC (bp) 10,000 8,000 5,000 4,000 3,000 2,500 2,000 1,500 1,000 800 600 400 200 (bp) 10,000 8,000 5,000 4,000 3,000 2,500 2,000 1,500 1,000 800 600 400 200 (bp) 10,000 8,000 5,000 4,000 3,000 2,500 2,000 1,500 1,000 800 600 400 200
Transcript of An Update on a Candidate BK Virus DNA Standard Reference ...
Professional Template for a 100cm x 100cm poster presentation
Your name and the names of the people who have contributed to this presentation go here.The names and addresses of the associated institutions go here.
An Update on a Candidate BK Virus DNA Standard Reference Material Jo Lynne Harenza1, Justin A. Buck1,2, Linda Cook3, and Peter M. Vallone11Applied Genetics Group, National Institute of Standards and Technology, Gaithersburg, MD, 20899 2South Carroll High School, Sykesville, MD, 21784 3Molecular Virology Laboratory, University of Washington, Seattle, WA, 98102
AbstractThe polyomavirus, BKV, is widespread in the population due to primary infection during childhood and largely remains latent in the majority of individuals. However, illnesses as a result of BKV occur in immunocompromised patients, organ transplant, HIV/AIDS-infected, or diabetic patients. Two common illnesses resulting from BKV, hemorrhagic cystitis and nephropathy, occur in transplant patients, as prescribed anti-rejection medications can weaken the immune system and this often ultimately leads to renal allograft failure. To treat BKV, accurate quantitation of viral load is necessary for proper adjustment of anti-rejection medications. Currently, no international “higher order” standard for BKV exists, making chronic monitoring of the virus difficult. Therefore, we propose a candidate standard reference material (SRM) to aid in precise measurements of viral load across laboratories and time. We have amplified and sequenced six full-length BKV genomes. Various primer and probe sets were designed and optimized for qPCR and digital PCR (dPCR). The availability of a panel of BKV DNA genotypes as potential reference materials will enable traceability for manufacturers of calibrant materials. This will ultimately improve upon the consistency and accuracy of viral load quantitation measurements across laboratories, leading to improved dosing regimens in infected patients.
B
Dorsal
Development StrategiesUtility of multiple strains Feedback from the clinical community triggered the design of a candidate reference material containing multiple genotypes. !Viral DNA was extracted from six available clinical isolates with distinct genotypes (Ia, Ic, III, IV, V, VI) of the BK virus (Hoffman, et. al, 2008). Sample digestion by BamHI or EcoRI, followed by long-range PCR with Takara LA Taq DNA polymerase (Clontech) and genotype-specific primers surrounding BamHI or EcoRI, allowed amplification of some, but not all six genotypes (Figure 1). This was likely due to strain polymorphisms within primer binding sites and/or the existence of multiple, instead of single BamHI or EcoRI sites predicted from known sequence information.
Scan the QR code to tell us your needs for DNA- or RNA-based reference materials!
Contact Information: [email protected]
Whole genome amplification using ϕ29 DNA polymerase (Epicentre) and random RNA hexamers, successfully amplified BKV genomes from each clinical isolate, Figure 2. Next-generation sequencing was performed using the Nextera XT library prep and MiSeq v3 600-cycle chemistry.
Figure 2. Whole genome amplification of BKV genomes prior to NGS. Rolling circle amplification created BKV genome concatamers, which were either left in tact or digested with a single cut restriction enzyme (HhaI, EcoRI, or BamHI). Quality was assessed via the Agilent Bionalyzer, A, prior to NGS, B (representative of each cut genotype shown).
Characterization TechniquesCertification for concentration Digital PCR, which allows for the calculation of absolute copy number per volume, will be used to certify the BKV material for concentration. Further, multiple assays will be used across droplet digital and chamber digital platforms (ddPCR using BioRad QX100 and cdPCR using BioMark Fluidigm). !Sequence Data Next-generation sequencing data will be provided in the SRM certificate as informational value. !Assay optimization Seven BK-specific assays were designed and tested at 2-3 Tms (58, 60, 62, 64ºC) for qPCR, ddPCR, and cdPCR, Figure 7.
BKV verification of isolate genotypes
Hoffman, N. G., Cook, L., Atienza, E. E., Limaye, A. P., & Jerome, K. R. (2008). Marked Variability of BK Virus Load Measurement Using Quantitative Real-Time PCR among Commonly Used Assays. Journal of Clinical Microbiology, 46(8), 2671–2680. doi:10.1128/JCM.00258-08
FIG. 3. Alignments of primers and probes with consensus sequences of BKV subtypes. Sequences corresponding to forward primers (left),probes (center), and reverse primers (right) are shown for each primer/probe set, along with corresponding regions of consensus sequencesrepresenting BKV subtypes Ia, Ic, III, IV, V, and VI. V3a and T3a indicate sequences of the modified primers and probes derived from the V3and T3 sequences, respectively, used in the V3T3 assay. The numbers indicate positions in the BKV genome based on the Dunlop reference strain(GenBank accession no. V01108). Subtypes with consensus sequences identical to those of a given primer/probe set are omitted. Nucleotidesidentical to the primer sequence at each position are shown as periods. IUPAC ambiguity codes are used where the consensus sequence could notbe defined as a simple majority of sequences in a subtype. The codes used are defined as follows: S, G/C; Y, C/T; W, A/T. The position in the V2probe appearing below the asterisk is occupied by a modified base (Nanogen, Inc., personal communication). Sequences of all reverse primers andT1, V2, and T2 probes are shown as the reverse complements of the synthesized oligonucleotides.
2676 HOFFMAN ET AL. J. CLIN. MICROBIOL.
—
—
—T
G
—
G
TCA
G
G
Ambiguous bases were identified (red) Three nucleotide mistakes were found in the Dunlop strain (blue) Genotype SNPs previously reported were confirmed, with the exception of genotype III, where 1 SNP disagreed (green) 2-3 samples per genotype were sequenced and all SNPs were concordant
FIG. 3. Alignments of primers and probes with consensus sequences of BKV subtypes. Sequences corresponding to forward primers (left),probes (center), and reverse primers (right) are shown for each primer/probe set, along with corresponding regions of consensus sequencesrepresenting BKV subtypes Ia, Ic, III, IV, V, and VI. V3a and T3a indicate sequences of the modified primers and probes derived from the V3and T3 sequences, respectively, used in the V3T3 assay. The numbers indicate positions in the BKV genome based on the Dunlop reference strain(GenBank accession no. V01108). Subtypes with consensus sequences identical to those of a given primer/probe set are omitted. Nucleotidesidentical to the primer sequence at each position are shown as periods. IUPAC ambiguity codes are used where the consensus sequence could notbe defined as a simple majority of sequences in a subtype. The codes used are defined as follows: S, G/C; Y, C/T; W, A/T. The position in the V2probe appearing below the asterisk is occupied by a modified base (Nanogen, Inc., personal communication). Sequences of all reverse primers andT1, V2, and T2 probes are shown as the reverse complements of the synthesized oligonucleotides.
2676 HOFFMAN ET AL. J. CLIN. MICROBIOL.
BKV verification of isolate genotypes
Hoffman, N. G., Cook, L., Atienza, E. E., Limaye, A. P., & Jerome, K. R. (2008). Marked Variability of BK Virus Load Measurement Using Quantitative Real-Time PCR among Commonly Used Assays. Journal of Clinical Microbiology, 46(8), 2671–2680. doi:10.1128/JCM.00258-08
C
——
G
———
A
——
G
———
C
Figure 4. Concordance of BKV WGA-prepped clinical isolates with previously published Sanger sequence data. NGS identified previously ambiguous bases (red). Three nucleotides were discordant from previous Dunlop strain sequence data (blue). Genotype SNPs previously reported were confirmed, with the exception of genotype III (green), n=2-3 separate WGA preparations per clinical sample. Figure adapted from Hoffman, et. al, 2008.
0255075100
0255075100
0255075100
0255075100
0255075100
0255075100
IaIc
IIIIV
VVI
0 1000 2000 3000 4000 5000
Freq
uenc
y [%
]
Type Deletion Insertion MNV SNV
0 1000 2000 3000 4000 5000Genomic Region
ori agno VP2VP3 VP1
Large T small T
Figure 3. NGS polymorphism distribution across the BKV genome for six genotypes. For each clinical isolate, 1-2 digested replicates and the non-digested replicate from WGA were used for NGS. Shown are polymorphisms in the non-digested samples, compared to the Dunlop strain, V01108.1. As expected, genotypes III and IV have the highest number of polymorphisms, as they are the most divergent of all of the genotypes.
BK Verification of Isolate Genotypes prepared by WGA Following quality base trimming (Q<30) and alignment to the BK Dunlop strain, V01108.1, variant calling at a 5% frequency was performed with CLC Genomics Workbench, Figure 3. To determine concordance, the resulting variants were compared to two publications documenting genotype SNPs, Figure 4 and Table 1. Each sample had a minimum coverage of 1000x.
Ia Ic III IV V VINumber of SNPs discordant 0 1 >10 >10 4 3Number of new SNPs found 0 0 - - 1 1
Table 1. Concordance of WGA-prepped BKV clinical isolates with previously published Sanger sequence data. Of the 235 SNPs documented in Sharma, et. al, 2006, the Ia clinical isolate sequenced was the only concordant genotype.
Conclusions and Future DirectionsAmplification and cloning challenges have prompted NIST to redirect its efforts to characterization of synthetic constructs, as they are easier to prepare, can be stored indefinitely in E. coli, and will allow for quicker production of reference materials. Additionally, we will be providing a JC virus construct along with the BKV construct. By integrating data from multiple assays and platforms, we can expand the measurement uncertainty, which may arise due to different master mixes and/or inconsistencies in droplet/chamber volumes.
Figure 6. The target plasmid conformation matters for digital PCR. As observed in both ddPCR (C) and cdPCR (A, B, D), there are more targets amplifying at later cycles in the supercoiled plasmid compared to the linear plasmid. Further, at 60 cycles, the supercoiled plasmid is still being amplified (D), but the linear plasmid has fully amplified.
Linear supercoiled
Linear Supercoiled
30
40
50
60
0.0 0.1 0.2 0.3Fraction Positive Chambers
Ct
Sample Linear Supercoiled
Linear
Supercoiled
A B !!!!!!!! C D
Synthetic plasmid construct and preparation The wild-type BKV genomic sequence (Accession No. JQ713822.1) was synthesized, ligated into the pUC57 vector, and transformed into E. coli (Genewiz) in preparation for SRM production, Figure 5. The plasmid will be propagated in E. coli, giga-prepped, purified, and linearized with restriction enzymes unique to the pUC57 backbone, leaving the entire BKV sequence in tact. Linearization of the plasmid is necessary for accurate digital PCR quantitation, Figure 6.
Figure 5. Candidate BKV SRM construct. Plasmid maps for the BKV WT sequence, JQ713822.1, pUC57, and candidate BKV SRM to be certified for concentration.
bla
lacZ
pMB
1re
plic
o n
bla
lacZ
pMB
1re
plic
o n2710 bppUC57-Amp
pUC57-Amp Vector Map
Multiple Cloning Site
HindIIIStuIPstISalI
ApaISmaI
XmaIBamHI
EcoRVXbaIKpnISacIEcoRI
CGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCTCGCGAATGCATCTAGATATCGGATCCCGGGCCCGTCGACTGCAGAGGCCTGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTG5'
M13F (-21) M13RM13F (-47)
bla(A
p )R
MCS
EcoRISacIKpnIXbaIEcoRVBamHIXmaISmaIApaISalIPstIStuIHindIII
lacZ
M13F(-47)
M13F(-21) M13R
M13F(-21): 5'-d(TGT AAA ACG ACG GCC AGT)-3'M13F(-47): 5'-d(CGC CAG GGT TTT CCC AGT CAC GAC)-3'M13R: 5'-d(CAG GAA ACA GCT ATG AC)-3'
rep(pM
B1)
GENEWIZ, Inc.115 Corporate BoulevardSouth Plainfield, NJ 07080p (877) GENEWIZ (436-3949)f (908) 333-4511www.genewiz.com
BKV WTJQ713822.1 +
+ AdhI BsshII
pUC57
BK WT
Figure 7. BKV assays optimized for dPCR. Five (B, D, E, F, G) of seven assays designed within coding regions of the BKV genome, showed optimal positive/negative droplet separation and curve morphologies for dPCR (left panel) and cdPCR (right panel). Note: Assay A was not used for cdPCR.
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
U&RQF�7\SH1DPH6DPSOH3DQHO��
'HWHFWRU�V�
����������������
(VW��7DUJHWV���8(VW��7DUJHWV���/(VW�7DUJHWVQ9ROXPH&RXQW
������������5DQJH�0D[5DQJH�0LQ7KUHVKROG
'HWHFWRU�7\SH'HWHFWRU�1DPH)$0�0*%
3UREH�*URXS�V�
B C D !!! E F G
A B C D E F G
Illumina MiSeq!
All genotypes were successfully amplified with RCA using ɸ29 polymerase
• Agilent Bioanalyzer confirmed amplification of all 6 BKV clinical isolates (~5kb following digestion with either BamHI or HhaI)
Ladder 155 225 123 152 62 41 NTC A B Ic V Ia III IV VI
Figure 8. Certification of SRMs utilizing multiple assays. By treating the results of multiple assays across platforms as an interlaboratory study, we can use the DerSimonian-Laird approach to calculate a consensus value.
G60
dd
F60
dd
C60
dd
E60
dd
B60
dd
D60
dd
E60
cd
C60
cd
D60
cd
F60
cd
B60
cd
G60
cd
1.0
1.5
2.0
2.5
3.0
Billio
n Ta
rget
s Consensus
Value
Assay
Figure 1. Long-range PCR of six BKV clinical samples. 1.8% Agarose gel electrophoresis of long-range PCR products. Complete genomes of genotypes Ia, Ic, IV, and V (boxed in blue), but not genotypes III and VI, were successfully amplified. The Dunlop (Dun) and MM strains were used as Ia genotype positive controls. NTC = no template control, E = empty well.
A B CE IV V NTC E MM Ia NTC
(bp)10,000
8,0005,0004,0003,0002,5002,0001,500!1,000
800600400!200
!(bp)
10,0008,0005,0004,0003,0002,5002,0001,500!1,000
800600
400
200
!(bp)
10,0008,0005,0004,0003,0002,5002,0001,500!1,000
800600400!200
